Application of wheat specific subfamily gene TaHsfC3-4 in wheat salt tolerance improvement

By inhibiting or knocking out the wheat TaHsfC3-4 gene and using the CRISPR/Cas9 system for gene editing, the problem of insufficient salt tolerance in wheat grown in saline-alkali land was solved, and the salt stress resistance and growth performance of wheat were significantly improved.

CN121380174AActive Publication Date: 2026-01-23HEBEI ACADEMY OF AGRI & FORESTRY SCI INST OF GENETICS & PHYSIOLOGY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511893068.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-16
Publication Date
2026-01-23
Estimated Expiration
2045-12-16

AI Technical Summary

Technical Problem

Existing wheat varieties lack sufficient salt tolerance when planted in saline-alkali land, which limits the efficient utilization of saline-alkali land and the production of food security.

Method used

Salt tolerance in wheat can be improved by inhibiting or knocking out the expression of the TaHsfC3-4 gene and using the CRISPR/Cas9 system for gene editing.

Benefits of technology

It significantly improved the salt stress resistance of wheat, enhanced the growth and germination rate of wheat under salt stress, reduced leaf electrolyte leakage and cell membrane damage, and improved the salt tolerance of wheat.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380174A_ABST
    Figure CN121380174A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to application of a TaHsfC3-4 gene in wheat salt tolerance improvement. The registration number of the gene TaHsfC3-4 is OQ680124.1, the gene TaHsfC3-4 has a remarkable effect in regulating and controlling the salt tolerance of wheat, the wheat gene TaHsfC3-4 is knocked out through a CRISPR / Cas9 gene editing technology, a homozygous mutant of the wheat gene TaHsfC3-4 is obtained, after salt stress treatment, the phenotype and the physiological index of the TaHsfC3-4 gene knockout mutant are superior to those of a wild type Fielder, and the gene TaHsfC3-4 gene knockout mutant has the advantages that the gene TaHsfC3-4 gene knockout mutant can be used for regulating and controlling the salt tolerance of wheat. The wheat TaHsfC3-4 gene mutant has the specific expression that dry leaves of the mutant after salt stress treatment are few, the growth vigor is good, and the relative conductivity and malondialdehyde content of the leaves are lower, so that the oxidation resistance of the leaf cell membrane of the wheat TaHsfC3-4 gene mutant is improved, the integrity of the cell membrane is better, and the salt tolerance of the mutant is enhanced. The invention provides a new method for rapidly creating a new salt-tolerant wheat variety.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of a TaHsfC3-4 gene in salt tolerance improvement of wheat. BACKGROUND

[0002] Efficient utilization of saline-alkali land has great strategic significance for promoting food security production and sustainable development of agriculture in China. Wheat is an important food crop in China, and its planting area and yield are both the second in China. However, wheat is a non-salt plant, and the premise of planting in saline-alkali land is to breed varieties with good salt tolerance. It is very important to mine salt tolerance genes of wheat, improve salt tolerance of excellent wheat varieties by using modern biological breeding technology, and accelerate the realization of the scientific goal of "planting in suitable land", for efficient utilization of saline-alkali land, guarantee of food security and sustainable development of future agricultural production. SUMMARY

[0003] The application aims to provide application of a TaHsfC3-4 gene in salt tolerance improvement of wheat, and TaHsfC3-4 negatively regulates salt tolerance in wheat, thereby providing a new gene resource for wheat salt tolerance breeding by using genetic engineering technology.

[0004] The application adopts the following technical scheme:

[0005] The application provides application of a TaHsfC3-4 gene in salt stress improvement of wheat, and the accession number of the TaHsfC3-4 gene is OQ680124.1.

[0006] The application improves salt stress resistance of wheat by inhibiting expression of the TaHsfC3-4 gene or knocking out the TaHsfC3-4 gene.

[0007] As a preferred scheme, the application obtains a wheat variety with improved salt tolerance by constructing biological materials related to inhibition of the TaHsfC3-4 gene.

[0008] In some embodiments of the application, the biological materials do not include propagation materials.

[0009] In some embodiments of the application, the biological materials include nucleic acid molecules, vectors and cells.

[0010] In some embodiments of the application, the nucleic acid molecules include microRNAs, siRNAs, shRNAs, dsRNAs, sgRNAs and / or antisense oligonucleotides for inhibiting functions of the TaHsfC3-4 gene.

[0011] In some embodiments of the application, the sequence of the sgRNA is shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0012] In some embodiments of the present application, the sgRNA is used in combination with a CRISPR / Cas9 vector to achieve the purpose of gene knockout.

[0013] In some embodiments of the present application, the CRISPR / Cas9 vector further comprises an expression vector containing the sgRNA, and can further comprise a Cas9 protein or an expression vector for expressing a Cas9 protein.

[0014] In some embodiments of the present application, the vector includes but is not limited to Cas9 and other common vectors in the art.

[0015] In some embodiments of the present application, the cell includes at least one of E. coli and Agrobacterium. Among them, E. coli is a commonly used host cell for constructing vectors and plasmids in the art, and Agrobacterium is a common tool for delivering DNA molecules to plants in the art.

[0016] The present application also provides a method for breeding a wheat variety with improved salt tolerance, comprising the step of reducing the expression amount and / or activity of TaHsfC3-4 gene in wheat. In some embodiments of the present application, the wheat variety comprises the following characteristics: the salt tolerance is improved relative to the reference level; the reference level is the level of wild type.

[0017] In some embodiments of the present application, the step of reducing the expression amount and / or activity of TaHsfC3-4 gene in wheat is to introduce the biological material related to the inhibition of TaHsfC3-4 gene into the wheat tissue or wheat cell. In some embodiments of the present application, the introduction mode comprises using at least one of Ti plasmid, Ri plasmid, plant virus vector, microinjection, electroporation.

[0018] In some embodiments of the present application, the step of reducing the expression amount and / or activity of TaHsfC3-4 gene in wheat is specifically: (1) designing a target sequence sgRNA of TaHsfC3-4 gene, and constructing a CRISPR / Cas9 vector for wheat TaHsfC3-4 gene editing; (2) transforming the CRISPR / Cas9 vector of step (1) into Agrobacterium competent cells to obtain Agrobacterium containing the CRISPR / Cas9 vector; (3) infecting the Fielder's young embryo with the Agrobacterium infection solution obtained in step (2), and obtaining young seedlings again through tissue culture, and screening for a mutant strain of wheat TaHsfC3-4 gene mutation, without foreign Cas9 protein, and target sequence variation, and stable inheritance.

[0019] In some embodiments of the present application, the vector is pWMB110-Cas9. In some embodiments of the present application, the host cell is Agrobacterium C58C1. In some embodiments of the present application, the wheat variety is Fielder.

[0020] The beneficial effects of the present application are: the present application first discovers the application of TaHsfC3-4 gene in regulating the salt tolerance of wheat. By inhibiting the expression of TaHsfC3-4 gene in wheat and knocking out TaHsfC3-4 gene, the salt tolerance of wheat can be significantly improved, which provides a simple and effective technical means for rapidly creating a new salt-tolerant wheat line. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 Schematic diagram of TaHsfC3-4 gene mutation mode;

[0022] Figure 2 Wild type and TaHsfC3-4 mutant wheat under normal and salt stress conditions;

[0023] Figure 3 Wild type and TaHsfC3-4 mutant wheat under normal and salt stress conditions;

[0024] Figure 4 Wild type and TaHsfC3-4 mutant wheat under normal and salt stress conditions; DETAILED DESCRIPTION

[0025] The concept and technical effects of the present application will be described below in conjunction with the examples, so as to fully understand the purpose, features and effects of the present application. Obviously, the described examples are only part of the examples of the present application, but not all the examples. Based on the examples of the present application, other examples obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0026] Example 1 Design of TaHsfC3-4 knockout target sgRNA1 and sgRNA2

[0027] The TaHsfC3-4 sequence was retrieved from the Ensembl plants database, and the sequence containing the PAM domain of NGG in the conserved region was selected. Two of them were selected as targets, the target sequence was 20 bp, and they were named as sgRNA1 and sgRNA2, respectively. The sequence of SgRNA1 is shown as SEQ ID NO. 1, and the sequence of SgRNA2 is shown as SEQ ID NO. 2.

[0028] Example 2 Construction and identification of CRISPR / Cas9-TaHsfC3-4 vector

[0029] The target primers for constructing the TaHsfC3-4 gene editing vector were as follows: the sequence of sgRNA1 target primer TaHsfC3-4-gR1-F was shown in SEQ ID NO. 3, and the sequence of TaHsfC3-4-gR1-R was shown in SEQ ID NO. 4; the sequence of sgRNA2 target primer TaHsfC3-4-gR2-F was shown in SEQ ID NO. 5, and the sequence of TaHsfC3-4-gR2-R was shown in SEQ ID NO. 6.

[0030] The PCR amplification of sgRNA1 target was performed in the first reaction by adding U-F, gR-R, TaHsfC3-4-gR1-F and TaHsfC3-4-gR1-R four primers as templates, and the PCR amplification of sgRNA2 target was performed in the second reaction by adding U-F, gR-R, TaHsfC3-4-gR2-F and TaHsfC3-4-gR2-R four primers. The PCR program was set as follows: the first stage: 95℃, 5 min; the second stage (35 cycles): 95℃, 30 sec; 60℃, 30 sec; 72℃, 1 min; the third stage: 4℃ preservation. The sequence of U-F was shown in SEQ ID NO. 7, and the sequence of gR-R was shown in SEQ ID NO. 8.

[0031] The second round of PCR amplification was performed by using primers ZWHind-UF and ZWHindR containing enzyme cutting sites as templates, and the PCR amplification products were detected by agarose gel electrophoresis and purified by cutting and recovering; the sequence of ZWHind-UF was shown in SEQ ID NO. 9, and the sequence of ZWHindR was shown in SEQ ID NO. 10.

[0032] The vector backbone pWMB110-Cas9 was linearized by enzyme cutting with restriction endonuclease HindIII, and the linearized vector was detected by agarose gel electrophoresis and purified by DNA purification and concentration kit.

[0033] The second round of PCR products and the enzyme-cutting vector DNA were connected by In-Fusion ligase, and then transformed into E. coli competent cells.

[0034] Colony PCR identification was performed, and the colonies with the same size as the target product were selected, and then sent for sequencing after shaking and culturing. The correct clones were repropagated, and the plasmids were extracted and transformed into C58C1 Agrobacterium competent cells. The positive clones were selected and sent to the Chinese Academy of Agricultural Sciences for genetic transformation, and the receptor was wheat line Fielder.

[0035] Example 3 Identification of TaHsfC3-4 knockout wheat lines

[0036] Genomic DNA was extracted from the leaves of the T0 generation transgenic plants using a DNA extraction kit (Kangwei Century Biotechnology Co., Ltd.), and the gene sequences of each target were detected by PCR-RE. The detection primer sequences are as follows: F: GGCGCCGGCGGCATGGAGTGCTCA, R: TGGCCACCGGCACGTCGCTGAAA The PCR amplification products corresponding to the edited plants identified by PCR-RE were sent to a biological company for sequencing, and the editing types were analyzed according to the sequencing results. The different types of edited plants were statistically arranged, and homozygous mutant materials were retained. Finally, three homozygous mutants were obtained, designated M-28, M-30 and M-33, and the TaHsfC3-4 gene mutation types are shown in Figure 1 .

[0037] Example 4 Salt tolerance analysis of TaHsfC3-4 gene knockout lines

[0038] Phenotypic differences between wild type and TaHsfC3-4 mutant wheat under normal and salt stress conditions Under normal culture conditions, there was no difference in growth between the wild type and the TaHsfC3-4 mutant. After salt stress treatment, the growth of the three TaHsfC3-4 mutants was significantly better than that of the wild type, with more green leaves and fewer dry leaves. This indicates that the salt tolerance of the TaHsfC3-4 mutant wheat lines is significantly enhanced Figure 2 .

[0039] Enhanced germination rate of TaHsfC3-4 mutant wheat under salt stress Seeds were sterilized with 10% H2O2 for 10 min, rinsed repeatedly with distilled water to remove residues, and placed on filter paper under dark conditions at 25°C. The normal treatment group was irrigated with distilled water, and the salt stress group was irrigated with 1.2% NaCl solution. The germination rate was recorded daily. The results showed that under normal culture conditions, there was no difference in germination rate between the wild type and the mutant lines. Under salt stress treatment, the germination rate of the three TaHsfC3-4 mutant lines was significantly higher than that of the wild type. The TaHsfC3-4 mutant has enhanced salt tolerance during germination Figure 3 .

[0040] Reduced relative conductivity and leaf malondialdehyde content of TaHsfC3-4 mutant wheat under salt stress The wheat seedlings for physiological index determination were cultured in a substrate of vermiculite: nutrient soil 1:1, and the seedlings were grown to the 1-leaf 1-heart stage. The salt stress group was irrigated with a 200 mM NaCl solution. After 3 weeks of treatment, the leaf blades were taken to determine the relative conductivity and malondialdehyde content. Under normal culture conditions, there was no significant difference in the relative conductivity and malondialdehyde content of the leaf blades of the wild type Fielder and the TaHsfC3-4 mutant system. After salt stress treatment, the relative conductivity and malondialdehyde content of the leaf blades of the three TaHsfC3-4 mutant systems were significantly lower than those of the wild type wheat (Figs. 1 and 2), indicating that under salt stress, the electrolyte leakage of the leaf blades of the mutant system wheat was less, the cell membrane antioxidant capacity was enhanced, the cell membrane integrity was better, and therefore the salt tolerance of the TaHsfC3-4 mutant was better. Figure 4 ​

Claims

1. Application of a wheat-specific subfamily gene TaHsfC3-4 in improving plant salt tolerance; the nucleotide sequence registration number of the TaHsfC3-4 gene is: OQ680124.

1.

2. The application according to claim 1, characterized in that: Inhibiting or knocking out the TaHsfC3-4 gene can improve wheat salt tolerance.

3. Application of biomaterials associated with TaHsfC3-4 gene knockout in wheat breeding; The nucleotide sequence registration number of the TaHsfC3-4 gene is: OQ680124.1; The application is to construct biological materials related to the knockout of the TaHsfC3-4 gene to obtain wheat varieties with improved salt tolerance; The biological materials do not include reproductive materials; The biomaterials include nucleic acid molecules, carriers, and cells; The nucleic acid molecule includes an sgRNA that inhibits the function of TaHsfC3-4; the sequence of the sgRNA is shown in SEQ ID NO.1 and SEQ ID NO.2; The vector includes a CRISPR / Cas9 vector; The cells include at least one of Escherichia coli and Agrobacterium.

4. A method for breeding highly salt-tolerant wheat varieties, comprising the step of reducing the expression level and / or activity of the TaHsfC3-4 gene in wheat; The wheat variety possesses the following characteristics: increased salt tolerance compared to the recipient wild-type wheat; The step of reducing the expression level and / or activity of the TaHsfC3-4 gene in wheat involves introducing the biological material associated with the knockout of the TaHsfC3-4 gene as described in claim 3 into wheat tissue or wheat cells.

5. The method according to claim 4, characterized in that: The importation method includes at least one of Ti plasmid, Ri plasmid, plant virus vector, microinjection, and electroporation.

Citation Information

Patent Citations

  • Drought-resistant gene TaHsfC3-4 and application thereof in plant drought-resistant improvement

    CN118440949A

  • Application of TaHSFA6e gene in regulating tolerance of plant to salt stress

    CN119661674A

  • Genes and uses for plant enhancement

    US20110258735A1

  • Stress tolerance in plants

    US20170121733A1