Application of OsERF8 gene in improving drought resistance of rice

Abstract

The invention provides application of an OsERF8 gene in improving drought resistance of rice, and belongs to the technical field of gene engineering and rice drought resistance. The nucleotide sequence of the OsERF8 gene is as shown in SEQ ID NO: 1, and the amino acid sequence of the encoding protein of the OsERF8 gene is as shown in SEQ ID NO: 2. Compared with a wild plant, the survival rate of an oserf8 mutant plant under PEG induction and soil dehydration drought stress is remarkably improved; and the survival rate of the overexpressed plant OsERF8-OE under the induction of PEG (Polyethylene Glycol) is obviously reduced. Compared with a wild type plant, after PEG induces drought stress, the malondialdehyde content of the overground part of the oserf8 mutant plant is reduced, and the proline content is increased; the malondialdehyde content of the overground part of the overexpressed plant OsERF8-OE is increased, and the proline content is reduced. In conclusion, the OsERF8 gene is a potential candidate new target for researching a rice drought resistance regulation mechanism.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological genes and drought resistance of rice, and particularly relates to application of OsERF8 gene in improving drought resistance of rice. BACKGROUND

[0002] Rice is one of the most important food crops in the world. In recent years, with the change of climate, the available fresh water resources are reduced. Because rice has a higher requirement for water, drought will seriously affect the yield of rice. Therefore, exploring the genes related to drought response of rice and elucidating the regulation mechanism are of great significance for breeding drought-resistant rice with high efficiency of water use.

[0003] Ethylene is a very important hormone in plants, which is involved in the response of plants to abiotic stress such as drought, high temperature and high salt. The mechanism of action of ethylene under drought stress involves multiple levels of physiological and molecular regulation, and its core functions include promoting adaptive growth of root system, mediating leaf senescence and abscission, and responding to water deficit in cooperation with abscisic acid (ABA). Ethylene enhances drought tolerance by up-regulating auxin synthesis genes such as MHZ10 gene, enhancing root geotropism, and forming deep root system to obtain deep soil water; ethylene up-regulates the activity of cell wall degrading enzymes such as pectinase and cellulase, promotes abscission layer formation, and reduces transpiration area. From the above characteristics of ethylene, it can be seen that ethylene plays an important role in regulating plant drought resistance.

[0004] ERFs (ethylene responsive factor) transcription factor family also plays a very important role in plant drought resistance. Wheat TaERF87 promotes proline content by binding to TaP5CS1 / TaP5CR1 promoter, and the proline content of transgenic plants is 2.8 times higher than that of wild type plants, while reducing malondialdehyde (MDA) content; wheat TaRAP2-13L interacts with TaWRKY10 to reduce the accumulation of reactive oxygen species (ROS) through ABA signal. In rice, OsERF109 gene promotes root growth and expands water absorption area by regulating auxin-related genes such as OsAUX / IAA gene; OsERF83 gene activates antioxidant enzyme genes such as SOD, CAT and POD, and reduces drought-induced oxidative damage. These genes are positive regulation of drought resistance genes, and their use can only go through the transgenic approach, while the use of germplasm resources is relatively less, but there are fewer reports of negative regulation of drought resistance ERFs genes, so it is necessary to explore negative regulation of drought resistance ERFs genes. SUMMARY

[0005] In order to overcome the problems in the prior art, the application aims to provide an application of an OsERF8 gene in improving drought resistance of rice, and the OsERF8 gene is of great significance for improving drought resistance of rice and can be used as a new target for improving drought resistance of rice.

[0006] The application of the OsERF8 gene in improving drought resistance of rice, wherein the nucleotide sequence of the OsERF8 gene is shown as SEQ ID NO: 1, and the OsERF8 gene negatively regulates drought resistance of rice

[0007] Further, the amino acid sequence of the protein encoded by the OsERF8 gene is shown as SEQ ID NO: 2.

[0008] Further, the improvement of drought resistance of the os erf8 mutant plant is that the survival rate of the os erf8 mutant plant is improved under drought stress caused by soil dehydration or PEG.

[0009] Further, the improvement of drought resistance of the os erf8 mutant plant is that the malondialdehyde content of the above-ground part of the os erf8 mutant plant is significantly lower than that of the wild type plant under drought stress caused by PEG.

[0010] Further, the improvement of drought resistance of the os erf8 mutant plant is that the proline content of the above-ground part of the os erf8 mutant plant is significantly higher than that of the wild type plant under drought stress caused by PEG.

[0011] Further, the plant is rice, and the rice is japonica rice.

[0012] Further, the variety of the japonica rice is Zhonghua 11.

[0013] Further, the OsERF8 gene is knocked out to obtain the os erf8 mutant plant, and the drought resistance of the os erf8 mutant plant is improved.

[0014] The application also provides a breeding method of drought-resistant rice, wherein the OsERF8 gene is knocked out in the rice, and the method comprises the following steps:

[0015] constructing an sgRNA expression cassette;

[0016] cloning the sgRNA expression cassette into a pYLCRISPR / Cas9 vector to obtain a CRISPR / Cas9-OsERF8 vector;

[0017] transferring the CRISPR / Cas9-OsERF8 vector into a plant cell for genetic transformation to obtain a transgenic plant T0;

[0018] screening homozygous os erf8 mutant plants from the transgenic plant T0.

[0019] Further, the sgRNA expression cassette is constructed, comprising:

[0020] A target site is designed according to the OsERF8 gene, and a target site fragment is obtained;

[0021] A primer pair is designed according to the target site fragment, and the primer pair is used for PCR amplification;

[0022] The target site fragment is subjected to first round of PCR amplification, and an amplification product is obtained;

[0023] The amplification product is subjected to second round of PCR amplification based on the primer pair, and the sgRNA expression cassette is obtained.

[0024] The beneficial effects of the present application are:

[0025] (1) Compared with wild type plants, the survival rate of os erf8 mutant plants after soil drought stress and PEG simulated drought stress is significantly improved, and the survival rate of overexpression plant OsERF8-OE is significantly reduced. It is inferred that the OsERF8 gene negatively regulates the drought resistance of rice.

[0026] (2) The resistance of plants to PEG induced drought stress is improved, the accumulation of malondialdehyde in the aboveground part of plants is reduced, and the content of proline in the aboveground part of plants is increased.

[0027] It can be seen that the OsERF8 gene is a potential candidate new target for studying the negative regulation of rice drought resistance mechanism. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 Wild type plants (WT), os erf8 mutant plants and overexpression plants OsERF8-OE are subjected to PEG simulated drought treatment, wherein, Figure 1 a is a drought treatment phenotype diagram of wild type plants (WT) and os erf8 mutant plants, Figure 1 b is a survival rate statistical result diagram of wild type plants (WT) and os erf8 mutant plants after drought treatment, Figure 1 c is a drought treatment phenotype diagram of wild type plants (WT) and overexpression plants OsERF8-OE, Figure 1 d is a survival rate statistical result diagram of wild type plants (WT) and overexpression plants OsERF8-OE after drought treatment;

[0029] Figure 2 Wild type plants (WT) and os erf8 mutant plants are subjected to soil drought treatment, wherein, Figure 2 a is a drought treatment phenotype diagram of wild type plants (WT) and os erf8 mutant plants, Figure 2b is the survival rate of wild type plants (WT) and osERF8 mutant plants after drought treatment;

[0030] Figure 3 b is the survival rate of wild type plants (WT) and osERF8 mutant plants after drought treatment; Figure 3 a is the content of malondialdehyde, Figure 3 b is the content of proline. DETAILED DESCRIPTION

[0031] Preferred embodiments of the present application will be described in more detail by making reference to the accompanying drawings. Even though preferred embodiments of the present application are shown in the drawings, it is to be understood that the present application can be carried out in various forms and should not be limited by the embodiments set forth herein. Rather, these embodiments are provided so that this application will be thorough and complete, and fully convey the scope of the application to those skilled in the art.

[0032] Plant material: The test material of this study is japonica rice (Oryza sativa L.). The wild type plant (WT) is Zhonghua 11 (ZH11) (publicly available rice variety, commercially available). The genetic transformation of OsERF8 genetic material was constructed by Baige Gene Technology (Jiangsu) Co., Ltd.

[0033] Chemical reagents: Polyethylene glycol 6000 (PEG6000) was purchased from Shengong Bioengineering (Shanghai) Co., Ltd., and malondialdehyde and proline assay kits were purchased from Solabio Biotechnology Co., Ltd.

[0034] Example 1 Construction of overexpression plant OE-OsERF8

[0035] The plant overexpression vector pRHV was provided by the Wang Guoliang group of the Chinese Academy of Agricultural Sciences (the plant overexpression vector pRHV has been disclosed in the supplementary data of He F, Zhang F, Sun W, et al. A Versatile Vector Toolkit for Functional Analysis of Rice Genes [J]. Rice, 2018, 11(1): 27.).

[0036] 1. Construction of pRHV-ERF8 overexpression vector

[0037] (1) Amplification of target gene

[0038] The cDNA of wild type plant (WT) leaves was extracted, and specific primers were designed according to the target gene, and restriction enzyme sites (such as XbaI and KpnI) and protection bases corresponding to the MCS of the vector were introduced into the 5' ends of the upstream and downstream primers, and the primer sequences are shown in Table 1. The target gene fragment was purified by gel recovery after PCR amplification to obtain the PCR amplification product, and the reaction system of PCR amplification is shown in Table 2.

[0039] Table 1: Primer of PCR amplified target fragment

[0040]

[0041] Table 2: PCR reaction system of target gene

[0042] Reaction solution Volume (μL) Template 2 2× KOD FX buffer 25 Primer OsERF8-OE-F / R (10 μM) 1.5 2 mM dNTPs 10 High-fidelity enzyme KOD FX 1 ddH2O 9 Total volume 50

[0043] The first step of PCR amplification is denaturation, and the temperature is set to 94℃. High temperature can break the hydrogen bond between double-stranded DNA templates (dsDNA) and dissociate into two single-stranded DNA (ssDNA) to facilitate primer binding to the template. Since it is the first denaturation, the time is set to 5 minutes to ensure that the template is completely unfolded. 98℃ denaturation for 10s, 55℃ annealing for 30s, 68℃ extension for 90s, 32 cycles; 68℃ total extension for 5min, 16℃ for 1min. After the reaction is completed, 50μL of amplification product is added to 1% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel is imaged on a UV imager to detect whether the band is amplified. If the target band is amplified, it means that the amplified fragment may contain the target gene. The target band is cut and the product is further purified by gel recovery and concentration determination.

[0044] (2) Preparation of linearized vector

[0045] Take 3μg of overexpression vector pRHV and target gene respectively (according to the operation manual of plasmid extraction kit), and add corresponding restriction endonuclease to both reaction systems at 37℃ for 20min. The reaction systems of overexpression vector pRHV and target gene are shown in Table 3:

[0046] Table 3: Enzyme digestion reaction system

[0047] Reaction solution Amount 10× CutSmart buffer 5 μL B amH I endonuclease 1 μL Kpn I endonuclease 1 μL Overexpression vector pRHV 3 μg Total volume make up to 50 μL with ddH2O

[0048] Take 50μL of reaction product and add it to 1% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel is imaged on a UV imager, and the target band is separated. The target band is cut and the product is further purified by gel recovery and concentration determination.

[0049] (3) Recombination reaction

[0050] 2xHieff MultiS Enzyme Premix (from Multi-fragment One-step Fast Cloning Kit, purchased from Shanghai Yisen Biotechnology Co., Ltd.) Homologous recombination enzyme will recombine the insert and the vector in proportion to obtain pRHV-OsERF8 overexpression vector. The optimal vector and insert molar ratio is 1 :(2-3), and the DNA mass corresponding to these molar numbers can be roughly calculated by the following formula: optimal vector usage X = [0.02 x number of base pairs of the vector] ng (0.03 pmol), optimal insert usage Y = [0.04 x number of base pairs of the insert] ng (0.06 pmol) or = [0.06 x number of base pairs of the insert] ng (0.09 pmol). The recombination reaction system is as shown in Table 4:

[0051]

[0052] Table 4: Recombination reaction system

[0053] After the system is prepared, use a pipette to gently suck and beat the components to mix, and centrifuge briefly to collect the reaction solution to the bottom of the tube. Place in a 50°C reaction for 20 min. The reaction product can be directly transformed, or can be stored at -20°C, and thawed for transformation when needed.

[0054] (4) Recombination product transformation and plating

[0055] Thaw the competent cells DH5a on ice. Take 10 μL of the cooled recombination product (containing pRHV-OsERF8 overexpression vector), add to 100 μL of competent cells, gently shake the tube wall several times to mix, and place on ice for 30 min; 42°C heat shock for 60 s, ice bath incubation for 2 min, add 900 μL of LB medium, 37°C, 200 rpm, shake for 30 min, 5000 rpm centrifuge for 3 min, discard the supernatant. Resuspend the bacterial cells with the remaining medium, and gently spread them on a plate containing kan resistance with a sterile spreader. After the bacterial solution is absorbed, invert the plate and incubate at 37°C overnight.

[0056] (5) Clone identification

[0057] The most convenient and fastest method is colony PCR. Use a sterile gun or toothpick to pick a single colony into 500 μL of LB medium and mix well, and directly take 1 μL as the PCR template, and the remaining bacterial solution is used for subsequent sequencing identification. The PCR reaction system is shown in Table 5.

[0058] Table 5: Colony PCR reaction system

[0059] Reaction solution Volume (μL) Template 1 2× Taq PCR Star Mix 10 Primer UbiP-seq / GFP-seq R (10 μM) 0.5 ddH2O 8 Total volume 20

[0060] The amplification procedure is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 25 cycles; 72℃ total extension for 5 min, 16℃ for 1 min. After the reaction, 20 μL of the amplification product is added to 1% agarose gel containing nucleic acid dye for electrophoresis; after electrophoresis, the gel is imaged under ultraviolet imaging instrument to detect whether the band is amplified. If the band is amplified, the clone is sent to a sequencing company for sequencing (sequencing is completed by Guangzhou Qikexin Biotechnology Co., Ltd.), and the sequencing primer is as follows:

[0061] UbiP-seq: TTTTAGCCCTGCCTTCATACGC;

[0062] GFP-seqR: AACTTGTGGCCGTTTACGTCG.

[0063] 2. Genetic transformation and identification of transgenic plants

[0064] The constructed pRHV-OsERF8 overexpression vector is sent to Baige Gene Technology Co., Ltd. for genetic transformation to obtain T0 generation plants. The obtained transgenic plants are identified, and since the pRHV-ERF8 overexpression vector carries a HYG hygromycin marker, it is only necessary to determine whether the transgenic plants are transgenic plants by identifying whether there is a hygromycin marker. The total genomic DNA of the plant to be tested is extracted, and primer HYG (Table 6) is used for PCR amplification. The size of the PCR product is determined by running agarose gel electrophoresis, and if it is consistent, it is a transgenic plant containing the target gene (i.e., an OsERF8 gene overexpression plant). The PCR amplification method is as described in step (1) of the plant pRHV-OsERF8 overexpression vector construction method. After the reaction, 5 μL of the amplification product is added to 1% agarose gel containing nucleic acid dye for electrophoresis, and after electrophoresis, the gel is imaged under ultraviolet imaging instrument to observe whether there is a target band. The T0 generation plants are selfed to obtain T1 generation plants, and the T1 generation plants are selfed to obtain T2 generation homozygous OsERF8 gene overexpression plants (OE-OsERF8).

[0065] Table 6: HYG identification primer

[0066]

[0067] In this embodiment, the OsERF8 gene is cloned from rice by PCR method, and the OsERF8 gene is of great significance for regulating rice grain development and can be used as a new target for improving rice grain traits. The OsERF8 gene is introduced into rice by genetic transformation, and a series of overexpression lines are screened. The phenotype of the overexpression lines is analyzed in detail.

[0068] Example 2: Construction of mutant lines

[0069] The osrtdl mutant was constructed according to the CRISPR / Cas9 technology described in Zeng D, Ma X, Xie X, et al. A protocol for CRISPR / Cas9-based multi-gene editing and sequence decoding of mutant sites in plants [J]. Scientia Sinica Vitae, 2018, 48(7): 783-794.

[0070] 1. Target sequence selection and primer design

[0071] The wild-type plant OsERF8 gene was used as the target site, with a 20-bp GGCTATGGCTCCTCTCGCCG. The primers were designed according to the target site.

[0072] gRT1: GGCTATGGCTCCTCTCGCCGgttttagagctagaaat;

[0073] OsU6aT1: CGGCGAGAGGAGCCATAGCCggcagccaagccagca.

[0074] 2. Partial overlap of PCR

[0075] (1) First round of PCR. The purpose of this step is to introduce the target sequence downstream of the U6a promoter and upstream of the sgRNA sequence, respectively. The experimental conditions are as follows: 2x Phanta Max Buffer 7.5 μl; 10 mM dNTPs Mix 0.25 μl; PhantaMax Polymerase 0.2 μl; YLgRNA-U6 / U32-5 ng; 10 μM U-F and U-T each 0.3 μl (reaction 1); 10 μM gR-T and gR-R each 0.3 μl (reaction 2); ddH2O to 15 μl; 25-26 PCR cycles: 95°C for 10 s, 58°C for 15 s, 72°C for 15 s. Take 3-5 μl of PCR product and check by 1.5% agarose gel electrophoresis (the length of reaction 2 product is about 140 bp). If the amplification product is weak, the second round of PCR can also be continued.

[0076] (2) Second round PCR. The purpose of this step is to construct the complete expression cassette with the promoter, target and sgRNA. The primers Pps-R / Pgs-L are synthesized according to the two targets, and the universal primer pair is mixed into working solution (10 μM each) in advance. In the second round of PCR, 30 μl system is selected for each expression cassette, 1 μl of the products of reaction 1 and reaction 2 in the first round of PCR is added to 8 μl of ddH2O to mix and dilute 10 times, and 1 μl is taken as the template for the second round of PCR. 3 μl of PCR product is electrophoresed for examination, and the approximate concentration of the sample is estimated. According to the concentration of the second round of PCR fragments of each expression cassette, all the expression cassette fragments are mixed in approximately equal amounts, and purified with a PCR product purification kit. Pps-R: TTCAGAggtctcTaccgACTAGTCACGCGTATGGAATCGGCAGCAAA; Pgs-L: AGCGTGggtctcGctcgACGCGTATCCATCCACTCCAAGC.

[0077] 3. Cloning of sgRNA expression cassette into pYLCRISPR / Cas9 vector

[0078] This step uses the "Golden Gate" cloning method based on BsaI digestion and ligation to assemble the sgRNA expression cassette into the pYLCRISPR / Cas9 vector in a "cut and connect" manner. Prepare a 15 μl reaction system: 10x CutSmart Buffer 1.5 μl; 10 mM ATP 1.5 μl (1.5 μl of 10x T4 DNA ligase buffer can also be added instead of ATP); pYLCRISPR / Cas9 plasmid 60-80 ng; purified mixed sgRNA expression cassette, 10-15 ng for each expression cassette, a total of 20-30 ng for two targets; BsaI-HF 10 U; T4 DNA ligase 35 U; ddH2O to 15 μl. Perform the cut and connect reaction with variable temperature cycling (PCR instrument can be used) for 10-15 cycles (37°C for 5 min, 10°C for 5 min, 20°C for 5 min); finally 37°C for 5 min.

[0079] 4. Transformation

[0080] Method same as overexpression vector construction.

[0081] 5. Genetic transformation and identification of transgenic plants

[0082] The constructed CRISPR / Cas9-OsERF8 vector was sent to Baige Gene Technology Co., Ltd. for genetic transformation to obtain T0 generation plants. The transgenic plants were then identified. Since the CRISPR / Cas9-OsERF8 vector carries a HYG hygromycin tag, the presence or absence of the hygromycin marker was sufficient to determine if a plant was transgenic. The detection method was the same as for the overexpression material identification described above. After the PCR amplification program, 5 μL of the amplification product was added to a 1% agarose gel containing nucleic acid dye for electrophoresis. After electrophoresis, the gel was irradiated with a UV imager to observe for the presence of the target band. The remaining PCR stock solution was sent to a sequencing company for sequencing, and the sequence was compared with the wild-type nucleotide sequence to determine the mutation type. T0 generation plants were self-crossed to obtain T1 generation plants. At this stage, it was necessary to detect whether the plants carried the CRISPR / Cas9 vector. Plants without the vector were selected for T1 generation seed harvest. T1 generation plants were then self-crossed to obtain T2 generation homozygous mutant plants (oserf8).

[0083] Example 3: Phenotypic Analysis of PEG under Drought Stress

[0084] This invention simulates drought stress with polyethylene glycol 6000 (PEG6000) after sowing wild-type (WT), OsERF8 mutant (oserf8), and OsERF8 overexpression (OsERF8-OE) japonica rice varieties at the farm of South China Agricultural University in Guangzhou, Guangdong Province.

[0085] Rice varieties tested: wild type, oserf8, OsERF8-OE

[0086] The specific steps are as follows: Newly sprouted wild-type, oserf8, and OsERF8-OE seeds were placed in 96-well plates with holes at the bottom, one seed per well, with three rows per strain. These were then placed in culture boxes containing rice nutrient solution and cultured at 28°C under light (16 hours light / 8 hours dark). After the rice seedlings had grown for two weeks, they were treated with 20% polyethylene glycol 6000 (PEG6000) to simulate drought for 5 days, followed by a 7-day recovery period with rice nutrient solution. The survival and mortality rates of each strain were recorded, and the survival rate was calculated. Each rice variety was repeated three times.

[0087] The t-test results are as follows Figure 1 As shown, Figure 1 The scale bar was 5 cm. Each rice variety was replicated three times. In the t-test results, compared with the wild type (WT), * indicates significant, ** indicates highly significant, n=3. Phenotypic analysis showed that before treatment, the growth status of wild type, oserf8, and OsERF8-OE was consistent. After rehydration, wild type, oserf8, and OsERF8-OE all showed varying degrees of damage. Compared with WT, however, the oserf8 plants showed less damage.Figure 1 a), OsERF8-OE plants were damaged more severely Figure 1 c) The survival rate of wild type was 33.3%, and the survival rates of OsERF8 mutant plants oserf8-1 and oserf8-2 were 73.6% and 84.4%, respectively Figure 1 b), significantly higher than that of wild type. The survival rate of wild type was 37.5%, and the survival rates of OsERF8-OE overexpression plants OsERF8-OE1 and OsERF8-OE2 were about 6.94% and 12.5%, respectively Figure 1 d), significantly lower than that of wild type. It showed that the mutation of OsERF8 improved the drought tolerance of rice under drought stress, and the overexpression of OsERF8-OE reduced the drought tolerance of rice under drought stress. It was inferred that OsERF8 negatively regulated the drought resistance of rice.

[0088] Example 4: Phenotype analysis of soil drought stress

[0089] The present application sowed japonica rice varieties wild type (WT) and OsERF8 mutant plants (oserf8) in Guangzhou, Guangdong Province, and planted them in pots after harvesting to perform soil drought stress.

[0090] Tested rice: wild type, oserf8

[0091] The specific steps are as follows: just after germination, wild type and oserf8 seeds are planted in wet soil, 24 seedlings of each variety are planted, and 28°C light culture (16 hours light / 8 hours dark) is performed. When the rice seedlings grow to 4 weeks old, watering is stopped, drought treatment is performed for 7 days, and then rice nutrient solution is added to recover for 7 days. The survival and death of seedlings of each variety is counted, and the survival rate is calculated. Each rice variety is repeated three times.

[0092] The results are shown in Figure 2 The phenotype analysis showed that after drought treatment and rehydration, oserf8 plants were damaged less severely than WT Figure 2 a) The survival rate of wild type was 31.94%, and the survival rates of OsERF8 mutant plants oserf8-1 and oserf8-2 were 61.11% and 66.67%, respectively Figure 2 b), significantly higher than that of wild type. It showed that the mutation of OsERF8 gene improved the drought tolerance of rice under drought stress. It was inferred that OsERF8 gene negatively regulated the drought resistance of rice.

[0093] Example 5: Analysis of malondialdehyde and proline content in the aerial part of plants after PEG treatment

[0094] Tested rice: wild type, os erf8, OsERF8-OE

[0095] The specific steps are as follows:

[0096] After the wild type, os erf8, and OsERF8-OE rice seedlings were cultured for 2 weeks, the aboveground parts of the rice seedlings were taken off and treated with PEG for 24 h to simulate drought, and the malondialdehyde and proline contents were determined using the malondialdehyde and proline content determination kits.

[0097] Proline is an important osmoregulation substance and signal molecule in plants, and plays multiple roles in plant growth, stress resistance, and quality improvement. Proline has the following effects on plant growth and development: (1) promotes seed germination and seedling growth; (2) enhances photosynthesis and dry matter accumulation; and (3) regulates hormone balance and optimizes plant type. Malondialdehyde (MDA) is the main end product of plant membrane lipid peroxidation, and its content change can reflect the physiological state and aging degree of plants under stress. Malondialdehyde causes damage to plant cell membranes and loss of function, and also inhibits plant photosynthesis.

[0098] The results are shown in Figure 3 Fig. 2, where different letters represent significant differences, p < 0.05, n = 3. The malondialdehyde content in the aboveground parts of OsERF8-OE was significantly higher than that of wild type rice under normal conditions, and the malondialdehyde content in the aboveground parts of os erf8 was the same as that of wild type under normal conditions. Compared with the normal culture conditions, the malondialdehyde content in the aboveground parts of OsERF8-OE was significantly higher than that of wild type rice after PEG treatment, and the malondialdehyde content in the aboveground parts of os erf8 was significantly lower than that of wild type Figure 3 (a). The proline content in the aboveground parts of OsERF8-OE was the same as that of wild type under normal conditions, and the proline content in the aboveground parts of os erf8 was significantly higher than that of wild type under normal conditions. Compared with the normal culture conditions, the proline content in the aboveground parts of OsERF8-OE was significantly lower than that of wild type rice after PEG treatment, and the proline content in the aboveground parts of os erf8 was significantly higher than that of wild type rice Figure 3 (b). The results prove that the aboveground parts of os erf8 mutants can synthesize more protective substances such as proline to protect rice from active oxygen after PEG stress treatment, thereby improving the drought resistance of rice.

[0099] The foregoing merely illustrates the principles of the application and application of its principles. For a fuller understanding of the application, one should refer to the read with the drawings, taking into account the appended claims and the full range of equivalents to which such claims are entitled. It is intended that all such changes and modifications that come within the spirit of the application be embraced by the claims.

[0100] The application described and claimed herein is not to be limited in scope by the specific aspects disclosed. While specific aspects have been discussed in some detail, alternatives will become apparent to those skilled in the art. For example, although the application has been described with respect to a particular embodiment, it is to be understood that various modifications and changes can be made by those skilled in the art which also fall within the scope of the application. For example, features of one embodiment can be interchanged with features of another embodiment.

Claims

1. Application of the OsERF8 gene in improving drought resistance of rice, characterized in that, The nucleotide sequence of the OsERF8 gene is shown as SEQ ID NO: 1, and the OsERF8 gene negatively regulates drought resistance of rice.

2. The use of the OsERF8 gene according to claim 1 to improve drought resistance of rice, characterized in that, The amino acid sequence of the protein encoded by the OsERF8 gene is shown as SEQ ID NO:

2. 3.The application of OsERF8 gene in improving drought resistance of rice according to claim 1, characterized in that, The improvement of drought resistance of the os erf8 mutant plant improves the survival rate of the os erf8 mutant plant under drought stress caused by soil dehydration or PEG.

4. The use of the OsERF8 gene according to claim 3 for improving drought resistance of rice, characterized in that, The improvement of drought resistance of the os erf8 mutant plant is that the malondialdehyde content of the above-ground part of the os erf8 mutant plant is significantly lower than that of the wild type plant under drought stress caused by PEG.

5. The use of the OsERF8 gene according to claim 3 to improve drought resistance of rice, characterized in that, The improvement of drought resistance of the os erf8 mutant plant is that the proline content of the above-ground part of the os erf8 mutant plant is significantly higher than that of the wild type plant under drought stress caused by PEG.

6. The use of the OsERF8 gene according to any one of claims 1 to 5 for increasing drought resistance in rice, characterized in that, The plant is rice, and the rice is japonica rice.

7. The use of the OsERF8 gene according to claim 6 for improving drought resistance of rice, characterized in that, The variety of the japonica rice is Zhonghua 11. 8.The application of the OsERF8 gene in improving drought resistance of rice according to claim 1, characterized in that, Knocking out the OsERF8 gene obtains an os erf8 mutant plant, and the drought resistance of the os erf8 mutant plant is enhanced.

9. A breeding method of drought-tolerant rice, characterized by, The method for knocking out the OsERF8 gene in rice as applied in any one of claims 1-8, the method comprising: constructing an sgRNA expression cassette; cloning the sgRNA expression cassette into a pYLCRISPR / Cas9 vector to obtain a CRISPR / Cas9-OsERF8 vector; transferring the CRISPR / Cas9-OsERF8 vector into a plant cell for genetic transformation to obtain a transgenic plant T0; screening a homozygous os erf8 mutant plant from the transgenic plant T0.

10. The method of claim 9, wherein, The construction of the sgRNA expression cassette comprises: designing a target point according to the OsERF8 gene to obtain a target point fragment; designing a primer pair according to the target point fragment, the primer pair being used for PCR amplification; performing first round PCR amplification on the target point fragment to obtain an amplification product; performing second round PCR amplification on the amplification product based on the primer pair to obtain the sgRNA expression cassette. The nucleotide sequence of the OsERF8 gene is shown as SEQ ID NO: 1, and the OsERF8 gene negatively regulates drought resistance of rice. The amino acid sequence of the protein encoded by the OsERF8 gene is shown as SEQ ID NO:

2. The improvement of drought resistance of the os erf8 mutant plant improves the survival rate of the os erf8 mutant plant under drought stress caused by soil dehydration or PEG. The improvement of drought resistance of the os erf8 mutant plant is that the malondialdehyde content of the above-ground part of the os erf8 mutant plant is significantly lower than that of the wild type plant under drought stress caused by PEG. The improvement of drought resistance of the os erf8 mutant plant is that the proline content of the above-ground part of the os erf8 mutant plant is significantly higher than that of the wild type plant under drought stress caused by PEG. The plant is rice, and the rice is japonica rice. The variety of the japonica rice is Zhonghua 11. Knocking out the OsERF8 gene obtains an os erf8 mutant plant, and the drought resistance of the os erf8 mutant plant is enhanced. The method for knocking out the OsERF8 gene in rice as applied in any one of claims 1-8, the method comprising: constructing an sgRNA expression cassette; cloning the sgRNA expression cassette into a pYLCRISPR / Cas9 vector to obtain a CRISPR / Cas9-OsERF8 vector; transferring the CRISPR / Cas9-OsERF8 vector into a plant cell for genetic transformation to obtain a transgenic plant T0; screening a homozygous os erf8 mutant plant from the transgenic plant T0. The construction of the sgRNA expression cassette comprises: designing a target point according to the OsERF8 gene to obtain a target point fragment; designing a primer pair according to the target point fragment, the primer pair being used for PCR amplification; performing first round PCR amplification on the target point fragment to obtain an amplification product; performing second round PCR amplification on the amplification product based on the primer pair to obtain the sgRNA expression cassette.

Images