T-DNA complex as well as preparation method and application thereof

Abstract

The invention provides a T-DNA complex as well as a preparation method and application thereof, and belongs to the technical field of genetic engineering. The invention provides a preparation method of a T-DNA (T-deoxyribonucleic acid) complex, which comprises the following steps: binding a single-chain T-DNA containing a target gene with RecA protein and VirD2 protein in sequence to obtain VirD2-RecA-ssT-DNA. The preparation method is simple in step and convenient to operate. The invention further provides a transgenic method of the T-DNA complex based on the scheme, the T-DNA complex VirD2-RecA-ssT-DNA is transferred into a plant receptor under the action of the cell permeable membrane peptide, a transgenic plant is obtained through screening, and the average transformation efficiency is about 6.1%. According to the transgenic method disclosed by the invention, a technical system for transforming the T-DNA complex into the gramineous plant is established, and a technical support is provided for functional genomics research of the gramineous plant.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a T-DNA complex and a preparation method and application thereof. BACKGROUND

[0002] T-DNA (transferred DNA) is a DNA sequence in a Ti (tumor inducing) or Ri (root inducing) plasmid of Agrobacterium, which can be transferred from Agrobacterium and stably integrated into the nuclear genome of a plant, and has become a widely used genetic transformation vector in plant molecular biology. The T-DNA complex is designed according to the principle of Agrobacterium-mediated transformation, and is a transgenic method developed in recent years. The transformation method using the T-DNA complex can overcome the pollution caused by the overgrowth of bacteria after Agrobacterium infection, the lack of resistance of callus to bacteriostatic agents, and other shortcomings, so that this method may be paid more and more attention in the future genetic transformation of monocotyledonous plants. However, the preparation steps of the T-DNA complex are relatively complex, and need to be simplified. SUMMARY

[0003] The application aims to provide a T-DNA complex and a preparation method and application thereof, and the preparation method of the T-DNA complex of the application is simple in steps and convenient to operate.

[0004] The application provides a preparation method of a T-DNA complex, comprising the following steps: mixing a single-stranded T-DNA containing a target gene and a RecA protein to perform first compounding to obtain RecA-ssT-DNA; mixing the RecA-ssT-DNA and a VirD2 protein to perform second compounding to obtain VirD2-RecA-ssT-DNA.

[0005] Preferably, the target gene comprises TaTAA1C a gene; the TaTAA1C nucleotide sequence of the gene in the NCBI database has a sequence number of No: CAD30696.1.

[0006] Preferably, the nucleotide sequence of the single-stranded T-DNA has an amino acid sequence in the NCBI database with a sequence number of XP_044384179.1; the amino acid sequence of the VirD2 protein in the NCBI database has a sequence number of WP_010974919.1; and the amino acid sequence of the RecA protein in the NCBI database has a sequence number of NP_417179.1.

[0007] Preferably, the first complex reaction system, 150 µL in total, comprises the following components: single-stranded T-DNA containing a target gene 100 µL, 10×TKM Buffer 15 µL, RecA protein 10 µL and ddH2O 25 µL; the first complex procedure is: 37℃, reaction for 1 h; the second complex reaction system, 200 µL in total, comprises the following components: RecA-ssT-DNA 150 µL, 10×TKM Buffer 5 µL, VirD2 protein 8 µL and ddH2O 37 µL; the second complex procedure is: 37℃, reaction for 30 min.

[0008] Preferably, the single-stranded T-DNA containing a target gene is prepared by the following method: taking a recombinant plasmid as a template, performing PCR amplification by using long fragment primers T-DNA-F1 and T-DNA-R1 to obtain a PCR amplification product, recovering a target fragment to obtain double-stranded T-DNA; denaturing the double-stranded T-DNA to obtain single-stranded T-DNA; the backbone plasmid of the recombinant plasmid is pCXSN; the recombinant plasmid has a target gene inserted thereinto; the nucleotide sequence of the T-DNA-F1 is shown as SEQ ID NO. 1; the nucleotide sequence of the T-DNA-R1 is shown as SEQ ID NO. 2.

[0009] The application provides a T-DNA complex prepared by the preparation method.

[0010] The application provides an application of the T-DNA complex in plant transgenesis.

[0011] The application provides a transgenic method based on the T-DNA complex, comprising the following steps: mixing the T-DNA complex and a cell membrane permeable peptide, and then infecting a plant receptor.

[0012] Preferably, after the plant receptor is infected, the method further comprises: performing tissue culture on the successfully infected plant receptor; the tissue culture comprises sequentially performing differentiation culture and rooting culture to obtain a rooted resistant seedling.

[0013] Preferably, the plant receptor comprises callus of a plant; the callus comprises callus of a young embryo, a mature embryo, a stem tip or a bud tip; the plant comprises a Gramineae plant.

[0014] The application provides a preparation method of a T-DNA complex, comprising the following steps: mixing single-stranded T-DNA containing a target gene and RecA protein to perform first complexing to obtain RecA-ssT-DNA; mixing VirD2-ssT-DNA and VirD2 protein to perform second complexing to obtain VirD2-RecA-ssT-DNA. According to the preparation method, the T-DNA fragment is amplified by using a constructed recombinant plasmid as a template, the fragment can be stored at-20 DEG C for a long time, and the fragment does not need to be amplified in the later stage, so that the experimental steps are reduced; the preparation process of the T-DNA complex is simple, only two types of proteins VirD2 and RecA need to be added into the single-stranded T-DNA, the reaction time of each step is short, and the preparation of the complex can be completed in about 1.5 h. The preparation method has the advantages of simple preparation process, easy operation and in-vitro processing of the T-DNA complex. Under the action of a cell membrane permeable peptide, the obtained T-DNA complex is transferred into a plant receptor, transgenic plants are obtained through screening, and the average transformation efficiency is about 6.1%. In conclusion, the preparation method provides a technical system for transforming T-DNA complex into gramineous plants, and provides technical support for functional genomics research of gramineous plants. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 Figure is a process diagram of wheat genetic transformation by using T-DNA complex; A in the figure is a young embryo of Xiaoyan 22; B is a young embryo callus of wheat Xiaoyan 22 transformed by using T-DNA complex, and the callus is cultured on a screening medium for 25 days; C is a young embryo callus of wheat Xiaoyan 22 transformed by using T-DNA complex, and the callus is cultured on a differentiation screening medium; D is a transgenic wheat seedling on a screening-rooting medium; Figure 2 Figure is TaTAA1C Figure is a structural schematic diagram of an expression vector; Figure 3 Figure is a mode diagram of T-DNA complex preparation; Figure 4 Figure is a PCR identification result diagram of transgenic wheat; Figure 5 Figure is a drought resistance analysis result diagram of wild type plants and transgenic lines; D (drought) is drought stress treatment, and R (Rewater) is rewatering treatment; Figure 6 Figure is a water retention analysis result diagram of wild type plants and transgenic lines under drought stress; Figure 7 Figure is an observation diagram of leaf, leaf sheath and glume epidermis wax crystal structure of wild type plants and transgenic line T19-6 of the transgene TaTAA1C; Figure 8 Figure 1 is a diagram of the growth of plants in the process of genetic transformation of wheat "Xiaoyan 22" mature embryo callus mediated by T-DNA complex; A is the inoculation of wheat mature embryo; B is the induced mature embryo callus; C is the screening culture; D is the differentiation of resistant callus into seedlings; E is the rooting and strong seedlings of resistant seedlings; F is the transplanting to flower pots; Figure 9 Figure 2 is a diagram of the PCR identification results of T-DNA mediated genetic transformation of wheat mature embryo callus plants; Figure 10 Figure 3 is a diagram of the growth of plants in the process of genetic transformation of wheat "Xiaoyan 22" bud tip callus mediated by T-DNA complex; A is the wheat bud tip callus; B is the screening culture; C is the differentiation of resistant callus into seedlings; D is the rooting and strong seedlings of resistant seedlings; E is the transplanting to flower pots; Figure 11 Figure 4 is a diagram of the PCR identification results of T-DNA mediated genetic transformation of wheat bud tip callus plants; Figure 12 Figure 5 is a diagram of the transformation of callus of different sources by T-DNA complex in Examples 1-3; A in the figure is the culture of wheat "Xiaoyan 22" young embryo callus after being transformed by T-DNA complex on the screening medium for 25 days; a is the transgenic wheat seedlings formed by the wheat young embryo on the screening-rooting medium; B is the culture of wheat "Xiaoyan 22" mature embryo callus after being transformed by T-DNA complex on the screening medium for 25 days; b is the transgenic wheat seedlings of the wheat mature embryo on the screening-rooting medium; C is the culture of wheat "Xiaoyan 22" bud tip callus after being transformed by T-DNA complex on the screening medium for 25 days; c is the transgenic wheat seedlings of the wheat bud tip on the screening-rooting medium; Figure 13 Figure 6 is a diagram of the growth of plants in the process of genetic transformation of young millet embryo mediated by T-DNA complex; A is the inoculation of young millet embryo of millet "Longmi 18"; B is the young millet embryo callus; C is the T-DNA complex transformation of young millet embryo callus; D is the screening of millet embryonic callus; E and F are the differentiation of resistant callus into seedlings; G is the rooting culture; H is the transplanting of transformed seedlings; Figure 14 Figure 7 is a diagram of the PCR identification results of T-DNA mediated genetic transformation of young millet embryo callus plants; Figure 15 Figure 8 is a diagram of the growth of plants in the process of genetic transformation of "Xinong 979" young embryo mediated by T-DNA complex; A is the inoculation of wheat Xinong 979 young embryo; B is the young embryo callus; C is the screening of T-DNA complex transformation of wheat young embryo callus; D is the differentiation into seedlings; E is the rooting and strong seedling culture; F is the transplanting of transformed seedlings; Figure 16 PCR identification results of T-DNA mediated genetic transformation of Xianong 979 (WT) and transgenic line 1-1 under drought conditions are shown in the following figure. Figure 17 PCR identification results of T-DNA mediated genetic transformation of Xianong 979 (WT) and transgenic line 1-1 under drought conditions are shown in the following figure. Figure 18 The growth of plants in the process of Agrobacterium-mediated genetic transformation of Xiaoyan 22 embryo is shown in the following figure. A is the inoculation of Xiaoyan 22 embryo; B is the embryo callus; C is the screening of Agrobacterium-mediated wheat embryo callus; D is the differentiation of seedlings; E is the rooting and seedling culture; F is the transplanting of transformed seedlings. Figure 19 PCR identification results of T-DNA mediated genetic transformation of Xianong 979 (WT) and transgenic line 1-1 under drought conditions are shown in the following figure. DETAILED DESCRIPTION

[0017] The application provides a preparation method of a T-DNA complex, which comprises the following steps: mixing single-stranded T-DNA containing a target gene and RecA protein to perform first complexing to obtain RecA-ssT-DNA; mixing the RecA-ssT-DNA and VirD2 protein to perform second complexing to obtain VirD2-RecA-ssT-DNA.

[0018] In the embodiment of the application, the RecA protein is combined on the single-stranded T-DNA to protect it from being degraded; the VirD2 is connected to the end of the single-stranded T-DNA containing the target gene to identify the position of the cell nucleus and the cell nucleus DNA. The structural diagram of the VirD2-RecA-ssT-DNA is shown in the following figure. Figure 3 In the embodiment of the application, the target gene comprises TaTAA1C a gene; the TaTAA1C nucleotide sequence of the gene in the NCBI database has a sequence number of No: CAD30696.1.

[0019] In the embodiment of the present application, the nucleotide sequence of the single-stranded T-DNA in the NCBI database is XP_044384179.1; the amino acid sequence of the VirD2 protein (T-DNA border endonuclease) in the NCBI database is WP_010974919.1, and the VirD2 protein is a specific endonuclease that can recognize and cut the T-DNA border and assist in T-DNA transfer. The VirD2 protein is a signal peptide; the amino acid sequence of the RecA protein in the NCBI database is NP_417179.1; the RecA protein is a single-stranded binding protein that mainly binds to single-stranded DNA in cells to prevent degradation of single-stranded T-DNA in cells. In the embodiment of the present application, the RecA protein is a protein obtained by induced expression, specifically, the coding gene of the VirD2 protein is connected to the prokaryotic expression vector pET-28a, and the protein product obtained after purification after IPTG induced expression; the NCBI number of the coding gene of the VirD2 protein is NC_003065.3.

[0020] In the embodiment of the present application, the first complex reaction system is 150 µL, which includes the following components: 100 µL of single-stranded T-DNA containing a target gene, 15 µL of 10×TKM Buffer, 10 µL of RecA protein and 25 µL of ddH2O; the first complex procedure is 37°C, reaction for 1 h. In the first complex process of the present application, the main reaction is that the RecA protein binds to the single-stranded T-DNA. In the present application, the RecA protein is combined with the single-stranded T-DNA to prevent degradation of the single-stranded T-DNA. In the embodiment of the present application, the second complex reaction system is 200 µL, which includes the following components: 150 µL of RecA-ssT-DNA, 5 µL of 10×TKM Buffer, 8 µL of VirD2 protein and 37 µL of ddH2O; the second complex procedure is 37°C, reaction for 30 min. In the second complex process of the present application, the VirD2 protein specifically recognizes the 5' end of the ssT-DNA to form a covalent bond to form a T-DNA complex. In the present application, the VirD2 protein is combined with the single-stranded T-DNA to stabilize the T-DNA and also to assist in the transfer of ssT-DNA. The preparation method of the present application has a simple preparation process, which only needs to add RecA and VirD2 to the single-stranded T-DNA, and the reaction time of each step is relatively short, and the preparation of the T-DNA complex can be completed in about 1.5 h.

[0021] In the embodiment of the present application, the single-stranded T-DNA containing the target gene is prepared by the following method: using a recombinant plasmid as a template, performing PCR amplification by using long fragment primers T-DNA-F1 and T-DNA-R1 to obtain a PCR amplification product, recovering the target fragment to obtain double-stranded T-DNA, and denaturing the double-stranded T-DNA to obtain single-stranded T-DNA; the backbone plasmid of the recombinant plasmid is pCXSN; the target gene is inserted into the recombinant plasmid; the nucleotide sequence of T-DNA-F1 is shown in SEQ ID NO. 1; and the nucleotide sequence of T-DNA-R1 is shown in SEQ ID NO. 2.

[0022] In the embodiment of the present application, the T-DNA refers to the entire large fragment from the LB end to the RB end of the constructed recombinant plasmid. As an optional embodiment of the present application, when the T-DNA complex is prepared, the concentration of the T-DNA is ≥100 ng / μL, which can be 100-200 ng / μL, or 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 ng / μL. In the embodiment of the present application, the pCXSN is a plant binary expression vector, and the sequence number of the nucleotide sequence in the NCBI database is MN832866.1; the target gene is inserted into the multiple cloning site at Xcm I. In the embodiment of the present application, the recombinant plasmid is constructed by the following method: after adding A to the end of the nucleotide sequence of the target gene, the target gene is connected to pCXSN. In the embodiment of the present application, the target gene is the sequence of wheat TaTAA1C (Genebank No: CAD30696.1); the sequence of the wheat TaTAA1C can be amplified by using primers TaTAA1C-F and TaTAA1C-R; the nucleotide sequence of TaTAA1C-F is shown in SEQ ID NO. 3; and the nucleotide sequence of TaTAA1C-R is shown in SEQ ID NO. 4. The double-stranded T-DNA obtained by performing PCR amplification by using the constructed recombinant plasmid as a template can be stored at -20℃ for a long time, and does not need to be repeatedly amplified in the later application process.

[0023] The present application also provides a T-DNA complex prepared by the preparation method described in the above scheme. In the present application, under the action of a cell permeable peptide, the T-DNA complex can carry a target gene into a plant receptor, transgenic plants are obtained through screening, and the average transformation efficiency is about 6.1%.

[0024] The present application also provides the application of the T-DNA complex in plant transgenesis in combination with a cell permeable peptide.

[0025] The application further provides a transgenic method based on the T-DNA complex in the above-mentioned scheme, comprising the following steps: mixing the T-DNA complex and the cell permeable peptide, and then infecting the plant receptor. In the specific implementation of the application, the volume ratio of the T-DNA complex to the cell permeable peptide is 50:1; the cell permeable peptide comprises Tat2; the amino acid sequence of the Tat2 in the NCBI database is SEQ ID NO: 2ND6_A. As an optional implementation of the application, the infection temperature is room temperature, which can be 24℃; the infection time is 5-15 min, which can also be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 min. In the specific implementation of the application, after infecting the plant receptor, the method further comprises: carrying out tissue culture on the successfully infected plant receptor; the tissue culture comprises sequentially carrying out differentiation culture and rooting culture to obtain the rooted resistant seedlings; after obtaining the rooted resistant seedlings, the application further comprises practicing the rooted resistant seedlings; the tissue culture can be carried out by using conventional means. In the specific implementation of the application, the plant receptor comprises plant callus; the callus comprises callus of immature embryos, mature embryos, stem tips or bud tips, and further comprises callus of immature embryos, which has high embryogenic callus induction rate and differentiation rate, and can obtain more transgenic seedlings, see Figure 8 ; the plant comprises Gramineae; the Gramineae comprises millet and / or wheat. In an embodiment of the application, the wheat comprises 'Xiaoyan 22' and / or 'Xinong 979'.

[0026] Millet, wheat and other Gramineae are crops that are difficult to genetically transform, which seriously hinders the verification of functional genes. Taking wheat as an example, the methods for wheat genetic transformation are mainly gene gun method and Agrobacterium-mediated method. Among them, the gene gun method is relatively expensive and complicated to operate, and is prone to insert multiple fragments of exogenous genes; while the Agrobacterium-mediated method is simple to operate, but is prone to cause browning and Agrobacterium contamination of the transgenic receptor (callus), which affects the differentiation efficiency. The transgenic method of the application can transfer the T-DNA complex in the above-mentioned scheme into the plant receptor under the action of the cell permeable peptide, and obtain transgenic Gramineae plants through screening, with an average transformation efficiency of about 6.1%. The transgenic method of the application can overcome the obstacles of millet, wheat genetic engineering breeding and functional genomics research, and provide technical support for the genetic improvement of commercial wheat varieties.

[0027] In order to further illustrate the application, the technical solutions of the application are described in detail below with reference to the drawings and examples, but they should not be understood as limiting the scope of protection of the application.

[0028] In order to further distinguish the difference of the culture medium used in the embodiment, the culture medium used for transformation of different receptors (wheat young embryo, mature embryo, wheat bud tip callus and foxtail millet young embryo) is summarized, and the main culture medium formula is as follows: I. The wheat young embryo culture and genetic transformation medium formula used in embodiment 1: 1. Young embryo callus induction medium MSD2 formula: MS+2,4-D 2.0 mg / L+sucrose 30 g / L+agar 8 g / L, pH 5.8. 2. Screening medium MSS1 formula: MS+2,4-D 2.0 mg / L+hygromycin 50 mg / L+sucrose 30 g / L+agar 8 g / L, pH 5.8. 3. Differentiation screening medium MSK formula: MS+KT 1.5 mg / L+hygromycin 40 mg / L+sucrose 30 g / L+agar 8 g / L, pH 5.8. 4. Rooting and seedling culture medium MSR formula: 1 / 2MS+IAA 0.2 mg / L+sucrose 30 g / L+agar 8 g / L, pH 5.8. II. The wheat mature embryo culture and genetic transformation medium formula used in embodiment 2: 1. Mature embryo callus induction medium MSDP formula: MS+picloram 2.0 mg / L+asparagine 150 mg / L+hydrolyzed colloid protein (CH) 100 mg / L+sucrose 30 g / L+agar 8 g / L, pH 5.8. 2. Mature embryo resistant callus screening medium MSS2 formula: MS+picloram 1.5 mg / L+hygromycin 40 mg / L+sucrose 30 g / L+agar 8 g / L, pH 5.8. 3. Differentiation screening medium MSK2 formula: MS+KT 1.5 mg / L+hygromycin 30 mg / L+sucrose 30 g / L+agar 8 g / L, pH 5.8. 4. Rooting and seedling culture medium MSR formula: 1 / 2MS+IAA 0.1 mg / L+sucrose 30 g / L+agar 8 g / L, pH 5.8. III. The wheat bud tip callus culture and genetic transformation medium formula used in embodiment 3: 1. Bud tip embryo callus induction medium MSDA formula: MS+2,4-D 2.0 mg / L+hydrolyzed colloid protein (CH) 100 mg / L+sucrose 30 g / L+agar 8 g / L, pH 5.8. 2. Embryonic resistant callus screening medium MSS3 formula: MS+2,4-D 2.0 mg / L+hygromycin 40 mg / L+sucrose 30 g / L+agar 8 g / L, pH 5.8. 3. Differentiation screening medium MSK3 formula: MS+KT 2.0 mg / L+hygromycin 30 mg / L+sucrose 30 g / L+agar 8 g / L, pH 5.8.4. Rooting and seedling culture medium MSR formula: 1 / 2MS + IAA 0.1 mg / L + sucrose 30 g / L + agar 8 g / L, pH 5.8. IV. Embryo callus culture and genetic transformation medium formula used in Example 4: 1. Millet embryo callus induction medium MSD3 formula: MS + 2,4-D 3.0 mg / L + sucrose 30 g / L + agar 8 g / L, pH 5.8. 2. Resistant callus screening medium MSS4 formula: MS + 2,4-D 3.0 mg / L + hygromycin 50 mg / L + sucrose 30 g / L + agar 8 g / L, pH 5.8. 3. Differentiation medium MSK4 formula: MS + KT 2.0 mg / L + hygromycin 40 mg / L + sucrose 30 g / L + agar 8 g / L, pH 5.8. 4. Rooting and seedling culture medium MSR formula: 1 / 2MS + IAA 0.1 mg / L + sucrose 30 g / L + agar 8 g / L, pH 5.8. V. Agrobacterium-mediated wheat embryo callus genetic transformation medium formula in Comparative Example 1: 1. Agrobacterium amplification and propagation liquid medium YEP1 formula: yeast extract 10 g / L + NaCl 5 g / L + tryptone 5 g / L, pH 7.0. 2. Agrobacterium amplification and propagation solid medium YEP2 formula: yeast extract 10 g / L + NaCl 5 g / L + tryptone 5 g / L + agar 12 g / L, pH 7.0. 3. Agrobacterium resuspension medium LR: MS + MES 0.7 g / L + acetosyringone 40 mg / L + sucrose 30 g / L + glucose 2 g / L, pH 6.0. 4. Embryo callus induction medium MSD2 formula: MS + 2,4-D 2.0 mg / L + sucrose 30 g / L + agar 8 g / L, pH 5.8. 5. Embryo pre-culture and co-culture medium formula: MS + 2,4-D 2.0 mg / L + acetosyringone 40 mg / L + sucrose 30 g / L + agar 8 g / L, pH 5.8. 6. Embryo pre-culture medium MSDY formula: MS + 2,4-D 2.0 mg / L + acetosyringone 40 mg / L + sucrose 30 g / L + agar 8 g / L, pH 5.8. 7. Screening medium MSS5 formula: MS + 2,4-D 2.0 mg / L + hygromycin 50 mg / L + cefotaxime 150 mg / L + sucrose 30 g / L, pH 5.8. 8. Differentiation and screening medium MSK5 formula: MS + KT 1.5 mg / L + cefotaxime 150 mg / L + sucrose 30 g / L, pH 5.8. 9. Rooting and seedling culture medium MSR2 formula: 1 / 2MS + IAA 0.2 mg / L + cefotaxime 100 mg / L + sucrose 30 g / L, pH 5.8. The MS medium is mainly composed of macroelements, microelements, iron salts and organic components.The macroelement composition is NH4NO31650 mg / L, KNO31900 mg / L, CaCl2*2H2O 440 mg / L, MgSO4*7H2O 370 mg / L, KH2PO4170 mg / L; the microelement composition is KI 0.83 mg / L, H3BO36.2 mg / L, MnSO4*4H2O 22.3 mg / L, ZnSO4*7H2O 8.6 mg / L, Na2MoO4*2H2O 0.25 mg / L, CuSO4*5H2O 0.025 mg / L, CoCl2*2H2O 0.025 mg / L; the iron salt composition is FeSO4*7H2O 27.80 mg / L, Na2-EDTA 37.3 mg / L; the organic composition is myo-inositol 100 mg / L, nicotinic acid 0.5 mg / L, nicotinic acid pyridoxine 0.5 mg / L, nicotinic acid thiamine 0.1 mg / L, glycine 1.0 mg / L. The 1 / 2MS medium is that the contents of macroelements and microelements in the MS medium components are halved, and the rest components of iron salt and organic components are unchanged.

[0029] The wheat variety "Xiaoyan 22" in Examples 1-3 and Comparative Example 1 is bred by hybridization of (Xiaoyan No. 6 x 775-1) x Xiaoyan 107 and selected by pedigree method; the millet line "Longmi 18" in Example 4 is a variety bred by hybridization of Shanxi Yanbei Dahuangmi x Zhenyuan Jiloumi and selected by pedigree method. The wheat variety "Xinong 979" in Example 5 is bred by pedigree selection method using the high-quality, high-yield and early-maturing variety Xinong 2611 as the female parent and the F1 generation of (918 x 95 No. 1) as the male parent, and is a main variety promoted in the Huanghuaihai wheat region of China. The above varieties are all planted and preserved by the Plant New Variety Breeding Group of Yulin University.

[0030] Example 11, Preparation of Wheat Explants The wheat spikes of "Xiaoyan 22" at 12-15 days after flowering were taken, the grains were peeled, and the surface was sterilized in a 75% ethanol aqueous solution for 60 s, washed with sterile water for 2 times, sterilized with a 0.75% NaClO solution for 15 min, and finally washed with sterile water for 5 times. Under sterile conditions, the wheat immature embryos (about 1.0 mm in size) were peeled off Figure 1 The scutellum was upward (the wide surface was upward) and was connected to the callus induction medium MSD2, and was cultured in the dark at 25°C for 7 days to obtain wheat immature embryo callus.

[0031] 2. Preparation of T-DNA complex (1) Construction of TaTAA1C expression vector According to the sequence of wheat TaTAA1C provided by NCBI website (Genebank No: CAD30696.1), the primers TaTAA1C-F: aagatggttgacacactgagtg (SEQ ID NO. 3) and TaTAA1C-R: tcagttgagcatgtgctttag (SEQ ID NO. 4) were designed to amplify the full-length of the target fragment. The target fragment was amplified by PrimeStar DNA polymerase, and then end-A connected to the overexpression vector pCXSN (commercially available vector) driven by 35S promoter to construct the vector as shown in Figure 2 After bacterial colony PCR and sample sequencing, the plasmid DNA was extracted for standby use.

[0032]

[0033] (2) Extension of T-DNA fragment (the process of preparing T-DNA complex by using long T-DNA fragment is shown in FIG. 2): According to the vector constructed in step (1) and its sequence, a pair of long fragment primers T-DNA-F1: gaaggcctggtatatatcctgccagtggcaggatatattgtggt (SEQ ID NO. 1) and T-DNA-R1: agaggcctggtatatatcctgccaaacgctcttttctcttaggt (SEQ ID NO. 2) were designed, and KOD high-fidelity enzyme was used to extend the T-DNA sequence. The long T-DNA fragment contains a hygromycin marker gene. The system is shown in Table 1: Figure 3 Figure 2 Table 1 Amplification system of long T-DNA sequence

[0034] After the PCR reaction, 1.0% agarose gel electrophoresis was used for detection, and the target fragment was recovered by cutting the gel. The kit of GeneStar Company was used for recovery. The full-length T-DNA was amplified by using T-DNA-F1 and T-DNA-R1 with the constructed pCXSN vector as a template. The target size was 5400 bp, which was consistent with the predicted size. After cutting and recovering, the concentration was more than 100 ng / μL, which met the requirements for preparing T-DNA complex. TaTAA1C

[0035] (3) Formation of T-DNA complex First, denaturation process: 200 ng of T-DNA double-stranded was reacted at 95℃ for 10 min to obtain ss T-DNA. Second, RecA-ssT-DNA formation: the reaction was carried out in a 1.5 mL centrifuge tube, and the system is shown in Table 2.

[0036] Table 2 RecA-ssT-DNA synthesis reaction system

[0037] In this process, RecA protein binds to ss T-DNA to prevent degradation of single-stranded T-DNA.

[0038] Third, VirD2-RecA-ssT-DNA formation: the reaction was carried out in a 1.5 mL centrifuge tube, and the system is shown in Table 3.

[0039] Table 3 VirD2-RecA-ssT-DNA synthesis reaction system ​​​

[0040] In this process, the VirD2 protein specifically recognizes the 5' end of ss T-DNA to form a covalent bond, stabilizes the ss T-DNA, and also helps the ss T-DNA to transfer. Through this process, a T-DNA complex, VirD2-RecA-ssT-DNA, is obtained.

[0041] Finally, 24 μL of cell membrane permeable peptide Tat is added, and the wheat callus is mixed and then added to the mixed system to obtain a T-DNA complex VirD2-RecA-ssT-DNA-infected wheat callus at room temperature 24℃ for 2 h.

[0042] 3. Obtaining of transgenic wheat (1) After the T-DNA complex VirD2-RecA-ssT-DNA prepared in step 2 infects the wheat immature embryo callus prepared in step 1, the obtained callus is transferred to MSD2 for co-culture for 2 d. Then the callus is transferred to sterile filter paper to absorb excess water. (2) The callus is transferred to fresh screening medium MSS1 and placed in a dark incubator at 24℃ for culture, and the medium is replaced every 15 d, and the culture is performed for 25-30 d. Figure 1 (3) The resistant callus obtained by screening is picked out and transferred to differentiation screening medium MSK, and cultured in a culture box at 25℃, light intensity 12000 lx, light / dark time 14 h / 10 h until the resistant seedlings are differentiated. Figure 1 (4) The resistant seedlings are carefully transferred to rooting and seedling culture medium MSR. Figure 1 (5) After the resistant seedlings grow good roots, they are transplanted to a scientific research greenhouse.

[0043] 4. Molecular biology identification of transgenic wheat (1) Extraction of transgenic wheat genomic DNA (CTAB method, commercially available kit). (2) Transgenic wheat PCR detection The genomic DNA of the wheat leaves extracted in the above step is determined for concentration and diluted to 100-200 ng / μL, a pair of HPT primers is designed according to the selection marker gene hygromycin, HF2: 5'-CGAGTACTTCTACACAGCCAT-3' (SEQ ID NO. 5), HR2: 5'-AATAGCTGCGCCGATGGTTTCTAC-3' (SEQ ID NO. 6), and the product size is 826 bp. The PCR reaction system is shown in Table 4.

[0044] Table 4 PCR detection reaction system of transgenic wheat

[0045] Amplification procedure: 94℃, 4 min; 94℃, 10 s, 60℃, 30 s, 72℃, 50 s, 30 cycles; 72℃, 10 min. After PCR amplification, 0.5 μL of nucleic acid dye was added to each PCR tube, mixed, and 3 μL of sample was taken for 1.2% agarose gel electrophoresis detection and photography. The results showed that, after PCR detection, the target T-DNA had been transferred into wheat and integrated into its genome. The identification results are shown in Figure 4 . Figure 4 In the above table, + is a positive plasmid control, - is a wild type control, H2O is a negative control, 1-7 are transgenic lines, and the same below. Among them, 1 is a transgenic homozygous line T19-6; 2 is a transgenic homozygous line T28-2.

[0046] 5. Drought resistance analysis of transgenic wheat Drought stress treatment of transgenic wheat: 100 seeds of wild type and two transgenic homozygous lines T19-6 and T28-2 were taken, soaked with 1.0% hydrogen peroxide for 24 h, and then placed at room temperature for germination. The growth was observed every day. When it grew to 10 cm high, it was transplanted into soil, treated for 20 d, and then transferred to a research greenhouse for culture. When it grew to five-leaf stage, the wild type and two transgenic homozygous lines T19-6 and T28-2 were subjected to drought stress treatment. Each treatment was planted with 12 wheat plants, and repeated 5 times. The specific method of drought stress treatment was as follows: the initial soil water content was about 15%, no watering was performed, and the non-watering treatment was continued for 22 d, then watering was performed, and the survival rate was counted after 10 d of watering. The results showed that, compared with the control (wild type), the survival rate of transgenic wheat lines after 22 d of drought treatment and 10 d of watering (48.2%~55.6%) was significantly higher than that of the control (see Figure 5 , Figure 6 In the above table, i).

[0047] 6. Determination of water loss rate, chlorophyll extraction rate and proline content of transgenic wheat (1) Determination of water loss rate: During the above-mentioned 5 tests, two pots of drought-treated materials (WT, T19-6 and T28-2, each taking two pots) were taken, the leaves were wilted at this time, and after watering, they were covered with black plastic bags, treated in dark at room temperature for 12 h, and 4-5 leaf blades were cut with scissors, weighed, and 3 sets of parallel tests were performed for each treatment. After cutting the leaves, each test group was continued to be placed in dark at room temperature, and then the mass was weighed every 30 min, and the data was counted after 6 h, and the water loss rate was calculated. The results showed that the leaf water loss rate of transgenic wheat lines was significantly lower than that of the control lines, see Figure 6(2) Measurement of chlorophyll extraction rate: During the above-mentioned 5 experiments, two pots of material treated with drought for two weeks (WT, T19-6 and T28-2 each take two pots) were taken, wrapped with a black plastic bag, treated in the dark for 12 h, and two leaves were cut with scissors, and their mass was measured, and 3 parallel tests were performed for each treatment. Then the leaves were cut into 5 cm pieces, soaked in 100 mL of 80% ethanol solution, and placed in the dark. Thereafter, the absorbance values at 647 nm and 664 nm were measured every 30 min using a spectrophotometer. After 6 h, the measurement was stopped, and it was continued to be placed for 24 h, and finally the total chlorophyll content was measured. Finally, taking the amount extracted in 24 h as the standard, the extraction percentage at each time point was calculated. The experimental results show that the chlorophyll extraction rate of the transgenic wheat strain is significantly lower than that of the control strain, see Figure 6 (3) Measurement of proline content by ninhydrin colorimetry, referring to Plant Physiology Experiment written by Gao Junfeng (Gao Junfeng 2006). Proline, as an osmotic regulator, can maintain the osmotic balance between protoplasm and environment and maintain the integrity of membrane structure under biological stress. The experimental results show that under drought stress, the proline content of the transgenic wheat strain is significantly higher than that of the control strain, see Figure 6 iii, which indicates that the drought resistance of the transgenic wheat strain is improved.

[0048] 7. Leaf epidermis wax crystal analysis of transgenic wheat Select the seed of the transgenic wheat T19-6 strain with enhanced drought resistance to plant, and after the wheat grows to the heading stage, collect the flag leaf, leaf sheath and glume for wax crystal observation. First, the sample is dried at 50°C for 24 h, then the sample is pasted on the observation table with double-sided tape, the sample size is 1 cm x 1 cm, and after gold spraying treatment, it is observed and photographed by scanning electron microscope. At the same time, wild type wheat is used as a control for inspection. The results show that compared with the control, the wax crystal density of the transgenic wheat flag leaf front and back is significantly increased (Figure 7). Figure 7 ), which indicates that after overexpression of the TaTAA1C gene in the recipient, the gene has been expressed in the recipient, further indicating the feasibility of T-DNA complex transgene.

[0049] Example 21: Preparation of Wheat Explants. Healthy, plump, and disease-free mature wheat seeds of the fully mature variety "Xiaoyan 22" were collected and placed in sterile tissue culture bottles. Surface disinfection with 75% ethanol was applied for 1 minute, followed by sterilization with 10% NaClO solution for 20 minutes. The mature wheat seeds were then washed 4-5 times with sterile distilled water. Sterile distilled water was then added, the tissue culture bottle was tightly sealed, and the bottle was placed in a 4°C refrigerator for 10-12 hours. The distilled water in the tissue culture bottle was discarded, and 10% NaClO solution was added for sterilization for 20 minutes. The seeds were then washed 4-5 times with sterile distilled water, and excess distilled water was discarded. The seeds were then ready for use. Mature wheat embryos were extracted using a scalpel on a clean bench and inoculated onto MSDP medium. Figure 8 (A), placed in a biochemical incubator at 25℃ and cultured in the dark for 20 days, using the same method as in Example 1, to obtain mature wheat embryo callus ( Figure 8 (B)

[0050] 2. The preparation method of the T-DNA complex is the same as that in Example 1, step 2.

[0051] 3. The methods for obtaining transgenic wheat and the molecular biological identification methods for transgenic wheat are the same as those in 3 and 4 of Example 1. After infecting mature wheat embryo callus with the prepared T-DNA complex, the infected callus was transferred to MSS2 selection medium and cultured for 25 days to screen for resistant callus. Figure 8 (C); and resistant wheat seedlings were differentiated on differentiation medium MSK2 ( Figure 8 (D), after rooting and strengthening seedlings ( Figure 8 After seedling hardening and treatment (using the E-type seedlings), they are planted in flowerpots for cultivation. Figure 8 (F). When wheat reached the tillering stage, genomic DNA was extracted from leaves, and the concentration was determined and diluted to 100-200 ng / μL. Based on the selection marker gene hygromycin, a pair of HPT primers were designed: HF3: 5'-GCGAGTACTTCTACACAGCCATC-3' (SEQ ID NO. 8), HR3: 5'-GATCGTTTATGTTTATCGGCACTT-3' (SEQ ID NO. 9), with a product size of 800 bp. Transgenic positive single plants were preliminarily obtained through PCR screening and identification. Figure 9 ).

[0052] Example 31, Preparation of wheat explants Take healthy, plump mature wheat "Xiaoyan 22" seeds, put them into sterile tissue culture bottles, surface sterilize with 75% ethanol for 1 min, then sterilize with 10% NaClO for 20 min, and then wash the mature wheat seeds with sterile distilled water for 4-5 times; then add sterile distilled water, tightly cover the tissue culture bottle lid, and then place it in a 4°C refrigerator for 10-12 h; pour out the distilled water in the tissue culture bottle, then sterilize with 10% NaClO for 20 min, and then wash the seeds with sterile distilled water for 4-5 times for standby use. On the clean bench, inoculate the mature sterile wheat seeds on 1 / 2MS medium, place it in a 25°C biochemical incubator for dark culture for 3-5 d, grow out the sterile wheat sprouts, cut off the sterile sprout tips (about 1-2 cm) with a sterile scalpel, and then place it on MSDA induction medium, and then place it in a 25°C incubator for dark culture for 20 d to induce wheat sprout tip callus Figure 10 Example 1).

[0053] 2, The preparation method of the T-DNA complex is the same as that in Example 1.

[0054] 3, The method for obtaining transgenic wheat is the same as that in Example 2. After the prepared T-DNA complex is used to infect the mature embryo callus of wheat, the infected callus is transferred to the screening medium MSS3 for screening for 25 d to obtain resistant callus Figure 10 Example 1). Figure 10 Example 2), and then the resistant wheat seedlings are differentiated on the differentiation medium MSK3 Figure 10 Example 3), and then the seedlings are planted in flowerpots for culture Figure 10 Example 4). When the wheat grows to the tillering stage, collect the leaves to extract genomic DNA, take the diluted DNA as a template (100-200 ng / μL), take hygromycin as a screening marker, and design a pair of HPT primers, HF4: 5'-CGGTTTCCACTATCGGCGAGTAC-3' (SEQ ID NO. 10), and HR4: 5'-ACAGCGTCTCCGACCTGATGC-3' (SEQ ID NO. 11), and the product size is 924 bp. Through PCR identification, transgenic positive single plants are obtained Figure 11 ). The callus formed after the callus of wheat "Xiaoyan 22" is transformed with the T-DNA complex in Examples 1-3 and the transgenic wheat seedlings obtained from the corresponding callus are shown in Figure 12 .

[0055] Example 41. Preparation of Millet Explants The millet strain “Longmi 18” was selected as the experimental material (this material is a variety bred by pedigree selection through a cross between Shanxi Yanbei Dahuang Millet and Zhenyuan Zhaolitou Erhan Millet, with high embryogenic callus rate and differentiation rate). The seeds were sown in 12cm diameter flowerpots filled with nutrient substrate and placed in a constant temperature and humidity incubator (temperature 24℃, light 12000 lx, photoperiod:day:night = 12 h:12 h). When the plants reached the flowering stage, labels were attached to record the flowering time of each millet plant. 15 days after flowering, the seeds were peeled off and placed in clean culture bottles. The seeds were first surface-sterilized with 75% alcohol for 1 min, then with 10% NaClO (effective chlorine content 0.85%) for 10 min, and finally washed 5 times with sterile distilled water before use. On a clean bench, place the millet seeds on the stage of a stereomicroscope and gently remove the young embryos with tweezers (avoid damaging the embryos). Place the embryos with the scutellum facing upwards on MSD3 callus induction medium. Figure 13 (A), incubate in the dark at 24℃ for 15-20 days to induce callus tissue. Figure 13 (B) Embryogenic callus tissue was selected as explants for T-DNA complex infection.

[0056] 2. The preparation method of the T-DNA complex is the same as in Example 1.

[0057] 3. Obtaining transgenic millet (1) After the T-DNA complex VirD2-RecA-ssT-DNA prepared in step 2 was infected with the millet immature embryonic callus prepared in step 1, the transformed callus was transferred to MSD3 medium and co-cultured for 2 days. Figure 13 (C) Afterwards, the callus tissue was transferred to sterile filter paper to absorb excess moisture. (2) The callus tissue was transferred to fresh screening medium MSS4 and placed in a dark incubator at 24°C. The medium was changed every 15 days and cultured for 25-30 days to screen out resistant callus tissue. Figure 13 (3) Select the resistant callus obtained from the screening, transfer it to the differentiation screening medium MSK4, and culture it in an incubator at 25℃, light intensity of 12000 lx, and light / dark time of 12 h / 12 ​​h until it differentiates into resistant seedlings ( Figure 13 (4) Carefully transfer the resistant seedlings to the MSR rooting and seedling strengthening medium (E, F). Figure 13 After the resistant seedlings have developed good roots, they are hardened off and transplanted to the research greenhouse. Figure 13 (H).

[0058] 4. Molecular biological identification of the transgenic millet (1) Extraction of the transgenic wheat genomic DNA (CTAB method, commercially available kit). (2) PCR detection of the transgenic millet The wheat leaf genomic DNA extracted in the previous step was determined for concentration and diluted to 100-200 ng / μL, and according to the selection marker gene hygromycin, HPT primers were designed, HF2: 5'-CGAGTACTTCTACACAGCCAT-3' (SEQ ID NO. 5), HR2: 5'-AATAGCTGCGCCGATGGTTTCTAC-3' (SEQ ID NO. 6), and the product size was 826 bp. The specific method was the same as in Example 1. The results showed that, after PCR detection, Figure 14 , it was preliminarily indicated that the target T-DNA had been transferred into the millet and integrated into its genome.

[0059] Example 51. Preparation of wheat explants, which was the same as in Example 1, wherein the wheat variety was "Xinong 979". 2. Preparation method of T-DNA complex, which was the same as in Example 1. 3. Acquisition of transgenic wheat, which was the same as in Example 1. 4. Molecular biological identification of the transgenic wheat, which was the same as in Example 1. The results showed that, after PCR detection, the target T-DNA had been transferred into the wheat and integrated into its genome. The plant growth condition diagram in the process of T-DNA complex-mediated genetic transformation of "Xinong 979" young embryos was as shown in Figure 15 . The PCR identification result diagram of T-DNA-mediated "Xinong 979" young embryo callus genetic transformation plants was as shown in Figure 16 . 5. Wild type "Xinong 979" and the transgenic line (referred to as transgenic line 1-1) identified as positive by PCR were planted in the field and grown under natural drought conditions, and the growth conditions of wild type "Xinong 979" (WT) and transgenic line 1-1 were as shown in Figure 17 . It can be seen from Figure 17 that the growth condition of transgenic line 1-1 was better under drought conditions.

[0060] Comparative Example 1 Traditional Agrobacterium-mediated method, and the corresponding steps and methods were as follows: 1. Preparation of wheat "Xiaoyan 22" young embryo explants Wheat "Xiaoyan 22" was used as the test material, and the wheat panicles after 12-15 days of flowering were taken, the grains were peeled, and then surface sterilized with 75% alcohol solution for 60 s, washed with sterile water for 2 times, then sterilized with 0.75% NaClO solution for 15 min, and finally washed with sterile water for 4-5 times. The 1.0 mm size young embryos were peeled off Figure 18 in sterile conditions (A in ), and the scutes were upward (the wide surface was upward) and were inoculated on callus induction medium MSD2, and were cultured in dark at 25°C for 7-10 days to obtain wheat young embryo callus.

[0061] 2. Preparation of Agrobacterium (1) Take out competent Agrobacterium cells from the ultra-low temperature freezer, thaw them in an ice bath, add 2 µL of pCXSN-TAA1C plasmid (preparation method is the same as in Example 1) DNA to the centrifuge tube containing competent cells, mix well, incubate on ice for 30 min, freeze in liquid nitrogen for 1 min, then put it in a 37℃ water bath for 5 min, take it out and add 900 µL of antibiotic-free YEP liquid medium, and culture at 28℃ and 200 rpm for 3 h with shaking; (2) Centrifuge at 8000 rpm for 1 min, discard the supernatant and rehydrate the cells with 100 µL of YEP liquid medium, take 50 µL and spread it on YEP solid medium (containing 50 mg / L kanamycin and 100 mg / L rifampin), and culture upside down at 28℃ for 2~3 days until single colonies grow. (3) Pick the above-mentioned monoclonal Agrobacterium and culture it in 5 mL YEP liquid medium (containing 50 mg / L kanamycin and 100 mg / L rifampicin) at 28℃ and 200 rpm for 36 h to activate the cells; take 200 µL of the cells and inoculate them into 50 mL YEP liquid medium (containing 50 mg / L kanamycin and 100 mg / L rifampicin), and culture them for a second time at 28℃ and 200 rpm for 15-20 h. (4) Centrifuge at 8000 rpm for 5 min to collect the Agrobacterium cells obtained in the previous step, resuspend the cells in 100 mL of resuspension culture medium, activate them at 28℃ and 180 rpm for 1 h, and then dilute to OD. 600 The value is around 0.4, which is used for subsequent genetic transformation.

[0062] 3. Genetic transformation of wheat embryo callus mediated by Agrobacterium (1) The wheat embryo callus obtained in step 1 was transferred to the pre-culture medium MSDY and pre-cultured for 1 day. (2) The wheat embryo callus prepared in step 1 was infected with Agrobacterium prepared in step 2. The specific infection method was to transfer the callus into a tissue culture bottle containing Agrobacterium solution and place it on a shaker at 50-60 rpm for 15 min. After the infection was completed, the transformed callus was transferred to MSDY medium and co-cultured for 2 days. Figure 18 (B) Then transfer the callus tissue to sterile filter paper to absorb excess water. (3) Transfer the callus tissue to fresh screening medium MSS5 and place it in a dark incubator at 24℃. Change the screening medium every 15 days and culture for 25-30 days to screen out resistant callus tissue. Figure 18 C). (4) Pick out the resistant callus obtained from the screening, transfer it to the differentiation screening medium MSK5, and culture it in an incubator at 25℃, light intensity of 12000 lx, and light / dark time of 12 h / 12 ​​h until it differentiates into resistant seedlings ( Figure 18 (5) Carefully transfer the resistant seedlings to the MSR2 rooting and seedling strengthening medium (D). Figure 18After the resistant seedlings grow well, they are transplanted to the greenhouse for scientific research (Gardenia) Figure 18 Medium F).

[0063] 4. Step 4: Molecular biological identification of transgenic wheat (1) Extraction of genomic DNA of transgenic wheat (CTAB method, commercially available kit). The genomic DNA of the wheat leaves extracted in the previous step was determined for concentration and diluted to 100-200 ng / μL. According to the selection marker gene hygromycin, a pair of HPT primers was designed, HF5: 5'-cgcttctgcgggcgatttgt-3' (SEQ ID NO. 12), HR5: 5'-cgatgtaggagggcgtggata-3' (SEQ ID NO. 13), and the product size was 715 bp. The specific method was the same as in Example 1. The results showed that, after PCR detection (Fig. 2), Figure 19 ), it was preliminarily indicated that the target T-DNA had been transferred into the wheat and integrated into its genome.

[0064] The genetic transformation efficiency statistical results of the T-DNA complex in Examples 1-5 are shown in Table 5.

[0065] Table 5 Genetic transformation efficiency statistical results of the T-DNA complex in Examples 1-5

[0066] The genetic transformation efficiency comparison of the T-DNA complex method and the Agrobacterium-mediated method is shown in Table 6.

[0067] Table 6 Genetic transformation efficiency comparison of Examples 1 and Comparative Example 1

[0068] From Tables 5-6, it can be seen that the T-DNA complex genetic transformation method provided by the present application is suitable for different tissues of different types of wheat, and its genetic transformation efficiency is better than that of the traditional Agrobacterium-mediated genetic transformation.

[0069] In summary, taking the Agrobacterium-mediated genetic transformation as the control (Comparative Example 1), through the implementation cases (Examples 1-5), the T-DNA complex is used to transform the wheat epidermis wax synthesis related genes TaTAA1C , not only can improve the wheat transformation efficiency (Table 6), but also has been successful in the commercialized wheat variety "Xinong 979", and the research results provide a method reference for future functional gene verification of wheat, and also create new research materials for traditional breeding.

Claims

1. A method for preparing a T-DNA complex, characterized in that, Includes the following steps: The single-stranded T-DNA containing the target gene and the RecA protein are mixed to form the first complex, resulting in RecA-ssT-DNA. RecA-ssT-DNA and VirD2 protein were mixed and subjected to a second complexation to obtain VirD2-RecA-ssT-DNA.

2. The preparation method according to claim 1, characterized in that, The target gene includes TaTAA1C Gene; The TaTAA1C The nucleotide sequence number of the gene in the NCBI database is No. CAD30696.

1.

3. The preparation method according to claim 1, characterized in that, The nucleotide sequence of the single-stranded T-DNA has the following sequence number in the NCBI database: XP_044384179.1; the amino acid sequence of the VirD2 protein has the following sequence number in the NCBI database: WP_010974919.1; and the amino acid sequence of the RecA protein has the following sequence number in the NCBI database: NP_417179.

1.

4. The preparation method according to claim 1, characterized in that, The reaction system for the first complex, in 150 µL, comprises the following components: 100 µL of single-stranded T-DNA containing the target gene, 15 µL of 10×TKM Buffer, 10 µL of RecA protein, and 25 µL of ddH2O; the reaction program for the first complex is: 37 °C, reaction for 1 h. The reaction system for the second complex, in 200 µL, comprises the following components: 150 µL of RecA-ssT-DNA, 5 µL of 10×TKM Buffer, 8 µL of VirD2 protein, and 37 µL of ddH2O; the reaction program for the second complex is: 37 °C, reaction for 30 min.

5. The preparation method according to claim 1, characterized in that, The single-stranded T-DNA containing the target gene was prepared using the following method: Using the recombinant plasmid as a template, PCR amplification was performed using long-fragment primers T-DNA-F1 and T-DNA-R1 to obtain the PCR amplification product. The target fragment was recovered to obtain double-stranded T-DNA. The double-stranded T-DNA was then denatured to obtain single-stranded T-DNA. The backbone plasmid of the recombinant plasmid is pCXSN; the target gene is inserted into the recombinant plasmid. The nucleotide sequence of the T-DNA-F1 is shown in SEQ ID NO.1; the nucleotide sequence of the T-DNA-R1 is shown in SEQ ID NO.

2.

6. The T-DNA complex prepared by the preparation method according to any one of claims 1 to 5.

7. The application of the T-DNA complex combined with cell-permeable peptides as described in claim 6 in plant transgenic applications.

8. A transgenic method based on the T-DNA complex according to claim 6, characterized in that, The process includes the following steps: mixing the T-DNA complex and cell-permeable peptides and then infecting plant receptors.

9. The transgenic method according to claim 8, characterized in that, After infecting the plant receptor, the process also includes: performing tissue culture on the successfully infected plant receptor; the tissue culture includes sequential differentiation culture and rooting culture to obtain rooted resistant seedlings.

10. The transgenic method according to claim 8, characterized in that, The plant receptor includes plant callus; the callus includes callus from immature embryos, mature embryos, shoot tips, or bud tips; the plant includes grasses.

Images