Indica rice type gene for cultivating nitrogen-efficient and yield-increasing rice and application of indica rice type gene

By editing the HTD1 gene of indica rice, the number of tillers and yield of rice were increased, solving the problem of low nitrogen fertilizer utilization efficiency in rice and achieving the effect of efficient nitrogen absorption and increased yield.

CN121380122APending Publication Date: 2026-01-23SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511606982.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-05
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

Existing rice varieties have low nitrogen fertilizer utilization efficiency, leading to resource waste and environmental problems, and limiting yield increases.

Method used

By editing the HTD1 gene in indica rice, the tillering, yield, and nitrogen uptake capacity of rice plants were altered. An indica rice HTD1 editing vector was constructed and introduced into the Xiushui 134 japonica rice variety to obtain indica rice HTD1 gene-edited plants, which enhanced nitrogen uptake and yield.

Benefits of technology

Under low or high nitrogen conditions, HTD1 edited indica rice plants significantly increased tiller number, yield per plant, and nitrogen uptake capacity, while reducing nitrogen fertilizer application, thus achieving efficient nitrogen fertilizer utilization and increased yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380122A_ABST
    Figure CN121380122A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, in particular to a nonglutinous rice type gene for cultivating nitrogen-efficient and yield-increasing rice and application of the nonglutinous rice type gene. The indica rice type HTD1 gene is located on a No.4 chromosome of rice, the nucleotide sequence of the indica rice type HTD1 gene is as shown in SEQ ID NO.1, and the amino acid sequence coded by the indica rice type HTD1 gene is as shown in SEQ ID NO.2. The HTD1 gene is cloned from a 9311 indica rice variety, a gene editing carrier is constructed, an indica rice type HTD1 editing plant is obtained, and the indica rice type HTD1 editing plant can regulate and control tillering, yield and nitrogen absorption capacity of rice. The character determination of the edited plant shows that compared with the control group rice, the indica rice type HTD1 edited plant shows the characters of tillering, yield and nitrogen absorption capacity increase under the low-nitrogen and high-nitrogen conditions, which indicates that the indica rice type HTD1 gene plays an important regulation function in the aspects of tillering, yield and nitrogen utilization of rice. An important gene resource is provided for cultivating a new rice variety with high yield and efficient nitrogen utilization, and remarkable agricultural economic value and ecological benefit are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a indica rice type gene for cultivating nitrogen-efficient and yield-increasing rice and application thereof. BACKGROUND

[0002] Nitrogen (N) is an essential macronutrient for plant growth and development, and plays a crucial role in the entire life cycle of plants. Since the "Green Revolution" in the 1960s, a batch of new varieties of semi-dwarf, lodging-resistant, high-yield rice, wheat and other crops have been cultivated and promoted, which has improved crop yield. The "Green Revolution" gene sd1 in rice encodes an important synthetic enzyme in the GA synthesis pathway, GA20 oxidase 2 (GA20ox2). The widely used mutant type sd1 in indica rice production leads to a decrease in endogenous active GA content in rice, which in turn leads to a decrease in rice plant height (Sasaki et al., 2002; Zhang, 2007). Although semi-dwarf rice varieties have high yield, they show reduced sensitivity to nitrogen fertilizer, which reduces nitrogen use efficiency (Nitrogen Use Efficiency, NUE) (Prabhu and Pingali, 2012), which is an important reason for limiting the further improvement of wheat and rice yield.

[0003] According to the statistics of the Food and Agriculture Organization of the United Nations (FAO), the nitrogen fertilizer consumed in China's grain production accounts for more than 30% of the global total, while the nitrogen use efficiency (NUE) in China is only about 30%, which is far lower than the average level of developed countries (FAO, 2019). Long-term reliance on large amounts of nitrogen fertilizer to maintain grain yield not only causes serious resource waste and environmental problems (Yu Fei et al., 2015), but also causes problems such as soil compaction, soil acidification, and decline in grain quality. Therefore, it is urgent to solve the scientific problems of ensuring high and stable grain yield while reducing fertilizer input in the green development of China's agriculture. SUMMARY

[0004] The present application is to overcome the shortcomings of the prior art, and provides a indica rice type gene for cultivating nitrogen-efficient and yield-increasing rice and application thereof. By constructing indica rice type HTD1 edited rice plants, the indica rice type HTD1 edited rice plants show increased tillering, increased yield per plant, and enhanced nitrogen uptake capacity under low-nitrogen or high-nitrogen planting conditions, thereby reducing the amount of nitrogen fertilizer and improving nitrogen use efficiency.

[0005] To achieve the above-mentioned purpose, the present application provides the following technical solutions: In a first aspect, a rice indica type HTD1 gene is provided, wherein a nucleotide sequence of the indica type HTD1 gene is shown as SEQ ID NO. 1, and an amino acid sequence encoded by the indica type HTD1 gene is shown as SEQ ID NO. 2.

[0006] The present application provides a brand new rice indica type HTD1 gene resource, wherein the gene HTD1 is located on the 4th chromosome of rice, and the rice tillering, yield and nitrogen absorption capacity are synergistically improved by editing the indica type HTD1 plant and changing the base, so as to realize the efficient utilization of nitrogen fertilizer while high yield, yield increase and fertilizer saving.

[0007] In a second aspect, an application of the indica type HTD1 gene in cultivating nitrogen efficient and yield-increasing rice is provided, wherein the application comprises obtaining the indica type HTD1 edited plant to realize the nitrogen efficient and yield-increasing rice under low nitrogen or high nitrogen conditions.

[0008] Further, the indica type HTD1 gene is edited by gene editing, the 3rd exon of the indica type HTD1 gene is edited, and a gRNA with a target sequence of TACAAGATCGACCCGCGGCG is used.

[0009] Further, the indica type HTD1 edited plant is obtained by the following steps: The indica type HTD1 gene shown as SEQ ID NO. 1 is cloned, an indica type HTD1 gene editing vector is constructed, the editing vector is introduced into Xiushui 134 japonica rice variety, and after cultivation, the indica type HTD1 gene edited plant is obtained.

[0010] Further, the vector is a pCAMBIA2300 vector.

[0011] When the indica type HTD1 edited plant is obtained, gene detection is also performed on the indica type HTD1 gene edited plant, PCR amplification and sequencing are performed by using a designed primer, and it is confirmed that the editing is successful.

[0012] Further, the nitrogen efficient and yield-increasing rice shows one or more properties: increased tiller number, increased yield per plant, and enhanced nitrogen absorption capacity.

[0013] Further, the increased tiller number is realized by obtaining the indica type HTD1 gene edited plant under low nitrogen or high nitrogen conditions.

[0014] Further, the increased yield per plant is realized by obtaining the indica type HTD1 gene edited plant under low nitrogen or high nitrogen conditions.

[0015] Further, the nitrogen absorption capacity enhancement is achieved by obtaining indica rice type HTD1 gene edited plant under low nitrogen or high nitrogen conditions.

[0016] Further, the indica rice type HTD1 gene is shown as SEQ ID NO. 1.

[0017] The beneficial effects of the present application are: The present application provides a brand new rice indica rice type HTD1 gene resource, the gene HTD1 is located on the 4th chromosome of rice, by cloning HTD1 gene from 9311 indica rice variety, constructing editing vector, obtaining indica rice type HTD1 edited plant in Xiushui 134 background. Phenotypic analysis shows that the tillering, yield and nitrogen absorption capacity of indica rice type HTD1 edited plant are significantly higher than those of control group rice (Xiushui 134) under low nitrogen or high nitrogen planting conditions. Specifically, it is proved by qRT-PCR that the indica rice type HTD1 edited plant is indeed edited successfully. The results show that the indica rice type HTD1 edited plant can significantly improve the yield while reducing the application of nitrogen fertilizer, which provides important gene resources for breeding new rice varieties with high yield and efficient nitrogen utilization, and has significant agricultural economic value and ecological benefits.

[0018] It should be understood that the above general description and the following detailed description are only exemplary and explanatory, and cannot limit the present application. BRIEF DESCRIPTION OF DRAWINGS

[0019] The drawings incorporated into the specification and forming part thereof show embodiments consistent with the present application and, together with the specification, serve to explain the principles of the present application.

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced below. Obviously, for those skilled in the art, other drawings can also be obtained without creative labor based on these drawings.

[0021] Figure 1 The figure of pCAMBIA2300 plasmid in the embodiments of the present application; Figure 2 The field phenotype figure of indica rice type HTD1 edited plant and wild type under low nitrogen (LN) and high nitrogen (HN) conditions in the embodiments of the present application; Figure 3 The tiller number statistical figure of indica rice type HTD1 edited plant and wild type under low nitrogen (LN) and high nitrogen (HN) conditions in the embodiments of the present application; the significant difference analysis uses t test, and the Tiller number is the tiller number; Figure 4 Figure 1 is a graph showing the yield of the indica rice type HTD1 edited plant and wild type under low nitrogen (LN) and high nitrogen (HN) conditions; the significant difference analysis uses t-test, and the grain yield per plant is the yield per plant; Figure 5 Figure 2 is a graph showing the nitrogen absorption capacity of the indica rice type HTD1 edited plant and wild type under low nitrogen (LN) and high nitrogen (HN) conditions; the significant difference analysis uses t-test. DETAILED DESCRIPTION

[0022] The embodiments of the present application will be described in detail below with examples, but those skilled in the art will understand that the following examples are only for illustration of the present application and should not be regarded as limiting the scope of the present application. If the specific conditions are not specified in the examples, the conventional conditions or the conditions recommended by the manufacturer are used. If the reagents or instruments used are not specified by the manufacturer, they are all conventional products that can be purchased on the market.

[0023] EXAMPLE This example discloses the obtaining of transgenic rice, including the following steps: 1) Extraction of total RNA The indica rice variety 9311 was sterilized with a 2.5% NaClO solution, germinated, and cultured to two-leaf-one-heart stage. Uniform-sized rice plants were selected, and the endosperm was removed and transplanted into a nutrient solution (pH = 5.5, 1 / 2 IRRI nutrient solution provided by the International Rice Research Institute (i.e., the IRRI nutrient solution provided by the International Rice Research Institute was diluted to 1 / 2 before use)). The plants were then replaced with the IRRI full nutrient solution at the four-leaf-one-heart stage. After one week of culture, the roots and leaves were frozen and stored in liquid nitrogen as samples. 0.1 g of the sample was ground with liquid nitrogen, and 1.5 mL of a centrifuge tube was added. 1 mL of Trizol reagent and 0.2 mL of chloroform were added, and after centrifugation, the supernatant was removed. 0.5 mL of isopropanol was added, and after centrifugation, the supernatant was discarded. The precipitate was washed with a 70% ethanol solution, and after centrifugation, the supernatant was discarded. The residual liquid in the centrifuge tube containing the precipitate was air-dried, and the precipitate was the extracted RNA. The RNA was dissolved in 1‰ DEPC water, and the quality of the RNA was detected by 1 wt% agarose gel electrophoresis. The concentration and purity of the total RNA were detected by a spectrophotometer. After passing the quality control, the next step was performed.

[0024] 2) Reverse transcription to obtain cDNA RNA sample 2 μg, add 50 μmol•L-1 Oligo dT18, add 1‰ DEPC water to 10 μL, 70℃ water bath for 5 min, place on ice for 5 min, then add RNase inhibitor 0.5 μL and 5xRT buffer 5 μL, 10 mM dNTPs 2.5 μL, M-MLV reverse transcriptase 1 μL, 1‰ DEPC water to 25 μL, 42℃ water bath for 60 min, then 70℃ water bath for 10 min to terminate the reaction (Oligo dT18 is provided by Nanjing KingsRiver Biotech Co., Ltd.; reverse transcription kit is purchased from Canada Fermentas (MBI Fermentas), the kit includes DEPC water, RNase inhibitor, 5xRT buffer, dNTPs, M-MLV reverse transcriptase), obtain cDNA, and sequence the cDNA to obtain the cDNA of 9311 indica rice varieties.

[0025] 3) Construction of editing vector A target site is designed at the 3rd exon of the gene; Target: GCGGGGGCGTCTGCTGACGGTCGCCT; 3.1 Synthesis of intermediate vector primers HTD1-F: 5'-TAGGTCTCATGCATACAAGATCGACCCGCGGCGGTTTCAGAGCTATGCTGGAAAC-3'; HTD1-R: 5'-TAGGTCTCAGGCCTTCTAGTTGGTTTAACGCGTAAC-3'; Primer denaturation and annealing to obtain gRNA fragments, and the PCR reaction system is as follows: add deionized ddH2O to the positive and negative primers respectively, and dilute to 100 μmol•L -1 -1. Respectively take 10 μL of mother liquor of primers HTD1-F and HTD1-R, and add them to the same PCR tube for annealing. The PCR reaction program is as follows: denaturation 98℃ for 10 min, annealing 55℃ for 10 min, and cooling 14℃ for 5 min.

[0026] 3.2 Enzymatic digestion and ligation to construct an intermediate vector The vector is digested by endonuclease at 37℃ overnight, and the enzyme digestion system is 10 μL of vector plasmid, 2 μL of AarⅠ, 5 μL of 10×Buffer, 50×oligonucleotide (0.025 mmol•L -1)1 μL, supplemented with ddH2O to 50 μL. The digested product was recovered, purified, eluted with 50 μL ddH2O, and stored at -20 °C for later use.

[0027] The gDNA fragment of HTD1 was ligated with pCAMBIA2300 vector. The ligation system was T4 DNA Ligase 1 μL, 5x Rapid Buffer 2 μL, annealed product fragment 6 μL, and pCAMBIA2300 vector 1 μL, incubated at 22 °C for 30 min.

[0028] The ligation system was transformed into E. coli DH5a competent cells, positive colonies were picked, and plasmids were extracted for DNA sequencing. The plasmids with correct sequencing were named HTD1-GE, respectively.

[0029] Subsequently, the agrobacterium was transformed, and the positive agrobacterium was used to infect rice callus to obtain indica rice type HTD1 gene editing material.

[0030] 4) Obtaining of transgenic plants In order to avoid the cytoplasmic gene mutation of rice cells generated in the transgenic process, different batches of transgenic experiments were carried out. From May 2024 to July 2024, the agrobacterium obtained above with HTD1-GE plasmid was used to infect rice callus, and the culture was carried out for 3 d. Different batches of T0 generation transgenic plants were obtained through the selection culture, differentiation, rooting, and seedling of resistant callus. In order to avoid the change of plant traits caused by cytoplasmic chimeras caused by non-genomic insertion, the present application carried out a propagation of all transgenic materials, obtained stable inheritance of T1 generation, and carried out physiological determination on the stable inheritance of T1 generation material.

[0031] The specific preparation of transgenic plants is as follows: 4.1) Agrobacterium-mediated rice transformation Induction of callus: peeled rice seeds (14 seeds in a dish) were soaked in a triangular flask with 70% ethanol for 1 min (submerged seeds), 70% ethanol was poured out, sterilized water was washed for 5-6 times, 2.5% NaClO solution was soaked for 30 min, and then sterilized water was washed for 5-6 times until clear. The seeds were picked up with tweezers and placed on sterilized filter paper, the water was absorbed, and finally the seeds were placed on induction medium (NB medium containing 2 mg / L 2,4-D) and cultured in a 32 °C light incubator for 5 d to obtain callus.

[0032] Preparation of Agrobacterium: Agrobacterium EHA105 strain with corresponding vector (HTD1-GE) was streaked on AB medium (50 mg / L Kanamycin (Kan)) and incubated at 28°C in dark for 3 days. The colonies of Agrobacterium were scraped off with a sterilized spoon and then suspended in AAM medium (containing 200 μmol•L -1 of As) to an OD600 of 0.1.

[0033] Infection of callus and co-cultivation: The rice callus was picked from the induction medium and placed in a centrifuge tube, with the number of callus not exceeding the conical part of the 50 ml centrifuge tube (selecting light yellow, plump and tough callus). 1 mL of the cultured Agrobacterium solution was taken in a 1.5 mL centrifuge tube and centrifuged at 4°C and 5000 rpm for 1 min, and the supernatant was removed. The collected bacteria were suspended in 30 mL of Agrobacterium solution containing 200 μmol•L -1 of acetosyringone (As) (the Agrobacterium solution was AAM medium containing 200 μmol•L -1 of acetosyringone), and the suspension was poured into the picked callus and infected for 5 min. The liquid was poured out, and the callus was taken out and placed on a sterile culture dish containing an absorbent paper to drain for 30-40 min. The callus was placed on the co-cultivation medium (provided by Wuhan Boyuan Biotechnology Co., Ltd.) with a layer of 9 cm sterile filter paper on top, and incubated at 25°C in dark for 3 days.

[0034] Washing bacteria and antibiotic selection culture: The callus was taken out from the co-cultivation medium and washed with sterile water for 5 times, with continuous shaking for 5 min each time. Then it was soaked in sterile water containing 500 mg•L -1 of carbenicillin (car) for 40-60 min. Finally, it was placed on a sterile filter paper to drain for 2 h. First round of selection: the dried callus was transferred to a selection medium containing 400 mg•L -1 of carbenicillin (car) and 50 mg•L -1 of hygromycin (Hyg) for the first selection, and incubated at 32°C under light for two weeks.

[0035] Second round of selection: the callus with vigorous growth was transferred to a differentiation medium containing 50 mg•L -1 of hygromycin B and 250 mg•L -1 of carbenicillin for induction of differentiation, and incubated at 28°C under continuous light for about two weeks.

[0036] Induction differentiation and rooting of resistant callus: pick the bright yellow resistant callus and transfer it into the differentiation tank containing differentiation medium, and put it into the constant temperature culture room. Wait for the differentiation into seedlings (about 30 days, the culture conditions in the tissue culture room are 24-30°C, 14h light / 10h dark), and put it into the rooting medium when the seedlings grow to about 5cm.

[0037] Training and transplanting of transgenic seedlings: pick out the test tube with well-differentiated roots and stems and leaves (the seedlings grow to the top of the test tube, and the cover should be opened in time), open the sealing film, add sterile water (to prevent the growth of bacteria in the medium), and train the seedlings for about 3-7 days, then wash off the agar and transplant them into the greenhouse for water culture or soil culture growth.

[0038] 4.2) Rapid detection of transgenic seedlings by hygromycin to obtain T0 generation plants Cut and collect fresh green leaves about 1 cm long from the seedlings to be detected (both ends have incisions), and place them flat on the medium containing hygromycin (80 mg•L -1 ), and incubate at 30°C for 16h / 8h (light / dark) for 48h. The leaves remain fresh green, which is a positive plant, while the leaves of negative seedlings appear massive necrosis. Through hygromycin screening, 20 positive T0 plant lines are obtained. In August 2024 to November 2024, the edited materials (positive T0 plant lines) are planted in Ledong Li Autonomous County, Hainan Province, and T1 generation seeds are obtained.

[0039] 4.3) Molecular identification of indica rice type HTD1 edited lines After the T1 generation seeds germinate, select homozygous edited lines (HTD1-GE), and collect root systems for RNA extraction (RNA extraction method is the same as before) at the seedling stage of gene edited seedlings (HTD1-GE) and wild type material Xiushui 134. After reverse transcription (reverse transcription method is the same as before), qRT-PCR is performed (qRT-PCR kit is used for operation, and the operation method refers to the instruction manual of the kit. The manufacturer of the qRT-PCR kit is Beijing Quanshi Gold Biotechnology Co., Ltd. The primers are as follows), quantitative PCR identification is performed, and homozygous GE edited lines are obtained.

[0040] HTD1-F: 5'-GCCGACGACAACAAGGCAA-3'; HTD1-R: 5'-GGAGGAGCGAATGGAAAATGC-3'; Test example The above GE edited strains were respectively cultivated to T1 generation, and then respectively treated with low nitrogen and high nitrogen in the field with wild type (Xiushui 134). Grouping: 48 edited strains were divided into low nitrogen GE group, 48 Xiushui 134 were divided into low nitrogen wild type group, 48 GE transgenic strains were divided into high nitrogen GE group, and 48 Xiushui 134 were divided into high nitrogen wild type group. Among them, the low nitrogen condition is 50 kg ha -1 urea; the high nitrogen condition is 150 kg ha -1 urea. The remaining conditions of the above 4 groups are consistent, and the 4 groups are cultivated to the mature period of rice, and the field phenotype observation, tillering statistics, yield per unit statistics and nitrogen absorption capacity statistics of the 4 groups are respectively carried out. The results are shown in Figure 2 、 Figure 3 、 Figure 4 and Figure 5 . Among them, Figure 3 、 Figure 4 and Figure 5 The results of each group in each group are the average values of the relevant data of each group. Figure 3 、 Figure 4 and Figure 5 a, b, c in and indicate the annotation of significant difference. If the difference is significant (p<0.05), different letters are marked, and if the difference is not significant, the same letter is marked.

[0041] As can be seen from Figure 2 , the T1 generation indica rice type HTD1 gene edited material (GE) and the wild type (Xiushui 134) have different field phenotypes under low nitrogen (LN, 50 kg ha -1 urea) and high nitrogen (HN, 150 kg ha -1 urea).

[0042] As can be seen from Figure 3 , compared with the wild type (Xiushui 134), the T1 generation indica rice type HTD1 gene edited material (GE) has a significant increase in tillering under low nitrogen (LN, 50 kg ha -1 urea) and high nitrogen (HN, 150 kg ha -1 urea).

[0043] As can be seen from Figure 4 , compared with the wild type (Xiushui 134), the T1 generation indica rice type HTD1 gene edited material (GE) has a significant increase in yield per unit under low nitrogen (LN, 50 kg ha -1 urea) and high nitrogen (HN, 150 kg ha -1 urea).

[0044] As can be seen from Figure 5As can be seen, the T1 generation indica rice type HTD1 gene editing material (GE) compared with wild type (Xiushui 134), under low nitrogen (LN, 50 kg ha -1 urea) and high nitrogen (HN, 150 kg ha -1 urea) conditions, the nitrogen absorption capacity is significantly increased.

[0045] In summary, the indica rice type HTD1 editing plant has obvious influence on tillering, yield and nitrogen absorption capacity.

[0046] The nucleotide sequence of the HTD1 gene is shown in SEQ ID NO. 1: The amino acid sequence encoded by the HTD1 gene is shown as SEQ ID NO. 2: MATQAIAPMHAAVVHRHHVLPPRRCVRRRGVFVRASAAAAAAAAETDTLSAAFWDYNLLFRSQRDECLDSIPLRVTEGAIPPDFPAGTYYLAGPGIFSDDHGSTVHPLDGHGYLRSFRFRPGDRTIHYSARFVETAAKREESRDGASWRFTHRGPFSVLQGGKKVGNVKVMKNVANTSVLRWGGRLLCLWEGGQPYEVDPRTLETVGPFDLLGLAAADDNKATNASAARRPWLQEAGLDAAARLLRPVLSGVFDMPGKRLLAHYKIDPRRGRLLTVACNAEDMLLPRSHFTFYEFDAHFDLVQKREFVVPDHLMIHDWAFTDTHYILLGNRIKLDIPGSLLALTGTHPMIAALAVDPRRQSTPVYLLPRSPETEAGGRDWSVPIEAPSQMWSVHVGNAFEEANRRGGLDVRLHMSSCSYQWFHFHRMFGYNWHHKKLDPSFMNAAKGKEWLPRLVQVAIELDRTGECRRCSVRRLSDQHARPADFPAINPSYANQRNRFVYAGAASGSRRFLPYFPFDSVVKVDVSDGSARWWSTDGRKFVGEPVFVPTGGGEDGGYVLLVEYAVSKHRCHLVVLDAKKIGTENALVAKLEVPKNLTFPMGFHGFWGDE It can be understood that the above embodiments only express the preferred embodiments of the present application, which are described in a more specific and detailed manner, but cannot be understood as a limitation to the scope of the present application; it should be noted that for those skilled in the art, the above technical features can be freely combined without departing from the concept of the present application, and several modifications and improvements can be made, which all belong to the protection scope of the present application; therefore, any equivalent transformation and modification within the scope of the claims of the present application shall belong to the scope of the claims of the present application.

Claims

1. A rice indica type HTD1 gene, characterized in that, The nucleotide sequence of the indica rice type HTD1 gene is shown as SEQ ID NO. 1, and the amino acid sequence encoded by the indica rice type HTD1 gene is shown as SEQ ID NO.

2.

2. The use of indica rice type HTD1 gene in breeding nitrogen efficient and yield increasing rice, characterized in that, The application comprises achieving nitrogen high efficiency and yield increase of rice under low-nitrogen or high-nitrogen conditions by obtaining indica rice type HTD1 edited plants.

3. The use of the indica rice type HTD1 gene according to claim 2 for breeding nitrogen-efficient and yield-increasing rice, characterized in that, The indica rice type HTD1 gene is edited by gene editing, the 3rd exon of the indica rice type HTD1 gene is edited, and a gRNA with a target sequence of GCGGGGGCGTCTGCTGACGGTCGCCT is used.

4. The use of the indica rice type HTD1 gene according to claim 2 for breeding nitrogen-efficient and yield-increasing rice, characterized in that, The indica rice type HTD1 edited plant is obtained by the following steps: The indica rice type HTD1 gene shown as SEQ ID NO. 1 is cloned, an indica rice type HTD1 gene editing vector is constructed, the editing vector is introduced into Xiushui 134 japonica rice variety, and after cultivation, an indica rice type HTD1 gene edited plant is obtained.

5. The use of the indica rice type HTD1 gene according to claim 4 for breeding nitrogen-efficient and yield-increasing rice, characterized in that, The vector is a pCAMBIA2300 vector.

6. The use of the indica rice type HTD1 gene according to claim 2 for breeding nitrogen-efficient and yield-increasing rice, characterized in that, The nitrogen high efficiency and yield increase type rice shows one or more of the following traits: increased tiller number, increased yield per plant, and enhanced nitrogen absorption capacity.

7. The use of the indica rice type HTD1 gene according to claim 6 for breeding nitrogen-efficient and yield-increasing rice, characterized in that, The increased tiller number is achieved by obtaining indica rice type HTD1 edited plants under low-nitrogen or high-nitrogen conditions.

8. The use of the indica rice type HTD1 gene according to claim 6 for breeding nitrogen-efficient and yield-increasing rice, characterized in that, The increased yield per plant is achieved by obtaining indica rice type HTD1 edited plants under low-nitrogen or high-nitrogen conditions.

9. The use of the indica rice type HTD1 gene according to claim 6 for breeding nitrogen-efficient and yield-increasing rice, characterized in that, The enhanced nitrogen absorption capacity is achieved by obtaining indica rice type HTD1 edited plants under low-nitrogen or high-nitrogen conditions.

10. The use of the indica rice type HTD1 gene according to any one of claims 2-9 for breeding nitrogen-efficient and yield-increasing rice, characterized in that, The indica rice type HTD1 gene is shown as SEQ ID NO. 1.