Method for improving wheat scab resistance by mutating heavy metal binding protein TaHMAP

By knocking out the wheat TaHMAP gene using gene editing technology, multiple homozygous mutants were created, solving the problems of low efficacy and strong environmental dependence of wheat scab resistance sites in existing technologies. This achieved the effect of improving wheat scab resistance without affecting yield-related traits.

CN121380098APending Publication Date: 2026-01-23NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511600679.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-04
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

Existing technologies cannot effectively utilize gene editing to improve resistance to Fusarium head blight in wheat while maintaining yield-related traits unchanged. Furthermore, Fusarium head blight resistance sites are mostly minimally effective and highly environmentally dependent.

Method used

By designing CRISPR/Cas9 to target the second exon of the wheat gene TaHMAP, knocking out or reducing its expression, multiple independent TaHMAP homozygous mutants were created to improve wheat resistance to Fusarium head blight. Gene editing technology was used to mutate the A, B, and D subgenomic copies of the heavy metal binding protein TaHMAP.

Benefits of technology

This study achieved a significant improvement in wheat's resistance to Fusarium head blight while maintaining yield-related traits such as plant height, number of spikelets per ear, and thousand-grain weight, providing efficient breeding materials and germplasm resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a method for improving wheat scab resistance by mutating a heavy metal binding protein TaHMAP. According to the invention, a homozygous three-mutant strain KO-1-3 of the TaHMAP gene is created, and the gibberellic disease resistance of a TaHMAP gene function deletion mutant is found to be improved. The study on the lignin synthesis pathway gene in the mutant finds that the expression of the lignin regulation gene is improved after the TaHMAP gene mutation. Lignin content determination shows that the lignin content of the homozygous three mutants of the TaHMAP gene is obviously higher than that of a wild plant. Therefore, the TaHMAP mutant strain has potential value in the aspects of analyzing a wheat gibberellic disease resistant signal channel and improving the resistance of wheat to gibberellic disease, and can be used as a genetic resource for wheat gibberellic disease resistant breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and discloses a method for improving the resistance of wheat scab by mutating a heavy metal binding protein TaHMAP, and creates a wheat germplasm with improved resistance to scab. BACKGROUND

[0002] Fusarium Head Blight (FHB) is one of the major diseases of wheat worldwide, mainly caused by Fusarium graminearum. It not only causes a significant reduction in global wheat and other cereal crops, but also causes DON pollution, which seriously affects the quality of grains. The middle and lower reaches of the Yangtze River wheat region in China is a traditional high-incidence area of wheat scab due to its high temperature and humidity during the wheat heading period. The annual occurrence area is 4000-5000 million mu, which is more than 1 / 10 of the wheat sown area in China . In recent years, due to climate change and changes in farming methods, wheat scab has shown a clear northward and westward expansion, and has begun to break out on a large scale in the Huanghuai winter wheat region, China's major wheat-producing area . In 2023, the actual prevention and control area of wheat scab in China reached 353 million mu, greatly increasing the cost of wheat production. Therefore, tapping genetic resources, cloning and utilizing resistance genes, and cultivating disease-resistant varieties to reduce pesticide application are the most economical and effective means of preventing and controlling wheat scab.

[0003] Scab resistance is a complex trait controlled by multiple Quantitive Trait Loci (QTL). The named scab resistance QTLs include Fhb1 ~ Fhb9 , only Fhb1 and Fhb7 have been cloned, both of which have been used in wheat breeding in China. In particular, Fhb1 is considered to be the most effective QTL so far, and has been widely used in global wheat breeding programs in the past half century . Although Chinese scientists have made international leading progress in this field, most of the scab resistance loci are micro-effect QTLs, and the results of resistance identification are greatly affected by environmental factors, making it a great challenge to clone wheat scab resistance genes using forward genetics.

[0004] Wheat is an allohexaploid crop with A, B, and D subgenomes. In recent years, efforts to improve crop disease resistance by genetic modification of susceptible genes and to create broad-spectrum disease-resistant germplasm have begun to be reported The existence of wheat scab disease susceptibility genes has also been confirmed. Therefore, by biochemical screening, multi-omics analysis, etc. to excavate wheat scab disease susceptibility genes, through gene editing or mutagenesis to create resistance alleles, and applied to disease-resistant variety breeding, will be a feasible approach to increase wheat scab disease resistance genetic resources and breed wheat scab disease-resistant varieties.

[0005] [1]Liao S, Fang Z, Zhang C, et al. Current status and prospects of wheat resistance to scab and its mechanism [J]. Jiangsu Journal of Agricultural Sciences, 2021, 49(19): 51-6. [2]ZHANG F, ZHANG H, LIU J, et al. Fhb9, a major QTL for Fusarium head blight resistance improvement in wheat [J]. Journal of Integrative Agriculture, 2024. [3]LI G Q, ZHOU J Y, JIA H Y, et al. Mutation of a histidine-rich calcium-binding-protein gene in wheat confers resistance to Fusarium head blight [J]. Nat Genet, 2019, 51(7): 1106-+. [4]SU Z, BERNARDO A, TIAN B, et al. A deletion mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheat [J]. Nat Genet, 2019, 51(7): 1099-105. [5]WANG H W, SUN S L, GE W Y, et al. Horizontal gene transfer of from fungus underlies head blight resistance in wheat [J]. Science, 2020, 368(6493): 844-+. [6] MA H, ZHANG X, YAO J, et al. Breeding for the resistance to Fusarium head blight of wheat in China [J]. Frontiers of Agricultural Science and Engineering, 2019, 6(3): 251-64. [7] BAI G H, SHANER G. Management and resistance in wheat and barley to Fusarium head blight [J]. Annual Review of Phytopathology, 2004, 42: 135-61. [8] WANG N, TANG C, FAN X, et al. Inactivation of a wheat proteinkinase gene confers broad-spectrum resistance to rust fungi [J]. Cell, 2022, 185(16): 2961-74 e19. [9] DING Y, ZHANG F, SUN F, et al. Loss of OsHRC function confers blast resistance without yield penalty in rice [J]. Plant biotechnology journal, 2023, 21(8): 1516-8. SUMMARY

[0006] The application provides application of the gene TaHMAP in improving resistance of wheat to scab.

[0007] The application provides a genome TaHMAP, an A subgenome sequence as shown in SEQ ID NO. 8, an A subgenome coding region as shown in SEQ ID NO. 11, a B subgenome sequence as shown in SEQ ID NO. 9, a B subgenome coding region as shown in SEQ ID NO. 12, a D subgenome sequence as shown in SEQ ID NO. 10, and a D subgenome coding region as shown in SEQ ID NO. 13.

[0008] The application also provides a gene editing target capable of realizing functional knockout of TaHMAP, TaHMAPT1, located at the second exon of the gene TaHMAP.

[0009] The application also provides application of the gene TaHMAP in improving the resistance of wheat to scab, specifically knocking out or reducing the expression of the gene TaHMAP in wheat.

[0010] The application also provides application in breeding of wheat resistant to scab, specifically knocking out or reducing the expression of the gene TaHMAP in wheat to obtain a wheat variety resistant to scab.

[0011] Preferably, the application is knocking out or reducing the expression of the gene TaHMAP in wheat by the gene editing target provided in the application.

[0012] The application also provides a gene editing target detection primer.

[0013] The application also provides three pairs of gene editing target detection primers, namely TaHMAP-A-F and TaHMAP-A-R, TaHMAP-B-F and TaHMAP-B-R, and TaHMAP-D-F and TaHMAP-D-R, and the sequences are shown in SEQ ID NO. 2 and SEQ ID NO. 3, or shown in SEQ ID NO. 4 and SEQ ID NO. 5, or shown in SEQ ID NO. 6 and SEQ ID NO. 7. A, B and D three subgenomic copies are specifically amplified, located at the upstream and downstream positions of the target site TaHMAPT1, and 1119bp, 1166bp and 542bp bands can be amplified, respectively, which can be used for Sanger sequencing or second-generation sequencing to detect the mutation type of TaHMAP in the mutant

[0014] The gene TaHMAP editing target detection primer provided in the application is applied to identifying wheat varieties resistant to scab.

[0015] The application utilizes gene editing technology to mutate a gene TaHMAP encoding a heavy metal binding protein, and obtains a plurality of independent TaHMAP A, B and D three subgenomic copy homozygous mutants KO-1 ~ 3 Figure 1 Through phenotype identification of the three independent mutant strains, it is confirmed that the mutant strains are more resistant to scab than the wild type control Fielder, and the plant height, spikelet number per spike and thousand-grain weight and other yield-related traits have no obvious changes Figure 2The feasibility of using homozygous mutants of TaHMAP, KO-1 to KO-3, in wheat breeding for resistance to Fusarium head blight was confirmed. Real-time quantitative PCR and lignin content assays showed that TaHMAP is involved in inhibiting genes in the lignin synthesis signaling pathway, and the increase in lignin content in the wheat spike after knocking out this gene may be the key reason for the improved resistance to Fusarium head blight in wheat. Figure 3 ).

[0016] Beneficial effects:

[0017] 1. The gene editing target for knocking out TaHMAP disclosed in this invention provides a convenient way to efficiently knock out the TaHMAP gene in common wheat varieties such as Fielder and create breeding materials resistant to Fusarium head blight.

[0018] 2. This invention discloses a method for improving wheat resistance to Fusarium head blight by functionally knocking out the TaHMAP gene, without altering wheat yield-related traits, including plant height, number of spikelets per spike, and thousand-grain weight.

[0019] 3. The homozygous mutants KO-1 to 3 of the three subgenome copies A, B, and D of TaHMAP created in this invention provide germplasm resources for wheat breeding against Fusarium head blight. Attached Figure Description

[0020] Figure 1 Creation of TaHMAP gene-editing mutants. (A) Schematic diagram of the TaHMAP protein domains, which includes a heavy metal protein-binding domain and a proline-rich region; (B) The gene structure of TaHMAP and the location of its CRISPR / Cas9 target; (C) The sequence of the TaHMAP gene-editing target and its PAM sequence; (D) Genotyping results of three TaHMAP gene-editing mutant lines, KO-1, KO-2, and KO-3. Red "-" or letters indicate deleted or added nucleotides, respectively.

[0021] Figure 2 1. Results of identifying the Fusarium head blight resistance phenotype of the TaHMAP gene-edited mutant. (A) Representative images of the growth and development phenotypes and Fusarium head blight resistance phenotypes of the TaHMAP gene-edited mutant and the wild-type Fielder; (B) Statistical results of identifying the Fusarium head blight resistance phenotype of the TaHMAP gene-edited mutant. PSS% represents the incidence rate of Fusarium head blight on each spikelet, and "**" indicates that the Student TTEST result P < 0.01. (C) Statistical results of plant height, spikelet number per spikelet, and thousand kernel weight of the TaHMAP gene-edited mutant.

[0022] Figure 3 Functional knockout of TaHMAP increases lignin content in wheat spikes. (A) Real-time quantitative PCR results showed that the expression levels of key genes PAL1-6, CCR, and CAD in the lignin synthesis signaling pathway were significantly increased in the spikes of TaHMAP gene-edited mutants compared to wild-type. (B) Spikelets of wild-type Fielder and TaHMAP gene-edited mutants were infected with Fusarium graminearum before flowering, and samples were taken and sectioned after 72 h, and stained with phloroglucinol. The lignin content in the tissues was positively correlated with the staining intensity. (C) Spikelets of wild-type Fielder and TaHMAP gene-edited mutants were infected with Fusarium graminearum before flowering, and samples were taken and the lignin content was measured after 72 h. Detailed Implementation

[0023] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0024] Example 1: Design of TaHMAP gene editing targets

[0025] The TaHMAP gene sequence was obtained from the reference genome of the wheat variety Fielder. Through homology sequence alignment, a CRISPR / Cas9 target capable of simultaneously targeting three homologous copies was designed in three highly homologous subgenomic regions of the TaHMAP gene. This target was named TaHMAPT1, and its target sequence is GGTGGCAGCGGGCGCAATCC (SEQ ID NO. 1). The PAM sequence required for CRISPR / Cas9 gene editing is AGG (…). Figure 1 ).

[0026] Example 2: Creation of the TaHMAP mutant

[0027] To achieve TaHMAP gene knockout, the target sequence of TaHMAPT1 was constructed into the CRISPR / Cas9 vector pBUE411 (Addgene number #62200), and then transformed into the wheat variety Fielder via Agrobacterium infection. The steps included using immature embryos of the Fielder wheat variety 12-14 days after flowering as recipient material, pre-culturing them, and then transforming them into the wheat variety Fielder using Agrobacterium strain EHA105 (OD) containing the recombinant CRISPR / Cas9 vector. 600=0.6-0.8) were infected for 30 minutes. Subsequently, they were cultured in the dark for 3 days on co-culture medium containing 100 μM acetylsyleugenol to promote T-DNA transfer. The co-cultured explants were then transferred to selection medium for resistance selection, subcultured every 2-3 weeks to induce resistant callus formation. Finally, the callus was transferred to differentiation medium to obtain regenerated plants. After obtaining regenerated plants, the target site of TaHMAPT1 in each genetically transformed line was amplified using the following primers, and the genotype of each line was identified by sequencing. Three TaHMAP gene triple mutants, KO-1, KO-2, and KO-3, were finally obtained. Figure 1 ).

[0028] The primers for sequencing detection of gene editing target sites are as follows.

[0029]

[0030] Example 3: Identification of Fusarium head blight resistance phenotype and yield-related traits in TaHMAP mutants

[0031] To evaluate the utilization value of the TaHMAP gene knockout mutant in wheat scab resistance breeding, the wild-type variety Fielder and the TaHMAP gene knockout mutant were planted in 15 cm × 15 cm pots and cultivated in a greenhouse with day / night temperatures maintained at 26℃ and 20℃, respectively, a daily light duration of 16 hours, and a light intensity of 3000 lux. At the early flowering stage of wheat, a suspension of Fusarium graminearum conidia was injected into the florets of the central spikelet of the ear. After inoculation, the entire ear was covered with a moist plastic cover for 48 hours to maintain humidity. The spread of Fusarium graminearum within the ear was assessed by counting the number of diseased spikelets per ear and the total number of spikelets at 7, 9, and 11 days post-inoculation. The severity of scab in each line was assessed by calculating the percentage of diseased spikelets (PSS).

[0032] The results are as follows Figure 2 As shown, phenotypic identification of three independent mutant lines confirmed that the mutant lines had significantly higher resistance to Fusarium head blight than the wild-type control Fielder, and that yield-related traits such as plant height, number of spikelets per spike, and thousand-grain weight did not change significantly. This confirmed the feasibility of using the homozygous mutants KO-1 to 3 of TaHMAP in wheat Fusarium head blight resistance breeding.

[0033] Example 4: Analysis of the mechanism of TaHMAP mutant Fusarium head blight resistance phenotype

[0034] To better guide molecular breeding for wheat scab resistance, the mechanism by which the TaHMAP mutant enhances scab resistance was further elucidated. Real-time quantitative PCR confirmed that the expression levels of multiple lignin synthesis signaling pathway genes, including PAL1-6, CCR, and CAD, were significantly increased in the TaHMAP mutant compared to the wild type. To confirm that the TaHMAP mutant can increase the lignin content in wheat ears, spikelet sections of wild-type Fielder and TaHMAP mutants infected with Fusarium graminearum at flowering stage were stained with phloroglucinol to confirm the difference in lignin content between the two. Furthermore, the lignin content of wild-type Fielder and TaHMAP mutant spikelets at flowering stage was quantitatively measured using a commercial kit (Beijing Solarbio Science & Technology Co., Ltd., catalog number: BC4200), further confirming that TaHMAP loss of function can increase the lignin content in wheat ears.

[0035] Real-time quantitative PCR and lignin content assays showed that TaHMAP is involved in inhibiting genes in the lignin synthesis signaling pathway, as shown in the results. Figure 3 As shown, knocking out this gene significantly increased the lignin content in the wheat spike compared to the wild type, which may be the key reason for the improved resistance to wheat scab.

Claims

1. A gene editing target for knocking out the function of the TaHMAP gene, named TaHMAPT1, is located in the second exon of the TaHMAP gene.

2. The gene editing target according to claim 1, the sequence of which is shown in SEQ ID NO.

1.

3. Application of the TaHMAP gene in improving wheat resistance to Fusarium head blight, specifically by knocking out or reducing the expression of the TaHMAP gene in wheat.

4. The application according to claim 3, characterized in that, The editing targets for knocking out or reducing TaHMAP gene expression are as described in claim 1 or 2.

5. An application in wheat scab resistance breeding, specifically involving knocking out or reducing the expression of the TaHMAP gene in wheat to obtain wheat scab resistant varieties.

6. The application according to claim 5, characterized in that, The editing targets for knocking out or reducing TaHMAP gene expression are as described in claim 1 or 2.

7. A pair of primers for detecting TaHMAP gene editing targets.

8. The detection primers according to claim 7, with sequences as shown in SEQ ID NO.2 and SEQ ID NO.3; or as shown in SEQ ID NO.4 and SEQ ID NO.5; or as shown in SEQ ID NO.6 and SEQ ID NO.

7.

9. The application of the gene TaHMAP editing target detection primers as described in claim 7 or 8 in the identification of wheat varieties resistant to Fusarium head blight.