Porcine reproductive and respiratory syndrome virus NADC30 strain and application thereof in preparation of vaccine

Abstract

The invention provides a porcine reproductive and respiratory syndrome virus NADC30 strain and application of the porcine reproductive and respiratory syndrome virus NADC30 strain in preparation of vaccines. According to the present invention, the porcine reproductive and respiratory syndrome virus NADC30 type ZM2410 strain is separated from pig lung tissue, and is subjected to passage purification to obtain the porcine reproductive and respiratory syndrome virus NADC30 type ZM2410 strain, and the microbial preservation number of the porcine reproductive and respiratory syndrome virus NADC30 type ZM2410 strain is CGMCC No. 46403; the strain can stably proliferate on passage cells to generate typical cytopathy. The reproductive and respiratory syndrome virus NADC30 type ZM2410 strain disclosed by the invention has excellent immunogenicity; the vaccine prepared from the strain can induce piglets to generate high-level neutralizing antibodies; meanwhile, a vaccine prepared from the strain can generate good protective efficacy.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a strain of isolated and purified porcine reproductive and respiratory syndrome virus NADC30 and application thereof. BACKGROUND

[0002] Porcine reproductive and respiratory syndrome (PRRS), also known as "blue ear disease", is a highly contagious disease characterized by reproductive disorders in sows and respiratory diseases in pigs at all stages, which is caused by porcine reproductive and respiratory syndrome virus (PRRSV). PRRSV has extensive variability and strain diversity. Porcine reproductive and respiratory syndrome is one of the important economic diseases that endanger global pig production. Clinically, it mainly manifests as fever, anorexia, premature delivery, abortion, stillbirth, mummification and other reproductive disorders in pregnant sows, and respiratory diseases in pigs at all ages, especially in piglets.

[0003] In 1991, Wensvoort et al. first isolated PRRSV from porcine alveolar macrophages in the Netherlands, and named it Lelystad virus (LV). According to the characteristics of the viral genome and serotype, PRRSV can be divided into two genotypes, i.e. genotype 1 (European type) represented by LV strain and genotype 2 (American type) represented by VR2332 strain. Porcine reproductive and respiratory syndrome virus, equine arteritis virus (EAV), lactate dehydrogenase-elevating virus (LDV) and simian hemorrhagic fever virus (SHFV) belong to the same arterivirus family (Arterividae) of the arterivirus genus (Artervirus) of the Nidovirales order. The full-length genome of PRRSV is about 15 kb, which is a single-stranded, non-segmented, enveloped RNA virus containing 9 open reading frames. The 5' untranslated region (5'UTR) of PRRSV may contain a binding motif for virus replication-related proteins. ORF1 is composed of ORF1a and ORF1b, which is about 12 kb and accounts for 80% of the whole genome of PRRSV, and encodes virus replication-related proteins. ORF2a, ORF2b, ORF3-ORF7 encode viral structural proteins GP2a, GP2b, GP3, GP4, GP5, M and N, respectively. Among them, GP5 is the main envelope protein of the virus, M protein is the membrane protein, and N protein is the nucleocapsid protein of the virus. The 3' untranslated region (3'UTR) at the end of the PRRSV genome contains a poly(A) tail.

[0004] PRRS is one of the most serious infectious diseases in China's pig industry, causing serious economic losses. PRRSV has great variability, which is one of the important reasons why the disease is difficult to control. Although a variety of vaccines have been developed, PRRS outbreaks continue to occur.

[0005] In recent years, NADC30-like PRRS outbreaks have occurred frequently, and the use of vaccines is still VR2332, HP-PRRSV and other strains with distant homology, and the cross-protection is relatively weak. Therefore, the development of vaccines with good immunity and similar homology to NADC30-like PRRSV is urgent, which is of great significance for the prevention and control of NADC30-like PRRS. SUMMARY

[0006] The purpose of the present application is to provide a NADC30-like PRRSV and its ORF5 gene sequence, and the application of inactivated vaccine or live vaccine prepared based on the isolated strain in the prevention and control of NADC30-like PRRS.

[0007] In order to achieve the purpose of the present application, the technical scheme of the present application is as follows: In the first aspect, the present application provides a NADC30-like PRRSV strain and its ORF5 gene sequence.

[0008] The present application inoculates the lung tissue grinding liquid of a certain pig farm into Marc145 cells, and through cell passage, purification and identification, a NADC30-like PRRSV strain is obtained, which is named ZM2410, and the classification name is porcine reproductive and respiratory syndrome virus Porcine reproductive and respiratory syndrome virus , which is stable in cell proliferation, and the ZM2410 strain F4 TCID 50 reaches 1.0x10 9.5 TCID 50 / ml, and on February 27, 2025, the China General Microbiological Culture Collection Center (address: No. 3, Institute of Microbiology, Chinese Academy of Sciences, Beijing City, Chaoyang District, Beichen West Road No. 1) preserved the strain, and the preservation number is CGMCC No. 46403. The present application provides the ORF5 gene sequence of the NADC30-like PRRSV isolated strain, which is shown in SEQ ID No. 1.

[0009] In the second aspect, the present application provides a biological product containing the NADC30-like PRRSV isolated strain, and the biological product is used for preventing porcine reproductive and respiratory syndrome.

[0010] The biological product can be a vaccine.

[0011] The vaccine is an inactivated vaccine or a live vaccine.

[0012] The application provides an inactivated vaccine and a live vaccine containing the isolated NADC30-like PRRSV.

[0013] The inactivated vaccine contains not less than 1×10 7.0 TCID 50 / ml of antigen per head, and the immunization approach is intramuscular injection.

[0014] The live vaccine contains not less than 1×10 6.0 TCID 50 / ml of antigen per head, and the immunization approach is intramuscular injection or nasal instillation.

[0015] The application has the following beneficial effects: The NADC30-like PRRSV strain obtained by the application has the following advantages: fast proliferation on susceptible cells (MARC-145 cell line), and the virus can be harvested 25 hours after inoculation; high proliferation titer, and the F4 generation can reach 1.0×10 9.5 TCID 50 / ml. The NADC30-like PRRSV strain has low pathogenicity, and 1×10 9.5 TCID 50 / ml of virus liquid can be used for nasal cavity challenge and intramuscular injection of 30-day-old healthy piglets, and the piglets are continuously observed for 21 days. The challenged piglets only show slight increase in body temperature, have no other clinical manifestations, and all survive. The inactivated vaccine or live vaccine prepared from the strain has good immunoprotection and can provide 100% protection against challenge of a strong strain, thereby providing important biological materials for effective prevention and control of NADC30-like PRRSV disease.

[0016] On this basis, other biological products containing the NADC30-like PRRSV for prevention and control also belong to the protection scope of the application.

[0017] In 2024, a NADC30-like PRRSV strain named ZM2410 was isolated from lung tissue of a pig farm in Sichuan and purified by passage. The isolated strain has good proliferation on passage cells, has no obvious pathogenicity to piglets, and has excellent immunogenicity. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 ZM2410 isolated strain was cultured on Marc145 adherent cells, wherein A is the pathological change (CPE) of the ZM2410 isolated strain on Marc145 cells, and B is a normal Marc145 cell control.

[0019] Figure 2 RT-PCR identification results of ZM2410 isolates, from left to right: 1. 4th generation ZM2410 cell culture; 2. PRRSV positive control; 3. PRRSV negative control.

[0020] Biological material preservation 1) Preservation number: CGMCC No. 46403 Name: Porcine reproductive and respiratory syndrome virus Porcine reproductive and respiratory syndrome virus ZM2410 Classification name: Porcine reproductive and respiratory syndrome virus Porcine reproductive and respiratory syndrome virus , Whether alive: alive Preservation time: February 27, 2025 Preservation agency: China General Microbiological Culture Collection Center Address: No. 3, Beichen West Road, Chaoyang District, Beijing 2) Preservation number: CGMCC No. 46650 Name: Porcine reproductive and respiratory syndrome virus GS1 Classification name: Porcine reproductive and respiratory syndrome virus Whether alive: alive Preservation time: September 19, 2025 Preservation agency: China General Microbiological Culture Collection Center Address: No. 3, Beichen West Road, Chaoyang District, Beijing DETAILED DESCRIPTION

[0021] The methods in the following examples are conventional unless otherwise specified.

[0022] The following examples are used to illustrate the present application, but are not intended to limit the scope of the present application. If not specifically indicated, the technical means used in the examples are conventional means known to those skilled in the art, and the reagents used are commercially available products.

[0023] Example 1, isolation of NADC30 PRRSV strain 1. Collection and processing of lung tissue Collect lung tissue, cut into small pieces, add 10 times the volume of DMEM medium to grind, centrifuge at 4°C, 12000 rpm for 5 min, take the supernatant of the grinding liquid, and freeze at -80°C for standby.

[0024] 2. Pathogen detection of lung tissue Take 200 μl of the above grinding liquid supernatant, use Beijing Quansijin Biological Company DNA / RNA extraction kit, according to the instruction book steps to extract DNA and RNA; then, use Quansijin reverse transcription kit to reverse transcribe RNA into cDNA. With the extracted DNA and reverse transcribed cDNA as the template, use 9 pairs of detection primers of swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine pseudorabies virus (PRV), porcine circovirus type 2 / 3 (PCV2 / PCV3), porcine parvovirus (PPV), porcine infectious gastroenteritis (TGEV), porcine epidemic diarrhea virus (PEDV), and porcine rotavirus (RV) and Quansijin 2×EasyTaq PCR SuperMix for PCR detection, and set up positive and negative controls. The detection results show that the grinding liquid of the sample is positive for porcine PRRSV and negative for other pathogens.

[0025] 3. Isolation of ZM2410 strain In 2024, lung tissue was collected from a pig farm in Sichuan that had a PRRSV-positive lung tissue material detected by RT-PCR. The collected lung tissue of infected pigs was inoculated into Marc145 cells, incubated for 1 hour, then the incubation liquid was discarded and replaced with DMEM containing 2% fetal bovine serum for maintenance culture. After 48 hours of inoculation, the cells showed shrinkage, syncytium aggregation and a small amount of shedding ( Figure 1 ), while normal cells had no lesions. After 3 days of inoculation, the cell culture was collected and continuously passaged on Marc145 cells. The 4th passage was inoculated on Marc145 cells, and 17 hours later the cells showed obvious aggregation, shrinkage, and a small amount of shedding. The virus was collected 25 hours after inoculation.

[0026] The 4th passage product was identified by RT-PCR. Nucleic acids were extracted according to the instructions of Beijing Quansijin DNA / RNA extraction kit, and reverse transcription was performed according to the instructions of Quansijin EasyScript First-Strand cDNA Synthesis SuperMix. The swine PRRSV primers used for PCR were: ORF5-F: AGCCTGTCTTTTTGCCATTCT; ORF5-R: CTTTTGTGGAGCCGTGCTATC.

[0027] The product was electrophoresed on a 1% agarose gel, and the target band was recovered and purified, then sent to Beijing Qikeng Biotechnology Co., Ltd. for sequencing. The sequences of the swine PRRSV ORF5 genome were obtained by splicing the fragments, as shown in SEQ ID No. 1. Figure 2 Thus, the swine PRRSV was successfully isolated.

[0028] The amplified product was electrophoresed on a 1% agarose gel, the target band was recovered and purified, then sent to Beijing Qikeng Biotechnology Co., Ltd. for sequencing. The sequences of the swine PRRSV ORF5 genome were obtained by splicing the fragments, as shown in SEQ ID No. 1.​

[0029] The pig PRRSV ORF5 genome sequence obtained by splicing was compared online with NCBI Blast, and the highest homology of 97.51% was found in comparison with the existing pig PRRSV strain sequence (online comparison website: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). The reference strain sequences downloaded from GenBank were compared and analyzed by gene sequence and phylogenetic analysis, and the PRRSV strain was shown to belong to the same branch as the existing NADC30 PRRSV in the phylogenetic tree. Therefore, it is determined that this strain is a new NADC30 PRRSV-like strain.

[0030] The isolated virus was continuously passaged on Marc145 adherent cells for 4 generations, and stable cytopathic effect (CPE) appeared. Cell aggregation and fusion lesions appeared 17 hours after inoculation, while normal cells had no obvious lesions, and the cell culture was collected 25 hours later. Continue to pass the NADC30 PRRSV to the 5th generation, and there is obvious cytopathic effect after 15 hours of culture, and the virus is harvested 25 hours later. After identification, a NADC30 PRRSV-like strain named ZM2410 was obtained, and the classification and naming of the virus was Porcine reproductive and respiratory syndrome virus Porcine reproductive and respiratory syndrome virus , ZM2410 was deposited at the China General Microbiological Culture Collection Center (address: No. 1, Beichen West Road, No. 3, Beijing Chaoyang District, Institute of Microbiology of Chinese Academy of Sciences) on February 27, 2025, and the accession number is CGMCC No. 46403.

[0031] The NADC30 PRRSV-like ZM2410 was inoculated into Marc145 adherent cells and cultured, and typical cytopathic effect appeared after 15 hours, such as Figure 1 ; when the cytopathic effect reached about 90%, the culture was harvested and freeze-thawed once. According to the Reed & Muench method, the virus titer of F4 generation was 1.0×10 9.5 TCID 50 / ml.

[0032] Example 2, pathogenicity experiment of ZM2410 strain Six 30-day-old piglets negative for pig PRRSV and antibodies were selected and randomly divided into two groups, 3 in each group.

[0033] The challenge group was challenged intranasally and intramuscularly, and each pig was inoculated intranasally with 1ml of 10 9.5 TCID 50 / ml F4 passage virus, and 1ml of 10 9.5 TCID 50 / ml F4 passage virus liquid.

[0034] The control group was respectively inoculated with 1 mL of sterile PBS solution in the nasal cavity and muscle of each pig. The state of the pigs was observed daily, the rectal temperature was measured, and the data were recorded.

[0035] The pigs were continuously observed for 21 days. The body temperature of the challenge group was slightly elevated (about 40.5°C), and the body temperature of the control group was normal. The clinical observation showed that the pigs in the challenge group and the control group were normal in spirit and appetite, had no respiratory symptoms, and no pigs died, and all survived. The above data show that the ZM2410 isolate has no obvious pathogenicity to weaned piglets.

[0036] Blood and anal swabs were collected from each pig in the challenge group and the control group before challenge (0 days) and 3 days, 5 days, 7 days, 14 days, and 21 days after challenge, and the serum was separated. The viremia and virus shedding were detected by fluorescence quantitative PCR. The viremia detection results are shown in Table 1. The virus shedding detection results are shown in Table 2.

[0037] The data show that the challenge pigs began to have viremia and virus shedding at 3 days, and the viremia and virus shedding were the most at 5-7 days, and the viremia and virus shedding decreased after 14 days.

[0038] Table 1 Detection results of viremia before and after challenge

[0039] Table 2 Detection results of pathogen in anal swabs before and after challenge

[0040] The challenge test data show that the ZM2410 isolate of the application has only a slight increase in body temperature (about 40.5°C) after infecting piglets, and has no other clinical manifestations, which is a low virulence strain.

[0041] Example 3 Application of ZM2410 in preparation of NADC30-type inactivated vaccine 1. Preparation of NADC30-type inactivated vaccine 30ml 10 7.5 TCID 50 / ml F9 passage ZM2410 virus liquid, which is sterile and qualified for exogenous virus test, is inactivated by adding formaldehyde with a final concentration of 0.2%. The inactivated virus liquid is added with an adjuvant to prepare an inactivated vaccine.

[0042] Vaccine configuration method: Zhongmu self-made colloidal water adjuvant formula: water for injection 90%, lactic acid-glycolic acid (PLGA) 3%, polyvinylpyrrolidone 2%, alkyl glycoside (decyl glucoside) (APG0816) 2%, polyethylene glycol 6000 1%, polyoxyethylene sorbitan monooleate 1%, cetyl alcohol 1%. Among them, % is the mass percentage content.

[0043] Weigh 30 g of Zhongmu self-made colloidal water adjuvant, mix with an equal volume of inactivated antigen, and shake well to mix.

[0044] 2. Vaccine safety test Select 6 PRRSV pathogen and antibody negative piglets of about 30 days old, and randomly divide them into 2 groups, 3 in each group. The test group is injected with 2 doses (4 ml) of inactivated vaccine, with an interval of 14 days for twice vaccination; the control group is injected with an equal volume of sterile PBS solution, with an interval of 14 days for twice vaccination; and the observation is continued for 28 days. The results show that, compared with the control group, there is no significant difference in the mental state, body temperature and daily weight gain of the test group piglets, and no adverse reactions occur.

[0045] 3. ZM2410 inactivated vaccine challenge protection test Select 6 PRRSV pathogen and antibody negative healthy piglets of 30 days old, and randomly divide them into 2 groups, 3 in each group.

[0046] The immune group is injected intramuscularly: each piglet is injected with 2 ml of 10 7.5 TCID 50 / mL F9 generation ZM2410 inactivated vaccine; the control group is injected with 2 ml of sterile PBS solution.

[0047] Four weeks after immunization, the immune group and the control group are challenged. The challenge strain is GS1 strain isolated by Zhongmu (the challenge strain has been verified as a strong strain and has been preserved in China General Microbiological Culture Collection Center, with the preservation number of CGMCC No. 46650).

[0048] The state of the pigs is observed daily, and the rectal temperature is measured and recorded.

[0049] The observation is continued for 28 days. The body temperature of the immune group fluctuates within the normal range, and the clinical symptom observation finds that the immune group pigs have normal appetite, no cough and respiratory symptoms, and no piglet death, all survive.

[0050] After challenge, the body temperature of the control group increases (41℃-42℃), the pigs are in a depressed state, have reduced appetite, and have cyanotic ears, cough symptoms and respiratory symptoms, of which 2 pigs die. Three pigs are pathologically dissected, and the lung tissue is dark red and has local parenchymal lesions.

[0051] The above data show that the ZM2410 strain has good protection efficacy against PRRSV of the NADC30 type.

[0052] Example 4: Challenge protection test of ZM2410 attenuated live vaccine Six 30-day-old healthy piglets negative for PRRSV pathogen and antibodies were selected and randomly divided into two groups, 3 piglets in each group.

[0053] The immunized group was inoculated intramuscularly with 2 ml of 10 6.0 TCID 50 / mL F30 generation ZM2410 virus solution; the control group was inoculated intramuscularly with 2 ml of sterile PBS solution per piglet.

[0054] Four weeks after immunization, the immunized group and the control group were challenged with the strong virus strain GS1 (the challenge strong virus strain has been deposited with the China General Microbiological Culture Collection Center, and the deposit number is CGMCC No. 46650).

[0055] The state of the pigs was observed daily, and rectal temperature was measured and recorded.

[0056] Continuous observation was performed for 28 days.

[0057] After challenge, the body temperature of the immunized group fluctuated within the normal range, the pigs had normal appetite, no cough and respiratory symptoms occurred, and no piglets died, all survived.

[0058] After challenge, the body temperature of the control group increased (41-42°C), the pigs were depressed, had decreased appetite, cyanotic ears, and had cough and respiratory symptoms, and 2 piglets died; pathological examination showed that the lung tissue of 3 piglets was dark red and had local parenchymal lesions.

[0059] The above data show that the ZM2410 strain as a live vaccine has obvious protection efficacy against porcine reproductive and respiratory syndrome of the NADC30 type.

[0060] Although the present application has been described in detail above with general description and specific embodiments, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of the present application claimed.

Claims

1. A strain of porcine reproductive and respiratory syndrome virus, NADC30-like strain, characterized in that: The name of the porcine reproductive and respiratory syndrome virus class NADC30 strain is ZM2410, and its classification name is porcine reproductive and respiratory syndrome virus Porcine reproductive and respiratory syndrome virus The preservation number in China Microbial Strain Preservation and Management Committee General Microorganism Center is CGMCC No. 46403.

2. The porcine reproductive and respiratory syndrome virus of the NADC30-like strain according to claim 1, characterized in that: The partial gene sequence of the porcine reproductive and respiratory syndrome virus of NADC30 strain is shown in sequence 1 in the sequence listing.

3. Biological product containing the porcine reproductive and respiratory syndrome virus of NADC30 strain according to claims 1 and 2, for use in the prevention or diagnosis of the porcine reproductive and respiratory syndrome virus of NADC30 virus disease.

4. The biological according to claim 3, characterized in that: The biological product is a vaccine.

5. The biological according to claim 4, characterized in that: The vaccine is a live vaccine or an inactivated vaccine, and further comprises a pharmaceutically acceptable adjuvant.

6. Use of the porcine reproductive and respiratory syndrome virus of NADC30 strain according to claims 1 and 2, for the preparation of a vaccine for the prevention of the porcine reproductive and respiratory syndrome virus of NADC30 virus disease.

Images