Engineering mesenchymal stem cell and application thereof

Abstract

The human umbilical cord MSCs knocked down and expressing the METTL1 gene are constructed through lentivirus infection, secretion of NAMPT can be promoted, SIRT1 can be activated, accordingly, an SREBP1-mediated adipogenesis gene is inhibited, liver cell lipid accumulation is remarkably reduced in in-vitro and in-vivo MASLD models, and metabolic dysfunction related fatty liver diseases and insulin resistance are improved and treated.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of stem cell technology, in particular to an engineered mesenchymal stem cell and application thereof. BACKGROUND

[0002] Metabolic dysfunction-associated steatohepatitis (MASLD) is characterized by intracellular lipid accumulation and degeneration of hepatocytes, and its pathological progression includes simple steatosis, steatohepatitis, liver fibrosis, and even cirrhosis. In recent years, the global prevalence of MASLD has continued to rise, affecting more than 30% of the adult population, and has become a major public health challenge. Currently, only Resmetirom has been approved for MASLD management, and there are limited clinical treatment options. Therefore, it is urgent to develop new drug targets and innovative treatment strategies.

[0003] Mesenchymal stem cells (MSCs) can be used as a promising tool for disease treatment through the secretion of cytokines, release of extracellular vesicles, and immunomodulation. Recent studies have focused on gene modification or pretreatment strategies to optimize the intrinsic properties and secretion profile of MSCs, improve their survival rate and secretion function, and enhance their therapeutic efficacy. For example, knocking out the autophagy-related gene ATG5 can enhance the secretion of hepatocyte growth factor (HGF) in adipose-derived MSCs, thereby playing a role in preventing fatty liver disease.

[0004] N7-methylguanine (m7G) is a post-transcriptional modification mediated by methyltransferase, which is widely distributed in tRNA, rRNA and mRNA of eukaryotic cells, and is closely related to the occurrence and development of various diseases. METTL1, as a core m7G methyltransferase, can participate in the progression of liver cancer by regulating tRNA m7G modification. Studies have shown that METTL1 can promote colorectal cancer cell proliferation by inhibiting CHEK2-mediated G1 / S phase arrest, while its knockout can inhibit the proliferation of hepatocellular carcinoma (HCC) and promote apoptosis, and reverse the resistance to lenvatinib. However, the effect of METTL1 on MASLD is still unknown. SUMMARY

[0005] To solve the above problems, the first aspect of the present application provides an engineered mesenchymal stem cell, wherein the engineered mesenchymal stem cell has a knockdown expression of METTL1 gene.

[0006] As a preferred technical solution, the concentration of the engineered mesenchymal stem cell is 1 x 10 5 to 1 x 10 8 per mL.

[0007] As a preferred technical solution, the engineered mesenchymal stem cell is derived from human umbilical cord.

[0008] As a preferred technical solution, the expression copy number of the METTL1 gene of the engineered mesenchymal stem cell is reduced by more than 70%.

[0009] In a second aspect of the present application, a pharmaceutical preparation is provided, which comprises an engineered mesenchymal stem cell that knocks down the expression of a METTL1 gene.

[0010] As a preferred technical solution, the pharmaceutical preparation further comprises a cell protective agent, a freeze-drying protective agent, a cytokine, a pH stabilizer, an osmotic pressure regulator, and an excipient. The cell protective agent is, for example, albumin or glycerol; the freeze-drying protective agent is, for example, sucrose or trehalose; the cytokine is, for example, hepatocyte growth factor; the osmotic pressure regulator is, for example, sodium chloride; and the excipient is, for example, an amino acid.

[0011] In a third aspect of the present application, the use of the engineered mesenchymal stem cell in the preparation of a medicament for treating metabolic dysfunction-related fatty liver disease is provided, wherein the engineered mesenchymal stem cell knocks down the expression of a METTL1 gene.

[0012] In a fourth aspect of the present application, the use of the engineered mesenchymal stem cell in the preparation of a medicament for improving insulin resistance is provided, wherein the engineered mesenchymal stem cell knocks down the expression of a METTL1 gene.

[0013] In a fifth aspect of the present application, a preparation method of an engineered mesenchymal stem cell is provided, which comprises the following steps: Step S1, cell culture: MSCs are cultured in a culture medium for 3-5 generations to obtain cells A; Step S2, lentivirus infection: a shRNA lentivirus plasmid vector targeting a human METTL1 gene is transfected into 293T cells to package viruses, and after transfection, lentivirus particles are collected to infect cells A to obtain cells B; Step S3, puromycin resistance screening: cells B are subjected to resistance screening using puromycin to obtain MSCs shMETTL1 .

[0014] As a preferred technical solution, the MSCs in step S1 are derived from human umbilical cords; the MSCs are CP-CL11 cell lines purchased from Procell (China); the culture medium is a DMEM culture medium purchased from Hyclone; 10% (volume ratio) fetal bovine serum (FBS) and 1% (volume ratio) penicillin or streptomycin are added to the culture medium; the fetal bovine serum, penicillin, and streptomycin are purchased from Gibco; the culture temperature is 37℃, at a concentration of 5% (volume ratio) and saturated humidity.

[0015] As a preferred technical solution, the lentivirus plasmid vector in the step S2 is provided by Han Heng Biotechnology Co., Ltd.; the transfection reagent is Lipofectamine 3000 (Thermo, L3000015, USA); and the infection multiplicity (MOI) is 1:1.

[0016] As a preferred technical solution, the puromycin concentration in the step S3 is 2 μg / mL, and the screening time is 72 hours.

[0017] The present application constructs human umbilical cord MSCs with knocked-down METTL1 gene expression by lentivirus transfection, promotes the secretion of NAMPT, activates SIRT1, thereby inhibits SREBP1-mediated lipogenic genes, significantly reduces hepatocyte lipid accumulation in MASLD models in vitro and in vivo, and improves and treats metabolic dysfunction-related fatty liver disease and insulin resistance. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 METTL1 mRNA and protein expression of MSC shMETTL1 of Example 1 shGFP ; wherein, Figure 1 A is the mRNA expression amount; Figure 1 B is the Western blotting; Figure 1 C is the protein expression amount; shMETTL1 represents MSC shMETTL1 , and shGFP represents MSC shGFP . Figure 2 METTL1 mRNA and protein expression of MSC shMETTL1 of Example 1 shGFP ; wherein, Figure 2 A is Nile red staining, scale bar 20 μm, FFA+ indicates free fatty acid treatment, and FFA- indicates no free fatty acid treatment; Figure 2 B is the TG content in hepatocytes; Figure 2 C is the Western blotting and analysis of lipid metabolism-related proteins in the AML12 cell co-culture system, wherein Figure 2 the left side of C is the Western blotting, Figure 2 and the right side of C is the statistical analysis of protein expression amount; Figure 2 D is the Western blotting and analysis of lipid metabolism-related proteins in the HepG2 cell co-culture system, wherein Figure 2 the left side of D is the Western blotting, Figure 2 and the right side of D is the statistical analysis of protein expression amount; Figure 2 E is the expression amount of lipid metabolism-related genes in the AML12 cell co-culture system; Figure 2F is the expression level of lipid metabolism related genes in HepG2 cell co-culture system; Figure 3 Example 1 MSC shMETTL1 and Comparative Example 1 MSC shGFP Data comparison chart of treating MASLD; Figure 3 A is the body weight of mice; Figure 3 B is the food intake of mice; Figure 3 C is the liver weight; Figure 3 D is the liver weight ratio; Figure 3 E is the fasting blood glucose level; Figure 3 F is the analysis of GTT and ITT results of different groups; Figure 3 G is the measurement results of serum ALT and AST; Figure 3 H is the HE and oil red O staining chart of mouse liver tissue, the scale is 100 μm; Figure 3 I is the TG content in mouse serum and liver tissue; Figure 3 J is the qPCR results of lipid synthesis related genes; Figure 3 K is the immunoblot analysis of lipid metabolism related proteins in mouse liver tissue in different groups, wherein Figure 3 K left is the immunoblot, Figure 3 K right is the statistical analysis of protein expression; Figure 4 Comparative Example 2 MSC AD-METTL1 and Comparative Example 3 MSC AD-GFP Data comparison chart of affecting MASLD; Figure 4 A is the HE and oil red O staining chart of mouse liver tissue, the scale is 100 μm; Figure 4 B is the measurement results of TG in serum and liver tissue; Figure 4 C is the qPCR results of lipid synthesis related genes; Figure 4 D is the immunoblot analysis of proteins related to lipid metabolism and NAMPT / SIRT1 signal transduction in mouse liver tissue; Figure 4 D left is the protein immunoblot, Figure 4 D right is the protein expression analysis; in all statistical analyses, a single data point represents a single mouse, and the data is expressed as mean ± S.E.M; Figure 5 NAMPT / SIRT1 / SREBP1 mediated MSC shMETTL1 Experimental data for improving MASLD; wherein, Figure 5 A-C are IF staining charts of NAMPT, SIRT1 and SREBP1 in HepG2 cells after cell co-culture, the scale is 20 μm; Figure 5 E is the immunoblot of NAMPT, SIRT1 and SREBP1 proteins in HepG2 cells after cell co-culture;Figure 5 F is the analysis of NAMPT, SIRT1 and SREBP1 protein expression in HepG2 cells after co-culture with cells; Figure 5 G is the NAD+ content in liver cells; Figure 5 H-J are the IF staining images of NAMPT, SIRT1 and SREBP1 in liver tissues of mice after cell transplantation, with a scale of 100 μm; Figure 5 K is the Western blot of NAMPT, SIRT1 and SREBP1 proteins in liver tissues of mice after cell transplantation; Figure 5 L is the analysis of NAMPT, SIRT1 and SREBP1 protein expression in liver tissues of mice after cell transplantation; Figure 5 M is the NAD+ content in liver tissues of mice; for all statistical charts, data are expressed as mean ± S.E.M., and statistical significance is shown in the figure; Figure 6 MSC treated with FK866 shMETTL1 Experimental data on the impact of MASLD; Figure 6 A is the body weight of mice after cell transplantation; Figure 6 B is the food intake of mice after cell transplantation; Figure 6 C is the liver weight and liver / body ratio of mice; Figure 6 D is the fasting blood glucose level of mice; Figure 6 E is the GTT and ITT analysis; Figure 6 F is the measurement of serum ALT and AST; Figure 6 G is the HE and oil red O staining images of liver tissues of mice, with a scale of 100 μm; Figure 6 H is the measurement of TG in serum and liver tissues; Figure 6 I is the Western blot analysis of proteins related to lipid metabolism and NAMPT / SIRT1 signaling in liver tissues of mice; wherein, Figure 6 I left is the Western blot of proteins related to lipid metabolism and NAMPT / SIRT1 signaling in liver tissues of mice; Figure 6 I right is the analysis of protein expression related to lipid metabolism and NAMPT / SIRT1 signaling in liver tissues of mice; for all statistical charts, individual data points represent individual mice, and data are expressed as mean ± S.E.M. DETAILED DESCRIPTION

[0019] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the applicant analyzes and explains through examples.

[0020] In the present application, METTL1-deficient mesenchymal stem cells and METTL1-knocked-down mesenchymal stem cells have the same meaning.

[0021] The corresponding relationship of abbreviations in the present application is as follows: MSCs: mesenchymal stem cells; MASLD: metabolic dysfunction-associated fatty liver disease; HFD: high-fat diet; FFA: free fatty acid; EdU: 5-ethynyl-2'-deoxyuridine; βgal: β-galactosidase; TGs: triglycerides; ALT: alanine aminotransferase; AST: aspartate aminotransferase; GTT: glucose tolerance test; ITT: insulin tolerance test; NCD: normal chow diet.

[0022] Example 1: Preparation of mesenchymal stem cells with knockdown of METTL1 expression Step S1, cell culture: MSCs were cultured in culture medium for 3-5 generations to obtain cell A; The MSCs were derived from human umbilical cord; the MSCs were CP-CL11 cell line purchased from Procell (China); the culture medium was DMEM culture medium purchased from Hyclone; 10% (by volume) fetal bovine serum (FBS) and 1% (by volume) penicillin or streptomycin were added to the culture medium; the fetal bovine serum, penicillin, and streptomycin were purchased from Gibco; the culture temperature was 37°C, at a concentration of 5% (by volume); the culture was saturated humidity; Step S2, lentivirus infection: a shRNA lentivirus plasmid vector (PLVshMETTL1) carrying a target human METTL1 gene was transfected into 293T cells to package the virus, and the lentivirus particles were collected after transfection to infect cell A to obtain cell B; the lentivirus plasmid vector was provided by Hanheng Biotechnology Co., Ltd.; the transfection reagent was Lipofectamine 3000 (Thermo, L3000015, USA); the multiplicity of infection (MOI) was 1:1; the shRNA targeting the human METTL1 gene was shMETTL1-1, and the sequence of shMETTL1-1 was GATGACCCAAAGGATAAGAAA; The specific method of transfection was as follows: the shRNA lentivirus plasmid vector targeting the human METTL1 gene was mixed with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G at a mass ratio of 4:3:1 (total plasmid amount 16 μg), and a Lipofectamine 3000 transfection reagent (30 μL) was used to form a complex in Opti-MEM medium, which was transfected into 293T cells with a confluence of 70-80% (seeding density cells / 10 cm dish); after 6 hours of transfection, the complete culture medium was replaced, and the supernatant containing virus particles was collected twice at 48 hours and 72 hours after transfection, and then filtered through a 0.45 μm filter membrane to obtain high-titer lentivirus particles; Step S3, puromycin resistance screening: puromycin was used for resistance screening of cell B to obtain MSCshMETTL1 ; the puromycin concentration is 2 μg / mL, and the screening time is 72 hours.

[0023] The mesenchymal stem cells with knocked down expression of METTL1 prepared in Example 1 are denoted as MSC shMETTL1 .

[0024] Preparation of mesenchymal stem cells expressing GFP Step S1, cell culture: MSCs are cultured in a culture medium for 3-5 generations to obtain cells A; the MSCs are derived from human umbilical cord; the MSCs are CP-CL11 cell line purchased from Procell (China); the culture medium is DMEM culture medium purchased from Hyclone; 10% (by volume) fetal bovine serum (FBS) and 1% (by volume) penicillin or streptomycin are added to the culture medium; the fetal bovine serum, penicillin and streptomycin are purchased from Gibco; the culture temperature is 37°C, at a concentration of 5% (by volume) and saturated humidity; Step S2, lentivirus infection: a lentivirus plasmid vector carrying a GFP gene is transfected into 293T cells to package virus, and after transfection, lentivirus particles are collected and used to infect cells A to obtain cells B; the lentivirus plasmid vector is provided by Hanheng Biotechnology Co., Ltd.; the transfection reagent is Lipofectamine 3000 (Thermo, L3000015, USA); the multiplicity of infection (MOI) is 1:1; The specific method for transfection is as follows: a shRNA lentivirus plasmid vector targeting the GFP gene is mixed with a packaging plasmid psPAX2 and an envelope plasmid pMD2.G at a mass ratio of 4:3:1 (total plasmid amount 16 μg), a Lipofectamine 3000 transfection reagent (20 μL) is used to form a complex in Opti-MEM medium, and the complex is transfected into 293T cells (seeding density of 1.5 x 105cells / 10 cm dish) with a confluence of 70-80%; after 6 hours of transfection, the complete culture medium is replaced, and the supernatant containing virus particles is collected twice at 48 hours and 72 hours after transfection, and then filtered through a 0.45 μm filter membrane to obtain high-titer lentivirus particles; Step S3, puromycin resistance screening: cells B are subjected to resistance screening using puromycin to obtain MSC shGFP ; the puromycin concentration is 2 μg / mL, and the screening time is 72 hours.

[0025] The mesenchymal stem cells expressing GFP prepared in Comparative Example 1 are denoted as MSC shGFP .

[0026] Preparation of mesenchymal stem cells overexpressing METTL1 Step S1, cell culture: MSCs were cultured in culture medium for 3-5 generations to obtain cell A; the MSCs were derived from human umbilical cord; the MSCs were CP-CL11 cell line, purchased from Procell (China); the culture medium was DMEM culture medium, purchased from Hyclone; 10% (v / v) fetal bovine serum (FBS) and 1% (v / v) penicillin or streptomycin were added to the culture medium; the fetal bovine serum, penicillin and streptomycin were purchased from Gibco; the culture temperature was 37°C, at a concentration of 5% (v / v) and saturated humidity; Step S2, adenovirus infection: an adenovirus vector carrying human METTL1 full-length coding sequence was transfected into 293A cells to package virus, and after transfection, adenovirus particles were collected to infect cell A to obtain MSC AD-METTL1 ; the adenovirus vector was provided by Hanheng Biotechnology Co., Ltd.; the multiplicity of infection (MOI) was 100:1; the adenovirus vector carrying human METTL1 full-length coding sequence was driven by CMV strong promoter to express genes.

[0027] The MSC AD-METTL1 overexpressing METTL1 prepared in Comparative Example 2 was used as a test control for Comparative Example 3.

[0028] Comparative Example 3: preparation of MSCs overexpressing GFP Step S1, cell culture: MSCs were cultured in culture medium for 3-5 generations to obtain cell A; the MSCs were derived from human umbilical cord; the MSCs were CP-CL11 cell line, purchased from Procell (China); the culture medium was DMEM culture medium, purchased from Hyclone; 10% (v / v) fetal bovine serum (FBS) and 1% (v / v) penicillin or streptomycin were added to the culture medium; the fetal bovine serum, penicillin and streptomycin were purchased from Gibco; the culture temperature was 37°C, at a concentration of 5% (v / v) and saturated humidity; Step S2, adenovirus infection: an adenovirus vector carrying GFP full-length coding sequence was transfected into 293A cells to package virus, and after transfection, adenovirus particles were collected to infect cell A to obtain MSC AD-GFP ; the adenovirus vector was provided by Hanheng Biotechnology Co., Ltd.; the multiplicity of infection (MOI) was 100:1; the adenovirus vector carrying GFP full-length coding sequence was driven by CMV strong promoter to express genes.

[0029] The MSC AD-GFP overexpressing GFP prepared in Comparative Example 2 was used as a test control for Comparative Example 3.

[0030] The inventors systematically verified MSCshMETTL1 Effects and roles in treating MASLD.

[0031] I. MSCs shMETTL1 Effects of co-culture with MSCs on lipid synthesis in hepatocytes of lipid accumulation model Using the co-culture system of MSCs and hepatocytes in vitro, the effects of MSCs shMETTL1 on the regulation of lipid metabolism in hepatocytes were studied.

[0032] 1. Experimental methods 1.1 Co-culture system of hepatocytes and MSCs A co-culture model of human HepG2 hepatocytes and mesenchymal stem cells (MSCs) was established using a Transwell system (Corning, China).

[0033] A co-culture model of mouse AML12 hepatocytes and mesenchymal stem cells (MSCs) was established using a Transwell system (Corning, China).

[0034] Human HepG2 hepatocytes (CL-0103) and mouse AML12 hepatocytes (CL-0602) were purchased from Procell China Co., Ltd.

[0035] The specific operation is as follows: Test group: Hepatocytes (HepG2 or AML12) were inoculated in the lower chamber of the Transwell system, and DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin was used to culture at 37°C, 5% % saturated humidity in an incubator. To construct a lipid accumulation model, oleic acid (O1008, Sigma) and palmitic acid (P5585, Sigma) were mixed at a molar ratio of 2:1, dissolved in PBS containing 1% bovine serum albumin (BSA), and prepared into a 400 μM free fatty acid (FFA) working solution. After 24 hours of FFA treatment of hepatocytes, MSCs shMETTL1 were inoculated in the upper chamber of the Transwell, and co-cultured for 24 hours. Subsequently, the co-culture system was treated with 400 μM FFA for another 24 hours. After termination of the experiment, hepatocytes in the lower chamber were collected for analysis. FFA+ / MSC shMETTL1 was used to represent.

[0036] Test control group: Hepatocytes (HepG2 or AML12) were inoculated in the lower chamber of the Transwell system, and DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin was used to culture at 37°C, 5% The cells were incubated in a 37°C, 5% CO2 and saturated humidity incubator. To construct the lipid accumulation model, oleic acid (O1008, Sigma) and palmitic acid (P5585, Sigma) were mixed at a 2:1 molar ratio, dissolved in PBS containing 1% bovine serum albumin (BSA), and prepared into a 400 μΜ free fatty acid (FFA) working solution. After the hepatocytes were treated with FFA for 24 hours, the MSCs shGFP The cells were incubated in a 37°C, 5% CO2 and saturated humidity incubator. To construct the lipid accumulation model, oleic acid (O1008, Sigma) and palmitic acid (P5585, Sigma) were mixed at a 2:1 molar ratio, dissolved in PBS containing 1% bovine serum albumin (BSA), and prepared into a 400 μΜ free fatty acid (FFA) working solution. After the hepatocytes were treated with FFA for 24 hours, the MSCs shMETTL1 The cells were incubated in a 37°C, 5% CO2 and saturated humidity incubator. To construct the lipid accumulation model, oleic acid (O1008, Sigma) and palmitic acid (P5585, Sigma) were mixed at a 2:1 molar ratio, dissolved in PBS containing 1% bovine serum albumin (BSA), and prepared into a 400 μΜ free fatty acid (FFA) working solution. After the hepatocytes were treated with FFA for 24 hours, the MSCs

[0037] Positive control group: Hepatocytes (HepG2 or AML12) were seeded in the lower chamber of the Transwell system, and were cultured in a 37°C, 5% CO2 and saturated humidity incubator using DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. After 24 hours, the medium was replaced with fresh medium containing 400 μΜ FFA, and the cells were cultured for another 24 hours. After the experiment was terminated, the hepatocytes in the lower chamber were collected for analysis. This is represented as FFA+ / BSA. The cells were incubated in a 37°C, 5% CO2 and saturated humidity incubator. To construct the lipid accumulation model, oleic acid (O1008, Sigma) and palmitic acid (P5585, Sigma) were mixed at a 2:1 molar ratio, dissolved in PBS containing 1% bovine serum albumin (BSA), and prepared into a 400 μΜ free fatty acid (FFA) working solution. After the hepatocytes were treated with FFA for 24 hours, the MSCs

[0038] Negative control group: Hepatocytes (HepG2 or AML12) were seeded in the lower chamber of the Transwell system, and were cultured in a 37°C, 5% CO2 and saturated humidity incubator using DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. After 24 hours, the medium was replaced with fresh medium containing 400 μΜ FFA, and the cells were cultured for another 24 hours. After the experiment was terminated, the hepatocytes in the lower chamber were collected for analysis. This is represented as FFA-. The cells were incubated in a 37°C, 5% CO2 and saturated humidity incubator. To construct the lipid accumulation model, oleic acid (O1008, Sigma) and palmitic acid (P5585, Sigma) were mixed at a 2:1 molar ratio, dissolved in PBS containing 1% bovine serum albumin (BSA), and prepared into a 400 μΜ free fatty acid (FFA) working solution. After the hepatocytes were treated with FFA for 24 hours, the MSCs

[0039] The effects of MSCs on the lipid metabolism of hepatocytes and the expression of related genes and proteins under FFA intervention were systematically evaluated using techniques such as Nile red staining, triglyceride (TG) content determination, qPCR, Western Blot, and immunofluorescence staining. shMETTL1 The effects of MSCs on the lipid metabolism of hepatocytes and the expression of related genes and proteins under FFA intervention were systematically evaluated using techniques such as Nile red staining, triglyceride (TG) content determination, qPCR, Western Blot, and immunofluorescence staining.

[0040] 1.2 Quantitative PCR analysis of mRNA expression Following the manufacturer's standard procedure, total RNA was extracted from cells using TRIzol reagent (DP424, Tiangen Biotech, China), and the extracted RNA was reverse transcribed into cDNA using the PrimerScript RT kit (KR116, Tiangen Biotech, China). Subsequently, real-time quantitative PCR (qPCR) and data analysis were performed on an ABI 7500 system using the SYBR Green kit (FP201, Tiangen Biotech, China). The expression level of the target mRNA was quantified using the Δ-ΔCt method, and normalized using GAPDH as an internal reference gene.

[0041] 1.3 Western blot analysis of protein expression levels Total protein was extracted from cells using RIPA lysis buffer (P0013B, Beyotime, China) with the addition of a protease inhibitor mixture (P1005, Beyotime, China) and a phosphatase inhibitor (P1045, Beyotime, China). Protein concentration was determined using a BCA protein quantification kit (P0012S, Beyotime, China). Equal volumes of protein samples were separated by 10% SDS-polyacrylamide gel electrophoresis and transferred to PVDF membranes. The membranes were blocked in PBS containing 5% skim milk at room temperature for 1 hour to prevent non-specific binding, followed by overnight incubation with a specific primary antibody against the target protein at 4°C. After washing, the membranes were incubated with HRP-labeled secondary antibody at room temperature for 1 hour. Finally, the target protein was detected by enhancing chemiluminescence imaging. ImageJ software was used to analyze the grayscale values ​​of protein bands, and normalization was performed using β-tubulin or β-actin as internal controls.

[0042] 1.4 Nile Red Staining Hepatocytes were fixed with 4% paraformaldehyde (PFA), then stained with Nile Red (Sigma) for 15 minutes at room temperature, and the nuclei were counterstained with DAPI for 5 minutes. Images of the stained samples were acquired using a confocal laser scanning microscope.

[0043] 1.5 Quantitative determination of triglyceride content Following the manufacturer's standard operating procedures, the triglyceride (TG) content in hepatocytes was quantitatively determined using a commercial kit (A110, Jiancheng, Jiangsu, China).

[0044] 1.6 Statistical Analysis All experiments were independently repeated three times. Quantitative data are expressed as mean ± SEM, and results were rounded to three decimal places. Statistical analysis was performed using GraphPad Prism software: one-way ANOVA was used for comparisons among multiple groups, and Tukey's post-hoc test was further performed.

[0045] 2. Experimental Results and Analysis The results are as follows.

[0046] MSC prepared in Example 1 shMETTL1 METTL1 mRNA expression was significantly lower than that of MSC of Comparative Example 1 shGFP The results are as follows. Figure 1 A.

[0047] MSC prepared in Example 1 shMETTL1 METTL1 protein expression was significantly lower than that of MSC of Comparative Example 1 shGFP The results are as follows. Figure 1 B, Figure 1 C.

[0048] MSC shMETTL1 significantly reduced the lipid content in hepatocytes exposed to FFA, indicating that MSC shMETTL1 inhibited lipid synthesis in hepatocytes. The results are as follows. Figure 2 A.

[0049] MSC shMETTL1 significantly reduced triglycerides in hepatocytes exposed to FFA, indicating that MSC shMETTL1 inhibited lipid synthesis in hepatocytes. The results are as follows. Figure 2 B.

[0050] Compared to MSC shGFP , MSC shMETTL1 significantly inhibited the expression of genes related to lipid synthesis (FASN, SREBP1, and ACC-1) at the protein level, while promoting the phosphorylation of AKT protein, reducing lipid accumulation in hepatocytes in vitro. The results are as follows. Figure 2 C- Figure 2 F.

[0051] II. Therapeutic effects of MSC shMETTL1 on a fatty liver model mouse To further investigate the effects of MSC shMETTL1 transplantation on lipid metabolism, we transplanted MSC into a HFD-induced fatty liver mouse model by tail vein injection to evaluate the therapeutic potential of MSC.

[0052] 1. Experimental method 1.1 HFD-induced fatty liver mouse model: 8-week-old male C57BL / 6 mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were used, and were raised in a sterile facility with a 12-hour light-dark cycle. To establish a model of metabolic dysfunction-associated steatohepatitis (MASLD), the experimental group mice were fed a high-fat diet (HFD, TP23400, Trophic, Jiangsu, China) for a long time, which was composed of 19.4% protein, 60% fat and 20.6% carbohydrate, and was represented by HFD; the normal control group was fed a standard diet (NCD, LAD3001M, Trophic, Jiangsu, China), represented by NCD.

[0053] 1.2 Stem cell treatment: Test group: After 8 weeks of HFD feeding, the mice received the first transplantation of MSCs via the tail vein shMETTL1 , with a dose of cells per mouse; a total of two transplantations were performed, with an interval of 3 weeks. Four weeks after the last transplantation, the mice were euthanized, and samples were collected for subsequent analysis. This is represented by HFD / MSC shMETTL1 .

[0054] Test control group: After 8 weeks of HFD feeding, the mice received the first transplantation of MSCs via the tail vein shGFP , with a dose of cells per mouse; a total of two transplantations were performed, with an interval of 3 weeks. Four weeks after the last transplantation, the mice were euthanized, and samples were collected for subsequent analysis. This is represented by HFD / MSC shGFP .

[0055] Positive control group: After 8 weeks of HFD feeding, the mice were injected with PBS via the tail vein, with the same volume as the test group; a total of two injections were performed, with an interval of 3 weeks. Four weeks after the last injection, the mice were euthanized, and samples were collected for subsequent analysis. This is represented by HFD / PBS.

[0056] Negative control group: After 8 weeks of NCD feeding, the mice were injected with PBS via the tail vein, with the same volume as the test group; a total of two injections were performed, with an interval of 3 weeks. Four weeks after the last injection, the mice were euthanized, and samples were collected for subsequent analysis. This is represented by NCD.

[0057] All animal experimental operations were reviewed and approved by the Ethics Committee of Xinxiang Medical College, ensuring compliance with animal welfare and ethical standards.

[0058] 1.3 Blood glucose levels were monitored using the Sinocare automatic blood glucose meter.

[0059] 1.4 The activity levels of ALT and AST in serum were quantitatively detected according to the standard operating procedures provided by the manufacturer, using the Jiangsu Jiancheng specific kit (C009 / C010).

[0060] 1.5 According to the literature method (literature DOI: 10.13764 / j.cnki.ncdm.2019.04.005), glucose tolerance test (GTT) and insulin tolerance test (ITT) were performed on mice. The mice were fasted for 16 hours before the GTT test and for 4 hours before the ITT test. The mice in the GTT group were injected intraperitoneally with a dose of 2 g / kg body weight of glucose solution, and blood samples were taken from the tail vein at 0 min before injection and at 15, 30, 60, 90 and 120 min after injection to measure the blood glucose level. The mice in the ITT group were injected intraperitoneally with a dose of 0.75 U / kg body weight of insulin, and blood samples were taken at the same time points to detect the change in blood glucose.

[0061] 1.6 According to the standard operating procedures provided by the manufacturer, the triglyceride (TG) content in the serum and liver of mice was quantitatively determined using a commercial kit (A110, Jiangsu Jiancheng, China).

[0062] 1.7 Histological analysis was performed according to the literature method (literature DOI: 10.16437 / j.cnki.1007-5038.2019.09.011). The mice were euthanized by cervical dislocation after deep anesthesia, and the liver tissue was fixed in 4% paraformaldehyde (PFA). After paraffin embedding, 8 μm thick sections were prepared, and hematoxylin-eosin (H&E) staining was performed. For oil red O staining, frozen liver sections were used. First, fix in 60% isopropanol for 10 minutes, then stain with freshly prepared oil red O working solution in the dark for 30 minutes, then separate and rinse with 60% isopropanol, then stain the nucleus with hematoxylin, and then mount with water-soluble mounting medium. All sections were examined and recorded under an optical microscope.

[0063] 1.8 The method for quantifying gene expression and the method for analyzing protein expression by Western blotting are described in "I. MSC shMETTL1 Effects of co-culture with hepatocytes on hepatocytes".

[0064] 1.9 Statistical analysis All experiments were repeated three times independently, and the quantitative data were expressed as mean ± SEM, with three decimal places. Statistical analysis was performed using GraphPad Prism software: single factor analysis of variance (ANOVA) was used for comparison between multiple groups, and further Tukey post-hoc test was performed. Two-way analysis of variance was used for glucose tolerance test (GTT) and insulin tolerance test (ITT); paired comparison was performed using independent sample t-test.

[0065] 2. Test results and analysis The test results are as follows.

[0066] 2.1 MSC with METTL1 expression knocked down improves liver dysfunction and insulin resistance.

[0067] Compared with MSC shGFP , transplantation of MSC shMETTL1 caused more significant decrease in body weight, liver weight ratio, fasting blood glucose level of mice Figure 3 (A, C-E). However, there was no significant change in food intake of mice Figure 3 (B).

[0068] Compared with MSC shGFP , transplantation of MSC shMETTL1 caused significant decrease in serum ALT and AST levels of HFD mice Figure 3 (G), indicating that transplantation of MSC shMETTL1 played a protective role in liver function.

[0069] GTT and ITT showed that, compared with MSC shGFP , transplantation of MSC shMETTL1 significantly restored insulin sensitivity Figure 3 (F), indicating that transplantation of MSC shMETTL1 could further improve liver dysfunction and insulin resistance caused by HFD.

[0070] Compared with MSC shGFP , transplantation of MSC shMETTL1 significantly improved liver tissue morphology of HFD mice and reduced the accumulation of serum and liver lipids Figure 3 (H, I).

[0071] In addition, we found that MSC shMETTL1 significantly inhibited the expression of genes involved in fatty acid synthesis (Fasn, Scd1, Acaca and Fads1) in the livers of MASLD mice induced by HFD at the transcriptional level; however, the effect on Srebp1 was small Figure 3 (J). At the protein level, transplantation of MSC shMETTL1 significantly inhibited the expression of lipid synthesis-related genes (FASN, SCD1 and ACC1), including SREBP1 Figure 3 (K). These data indicate that MSC shMETTL1 effectively inhibited lipid accumulation.

[0072] 2.2 MSC overexpressing METTL1 accelerated the progression of liver dysfunction and insulin resistance.

[0073] To explore the role of mesenchymal stem cells (MSC) overexpressing METTL1 in metabolic dysfunction-related fatty liver disease (MASLD), the present study constructed an adenovirus vector carrying METTL1 to achieve specific overexpression of METTL1 in MSC, and transplanted the modified cells into MASLD model mice induced by high-fat diet (HFD).

[0074] Biochemical and histological analysis showed that transplantation of METTL1-overexpressing MSCs significantly exacerbated lipid accumulation in the serum and liver of HFD mice, as evidenced by enlarged steatotic areas in HE staining and oil red O staining, and increased hepatic triglyceride (TG) content Figure 4 A, B). Meanwhile, the transcriptional and protein levels of fatty acid synthesis-related genes (such as FASN, SCD1, and FADS1) were significantly upregulated Figure 4 C, D). The expression levels of NAMPT and SIRT1 in the liver decreased, while the SREBP1-mediated lipid synthesis signaling pathway was significantly enhanced Figure 4 D). These results suggest that METTL1-overexpressing MSCs may further promote the SREBP1-dependent lipid synthesis pathway by reducing the secretion of NAMPT, thereby exacerbating the pathological process of MASLD.

[0075] III. Mechanism of MSCs with Knocked-down METTL1 Expression Improving Liver Dysfunction and Insulin Resistance

[0076] Previous studies have shown that NAMPT regulates intracellular NAD+ levels and affects oxidative stress, apoptosis, lipoglycemic metabolism, inflammation, and insulin resistance in obesity and related diseases. NAMPT can regulate lipid metabolism through the SIRT1 pathway. To verify this mechanism, we analyzed the NAD+ content in hepatocytes in the co-culture system using immunofluorescence (IF) and Western blotting (WB).

[0077] The immunofluorescence experiment method is as follows: After the cell or liver tissue sample is fixed with 4% paraformaldehyde (PFA), it is subjected to blocking and permeabilization treatment to reduce non-specific binding and promote antibody penetration. Then, the sample is incubated with a primary antibody specific to the target antigen, thoroughly washed, and detected using a fluorescently labeled secondary antibody (such as the CoraLite series). After the nucleus is stained with DAPI, high-resolution fluorescence data is obtained for analysis by confocal laser scanning microscopy.

[0078] The primary antibody information is as follows: ACC-1 (#3676), SCD1 (#2794), FASN (#3180), p-AKT (#4060), AKT (#9272) are from Cell Signaling Technology; METTL1 (14994-1-AP), SIRT1 (13161-1-AP), NAMPT (11776-1-AP), SREBP1 (14088-1-AP) are from Proteintech; SREBP1 (abs131802) and β-tubulin (abs171597) are derived from Absin; The Western Blot secondary antibody information is as follows: Goat anti-rabbit IgG (#abs20040) is derived from Absin; Goat anti-mouse IgG (#abs20039) is derived from Absin; The information for the immunofluorescence secondary antibody is as follows: CoraLite488-labeled goat anti-rabbit IgG (#SA00013-2) is derived from Proteintech; CoraLite594-labeled goat anti-mouse IgG (#SA00013-3) is derived from Proteintech.

[0079] After treating co-cultured cells with fresh culture medium containing NAMPT inhibitor FK866 (S2799, Selleck, China) or recombinant human NAMPT protein (Ag26088, Proteintech, China) for 24 h, the cells were analyzed.

[0080] The results showed that free fatty acid (FFA) stimulation significantly inhibited NAMPT expression and reduced NAD+ levels; while MSC... shGFP Co-culture can enhance NAMPT expression and NAD+ levels in hepatocytes, and METTL1-deficient MSCs (MSCs) shMETTL1 The treatment further enhanced this effect. Figure 5 A, E, F, G). Furthermore, SIRT1 expression was significantly upregulated, while SREBP1 expression was suppressed, suggesting that transcription of lipid synthesis-related genes was repressed. Figure 5 B, C, E).

[0081] Further analysis of IF, WB, and NAD+ levels was performed on liver tissue from mice that received MSC transplantation. This was compared with the results of MSC transplantation. shGFP Compared to mice receiving MSCs shMETTL1 In the livers of mice, the expression of NAMPT and SIRT1 proteins was significantly increased, while the expression of SREBP1 was significantly decreased. Figure 5 HL), while the level of NAD+ in liver tissue increased, indicating that the cellular metabolic state was improved ( Figure 5 The above results indicate that METTL1-deficient MSCs exert a regulatory role in lipid metabolism in MASLD by secreting NAMPT, activating SIRT1, and inhibiting the SREBP1-mediated lipid synthesis signaling pathway.

[0082] At the phenotypic level, MSCs pretreated with FK866 shMETTL1 Transplantation did not significantly affect the body weight and food intake of mice. Figure 6 A, B), but this resulted in a liver-to-body weight ratio and fasting blood glucose level lower than MSC. shMETTL1 The group significantly increased ( Figure 6 C, D). GTT and ITT trials further showed that FK866 pretreatment weakened MSC. shMETTL1 The effect of improving insulin resistance ( Figure 6 E). Furthermore, the FK866 pretreatment group mice also had higher serum ALT and AST levels, suggesting increased liver damage (E). Figure 6 F).

[0083] Consistent with previous results, MSC shMETTL1 Transplantation significantly reduced lipid accumulation in the liver of MASLD mice, while FK866 pretreatment reversed this protective effect, leading to a significant increase in lipid accumulation. This result was confirmed by both biochemical and histological (HE, Oil Red O staining) analyses. Figure 6 G, H). At the molecular level, FK866 pretreatment upregulated the expression of lipid synthesis-related genes, accompanied by a decrease in SIRT1 levels and an increase in SREBP1 expression (G, H). Figure 6 I). The above results indicate that the protective effect of METTL1-deficient MSCs against MASLD lipid metabolism depends on their ability to secrete NAMPT.

Claims

1. An engineered mesenchymal stem cell, characterized in that, The engineered mesenchymal stem cells knocked down the expression of the METTL1 gene.

2. The engineered mesenchymal stem cells as described in claim 1, characterized in that, The concentration of the engineered mesenchymal stem cells is 1 × 10⁻⁶. 5 cells / mL ~ 1 × 10⁻⁶ 8 per mL.

3. The engineered mesenchymal stem cells as described in claim 1, characterized in that, The METTL1 gene expression copy number in the engineered mesenchymal stem cells was reduced by more than 70%.

4. The method for preparing engineered mesenchymal stem cells as described in claim 1, characterized in that, Includes the following steps: Step S1, Cell Culture: Mesenchymal stem cells are cultured in culture medium for 3-5 generations to obtain cell A; Step S2, Lentiviral infection: The shRNA lentiviral plasmid vector targeting the human METTL1 gene was transfected into 293T cells to package the virus. After transfection, the lentiviral particles were collected and used to infect cell A to obtain cell B. Step S3, Puromycin resistance screening: Cell B cells are screened for resistance using puromycin to obtain engineered mesenchymal stem cells.

5. A pharmaceutical preparation, characterized in that, The pharmaceutical preparation includes the engineered mesenchymal stem cells as described in claim 1.

6. The use of engineered mesenchymal stem cells as described in claim 1 in a pharmaceutical formulation for the treatment of metabolic dysfunction-related fatty liver disease.

7. The use of engineered mesenchymal stem cells as described in claim 1 in drug formulations for improving insulin resistance.

Images