SNP (Single Nucleotide Polymorphism) molecular marker of cucumber related to collection of pseudomonas and application of SNP molecular marker

Abstract

The invention provides a cucumber SNP (Single Nucleotide Polymorphism) molecular marker related to pseudomonas recruitment and application thereof, and belongs to the technical field of microorganisms. The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to collection of cucumber and pseudomonas. The SNP molecular marker is closely related to the enrichment condition of cucumber to pseudomonas. Compared with the haplotype cucumber with the SNP molecular marker being TTG, the haplotype cucumber with the SNP molecular marker being CCA can collect pseudomonas more efficiently, and the abundance of the pseudomonas in xylem is improved. By applying the Pseudomonas aeruginosa microbial inoculum to different haplotypes of cucumbers, the Pseudomonas aeruginosa microbial inoculum can significantly increase the number of Pseudomonas aeruginosa in haplotypes of cucumbers with SNP molecular markers as CCA, more significantly promote growth of cucumbers, and increase the plant height, stem diameter, leaf area, fresh weight, dry weight and 4-methylene glutamine content of cucumbers.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microorganisms, and particularly relates to a SNP molecular marker related to the recruitment of cucumber and pseudomonas and application thereof. BACKGROUND

[0002] There are a large number of beneficial microorganisms in the rhizosphere and internal tissues (such as xylem) of plants, collectively referred to as plant growth-promoting rhizobacteria (PGPR). These microorganisms can promote plant growth through mechanisms such as nitrogen fixation, phosphorus dissolution, iron carrier production, and plant hormone (such as indole-3-acetic acid, IAA) production, and can inhibit plant pathogens by producing antibacterial substances or inducing systemic resistance. Cucumber bacterial wilt caused by Ralstonia solanacearum is a serious vascular disease that causes significant losses to cucumber production. At present, the overuse of chemical pesticides has caused environmental pollution and pathogen resistance, etc. Therefore, it is of great significance to develop efficient and environmentally friendly biocontrol and growth-promoting strains. Ralstonia solanacearum

[0003] Xylem is the key channel for water and nutrient transport in plants, and the core microorganisms colonized in it may play a key role in plant health, but the resources of xylem endophytic bacteria with clear growth-promoting and biocontrol functions still need to be explored. The influence of different cucumber germplasms on the effect of microbial inoculants has not been reported. SUMMARY

[0004] In view of the defects in the prior art, the purpose of the present application is to provide a SNP molecular marker related to the recruitment of cucumber and pseudomonas and a pseudomonas agent interacting therewith; the SNP molecular marker is closely related to the enrichment of cucumber and pseudomonas; the pseudomonas agent has completely different effects on different haplotype plants of the SNP molecular marker, and can significantly promote the growth of cucumber with the SNP molecular marker CCA.

[0005] The purpose of the present application is achieved by the following technical solutions: The present application provides a SNP molecular marker related to the recruitment of cucumber and pseudomonas, which comprises Chr3_24847315, Chr3_24847328 and Chr3_24847344 on chromosome 3 of cucumber; Chr3_24847315 is located at 51bp of SEQ ID NO. 1; Chr3_24847328 is located at 64bp of SEQ ID NO. 1; Chr3_24847344 is located at 80bp of SEQ ID NO. 1; the polymorphism of Chr3_24847315 is T / C; the polymorphism of Chr3_24847328 is T / C; and the polymorphism of Chr3_24847344 is G / A.​

[0006] Preferably, the SNP molecular marker sequence is CCA to increase the abundance of Pseudomonas in the xylem of cucumber; and the SNP molecular marker sequence is TTG to reduce the abundance of Pseudomonas in the xylem of cucumber.

[0007] Preferably, the Pseudomonas includes Pseudomonas cinnabaris ivf-220.

[0008] The application provides application of the SNP molecular marker in the above technical solution in genetic diversity analysis and / or assisted selection breeding of cucumber.

[0009] The application provides a Pseudomonas agent interacting with the SNP molecular marker in the above technical solution, wherein the Pseudomonas agent includes Pseudomonas cinnabaris (ivf-220. Pseudomonas fulva ) with a preservation number of CGMCC No.36162.

[0010] The application provides a microbial preparation including the Pseudomonas agent in the above technical solution.

[0011] The application provides a preparation method of the microbial preparation in the above technical solution, including: Culturing the Pseudomonas agent in a culture medium to obtain the microbial preparation.

[0012] The application provides application of the Pseudomonas agent in the above technical solution, the microbial preparation in the above technical solution or the microbial preparation prepared by the preparation method in the above technical solution in preparation of a plant pathogenic bacteria preparation; the plant pathogenic bacteria includes Ralstonia solanacearum.

[0013] The application provides application of the Pseudomonas agent in the above technical solution, the microbial preparation in the above technical solution or the microbial preparation prepared by the preparation method in the above technical solution in promoting growth of cucumber; the cucumber includes cucumber with the SNP molecular marker CCA in the above technical solution.

[0014] The application provides application of the Pseudomonas agent in the above technical solution, the microbial preparation in the above technical solution or the microbial preparation prepared by the preparation method in the above technical solution in increasing 4-methylene glutamine content in cucumber; the cucumber includes cucumber with the SNP molecular marker CCA in the above technical solution.

[0015] The application has the following beneficial effects: The application provides a SNP molecular marker related to Pseudomonas recruitment of cucumber, which comprises Chr3_24847315, Chr3_24847328 and Chr3_24847344 on chromosome 3 of cucumber; the Chr3_24847315 is located at 51 bp of SEQ ID NO. 1; the Chr3_24847328 is located at 64 bp of SEQ ID NO. 1; the Chr3_24847344 is located at 80 bp of SEQ ID NO. 1; the polymorphism of the Chr3_24847315 is T / C; the polymorphism of the Chr3_24847328 is T / C; and the polymorphism of the Chr3_24847344 is G / A. In the application, the SNP molecular marker is closely related to the Pseudomonas enrichment of cucumber. The cucumber with the SNP molecular marker of CCA can more efficiently recruit Pseudomonas and improve the Pseudomonas abundance in xylem than the cucumber with the SNP molecular marker of TTG. In the application, a Pseudomonas fluorescens inoculant is applied to different haplotypes of cucumber, the Pseudomonas fluorescens inoculant can significantly improve the number of Pseudomonas fluorescens in the cucumber with the SNP molecular marker of CCA, more significantly promote the growth of cucumber, and improve the plant height, stem diameter, leaf area, fresh weight, dry weight and 4-methylene glutamine content of cucumber; and the Pseudomonas fluorescens inoculant has no significant improvement effect on the growth of the cucumber with the SNP molecular marker of TTG.

[0016] Biological preservation information Pseudomonas fluorescens ivf-220, the Latin name of which is Pseudomonas fulva , was preserved in the China General Microbiological Culture Collection Center on October 13, 2025, the address of which is No. 1, Beichen West Road, Haidian District, Beijing, and the preservation number is CGMCC No. 36162. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 is Pseudomonas The relative abundance diagram of ASV4 in different haplotypes; Figure 2 is the gene structure diagram and functional annotation diagram of three genes located within the range of 15 kb upstream and downstream of the significant SNP (Chr3_24 847 328); Figure 3 is the transcriptome result diagram of the three genes; Figure 4 is the maximum likelihood phylogenetic tree diagram of strain ivf-220 based on 92 core genes; Figure 5Figure 1. Average nucleotide identity (ANI) plot of strain ivf-220 and the closest model strains; Figure 6 Figure 2. Circular genome plot of strain ivf-220; Figure 7 Figure 3. Results plot of strain ivf-220 phosphate solubilization capacity on inorganic phosphorus; Figure 8 Figure 4. Results plot of strain ivf-220 phosphate solubilization capacity on organic phosphorus; Figure 9 Figure 5. Results plot of strain ivf-220 siderophore production capacity; Figure 10 Figure 6. Results plot of strain ivf-220 ammonium production capacity; Figure 11 Figure 7. Results plot of strain ivf-220 antagonistic effect on Ralstonia solanacearum; Figure 12 Figure 8. Photographs of strain ivf-220 effect on Hap1 (TTG) genotype cucumber variety growth; Figure 13 Figure 9. Results plot of strain ivf-220 effect on Hap1 (TTG) genotype cucumber variety plant height; Figure 14 Figure 10. Results plot of strain ivf-220 effect on Hap1 (TTG) genotype cucumber variety stem thickness; Figure 15 Figure 11. Results plot of strain ivf-220 effect on Hap1 (TTG) genotype cucumber variety leaf area; Figure 16 Figure 12. Results plot of strain ivf-220 effect on Hap1 (TTG) genotype cucumber variety fresh weight; Figure 17 Figure 13. Results plot of strain ivf-220 effect on Hap1 (TTG) genotype cucumber variety dry weight; Figure 18 Figure 14. Results plot of strain ivf-220 effect on Hap1 (TTG) genotype cucumber variety 4-methylene glutamine relative content; Figure 19 Figure 15. Photographs of strain ivf-220 effect on Hap2 (CCA) genotype cucumber variety growth; Figure 20 Figure 16. Results plot of strain ivf-220 effect on Hap2 (CCA) genotype cucumber variety plant height; Figure 21 Figure 17. Results plot of strain ivf-220 effect on Hap2 (CCA) genotype cucumber variety stem thickness; Figure 22Figure of the influence of strain ivf-220 on the leaf area of Hap2 (CCA) genotype cucumber varieties; Figure 23 Figure of the influence of strain ivf-220 on the fresh weight of Hap2 (CCA) genotype cucumber varieties; Figure 24 Figure of the influence of strain ivf-220 on the dry weight of Hap2 (CCA) genotype cucumber varieties; Figure 25 Figure of the influence of strain ivf-220 on the 4-methylene glutamine relative content of Hap2 (CCA) genotype cucumber varieties; Figure 26 Figure of the observation of the colonization of strain ivf-220 in the xylem of cucumber. DETAILED DESCRIPTION

[0018] The present application provides a SNP molecular marker related to the recruitment of Pseudomonas in cucumber, which comprises Chr3_24847315, Chr3_24847328 and Chr3_24847344 on the 3rd chromosome of cucumber; Chr3_24847315 is located at 51bp of SEQ ID NO. 1; Chr3_24847328 is located at 64bp of SEQ ID NO. 1; Chr3_24847344 is located at 80bp of SEQ ID NO. 1; the polymorphism of Chr3_24847315 is T / C; the polymorphism of Chr3_24847328 is T / C; the polymorphism of Chr3_24847344 is G / A. As an optional embodiment of the present application, when the sequence of the SNP molecular marker is CCA, the abundance of Pseudomonas in the xylem of cucumber is increased; when the sequence of the SNP molecular marker is TTG, the abundance of Pseudomonas in the xylem of cucumber is decreased. As an optional embodiment of the present application, the Pseudomonas comprises Pseudomonas cinnabarinus ivf-220.

[0019] The application provides application of the SNP molecular marker in the above technical solution in cucumber genetic diversity analysis and / or assisted selection breeding. The SNP molecular marker provided by the application can identify enrichment of pseudomonas in the xylem of cucumber. When the SNP molecular marker of the cucumber germplasm is CCA, the cucumber germplasm can better enrich pseudomonas, and the abundance of pseudomonas in the xylem of the cucumber germplasm is higher. The use of Pseudomonas cinnabaris ivf-220 on the cucumber germplasm with the SNP molecular marker of CCA can significantly promote the growth of the cucumber germplasm and increase the content of 4-methylene glutamine in the cucumber germplasm. When the SNP molecular marker of the cucumber germplasm is TTG, the cucumber germplasm has a lower ability to enrich pseudomonas, and the abundance of pseudomonas in the xylem of the cucumber seed is lower. The use of Pseudomonas cinnabaris ivf-220 on the cucumber germplasm with the SNP molecular marker of TTG cannot significantly promote the growth of the cucumber germplasm and cannot significantly increase the content of 4-methylene glutamine in the cucumber germplasm. The SNP molecular marker provided by the application can be used to screen and / or cultivate cucumber germplasm with the SNP molecular marker of CCA, and then Pseudomonas cinnabaris ivf-220 is used to make it better act on the corresponding cucumber.

[0020] The application provides a Pseudomonas agent interacting with the SNP molecular marker in the above technical solution, and the Pseudomonas agent comprises Pseudomonas cinnabaris (P. Pseudomonas fulva ) ivf-220, and the Pseudomonas cinnabaris ivf-220 has a preservation number of CGMCC No. 36162.

[0021] The Pseudomonas cinnabaris ivf-220 provided by the application is isolated from xylem juice of cucumber; the nucleotide sequence of 16S rDNA of the Pseudomonas cinnabaris ivf-220 is shown in SEQ ID NO. 2; the genome size of the Pseudomonas cinnabaris ivf-220 is 5,126,730 bp, the GC content is 61.42%, and 4,807 predicted genes are encoded. The functional annotation analysis of the genes of the Pseudomonas cinnabaris ivf-220 shows that the genome of the Pseudomonas cinnabaris ivf-220 contains genes related to indole-3-acetic acid (IAA) biosynthesis, protease, cellulase, beta-galactosidase and amylase, and gene clusters involved in phosphorus and nitrogen metabolism. The test detection of the application shows that the Pseudomonas cinnabaris ivf-220 has the abilities of dissolving organic and inorganic phosphorus, producing iron carrier and ammonium, secreting IAA and inhibiting the growth of Ralstonia solanacearum.

[0022] The Pseudomonas fluorescens ivf-220 provided by the present application can colonize and act on the xylem of cucumber, and the content of 4-methylene glutamine in the xylem fluid of the cucumber of the haplotype of the SNP molecular marker CCA is promoted, thereby further promoting the growth of the cucumber, and the growth-promoting effect of the strain ivf-220 on the cucumber variety has genotype dependence. The results of the examples show that the Pseudomonas fluorescens ivf-220 promotes the growth of the cucumber variety of the Hap2 haplotype by acting on the SNP molecular marker CCA, significantly improves the plant height, stem diameter, leaf area, fresh weight, dry weight and content of 4-methylene glutamine of the cucumber variety of the Hap2 haplotype. However, the Pseudomonas fluorescens ivf-220 has no significant effect on the growth of the cucumber variety of the Hap1 haplotype of the SNP molecular marker TTG, and cannot significantly improve the content of 4-methylene glutamine in the cucumber.

[0023] The present application provides a microbial preparation, which comprises the Pseudomonas fluorescens ivf-220 described in the above technical solution. As an optional embodiment of the present application, the viable bacterial count of the Pseudomonas fluorescens ivf-220 in the microbial preparation is greater than or equal to 1×10 8 CFU / mL.

[0024] The present application provides a preparation method of the microbial preparation described in the above technical solution, which comprises: culturing the Pseudomonas fluorescens ivf-220 in a culture medium to obtain a microbial preparation. As an optional embodiment of the present application, the culture medium comprises an LB culture medium; the culture temperature can be 28-30℃, or 28℃, 29℃ or 30℃. As an optional embodiment of the present application, the culture can be accompanied by oscillation, and the rotation speed of the oscillation can be 220 rpm. As an optional embodiment of the present application, the culture can be an overnight culture; the time of the overnight culture can be 12-18h, or 12h, 13h, 14h, 15h, 16h, 17h or 18h. After the culture is completed, a culture solution is obtained. As an optional embodiment of the present application, the culture solution can be directly used as a microbial preparation. As another optional embodiment of the present application, the bacterial cells in the culture solution can be separated, resuspended and then a bacterial suspension of the Pseudomonas fluorescens ivf-220 is obtained. After the bacterial suspension of the Pseudomonas fluorescens ivf-220 is obtained, the bacterial suspension of the Pseudomonas fluorescens ivf-220 can be directly used as a microbial preparation.

[0025] The application provides application of the Pseudomonas agent, the microbial preparation or the microbial preparation prepared by the preparation method in preparation of a plant pathogenic bacteria inhibiting preparation.

[0026] The application provides application of the Pseudomonas agent, the microbial preparation or the microbial preparation prepared by the preparation method in promoting growth of cucumbers.

[0027] The application provides application of the Pseudomonas agent, the microbial preparation or the microbial preparation prepared by the preparation method in preventing and treating cucumber bacterial wilt.

[0028] The application provides application of the Pseudomonas agent, the microbial preparation or the microbial preparation prepared by the preparation method in increasing 4-methylene glutamine content in cucumbers.

[0029] The application provides a method for promoting growth of cucumbers, which comprises: applying a microbial preparation containing Pseudomonas flavedoncida ivf-220 in the growth process of a cucumber variety with an SNP molecular marker of CCA.

[0030] In order to further illustrate the application, the technical solutions provided by the application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the protection scope of the application.

[0031] In the following description and the accompanying drawings, the strain ivf-220 can also be referred to as strain 220 or simply 220.

[0032] Example 1 After planting different cucumber varieties (see Table 1 for specific variety information), during the vigorous growth period of cucumber, stem tissues of different cucumber varieties were taken, and xylem fluid was taken. Total DNA was extracted from cucumber xylem fluid, genotype data was obtained by amplicon sequencing, and whole genome association analysis (GWAS) was performed.

[0033] Table 1 Information of 109 different cucumber germplasms

[0034] Note: For specific information of the germplasm in Table 1, please refer to the reference Qi J, Liu X, Shen D, Miao H, Xie B, Li X, et al. A genomic variation map provides insights into the genetic basis of cucumber domestication and diversity. Nature genetics. 2013; 45(12): 1510-5. The GWAS results showed that only one genetic signal significantly associated with the core Pseudomonas_ASV4 (16S rDNA V4 region) was detected on chromosome 3. The relative abundance of Pseudomonas_ASV4 in the xylem of various germplasms showed certain differences, indicating that its accumulation may be regulated by genetic factors.

[0035] To further analyze the genetic loci related to the target traits, this study used linkage disequilibrium (Linkage Disequilibrium, LD) analysis method to conduct detailed LD block analysis on the genomic region where the significantly associated loci were located. By calculating the LD value (R 2 ) between SNPs, three consecutive SNP loci (R 2= 0.99), these sites showed high linkage disequilibrium, and three consecutive SNP sites were Chr3_24847315, Chr3_24847328, and Chr3_24847344. Among them, Chr3_24847315 was located at 51 bp of SEQ ID NO. 1; Chr3_24847328 was located at 64 bp of SEQ ID NO. 1; and Chr3_24847344 was located at 80 bp of SEQ ID NO. 1. SEQ ID NO. 1 was the sequence of 24847265-24847394 bp on chromosome 3 (i.e., the sequence of 24847265-24847394 bp of Cucumber (Chinese Long) v3 Genome chr3, see: http: / / www.cucurbitgenomics.org / blast / report / 606432).

[0036] SEQ ID NO. 1: CATCAAATTTAATACATTTTACTAACGTCATATATTACATATACTTATCATAAATCTTTGGTTTTAAAATACACACCATGACTGAAACTTATACTCATGAAACACAGCATTATTGATCTTAAATATTTAT.

[0037] The SNP molecular marker is specifically shown in the bold part in SEQ ID NO. 1.

[0038] Based on the results of LD block analysis, haplotype analysis was further performed on the three SNPs. The results showed that these germplasms were divided into three main haplotypes (as shown in Figure 1 ). TTG (Hap1, n = 64) and CCA (Hap2, n = 11), and YYR (Hap3, n = 6) were hybrid types of Hap1 and Hap2. Analysis found that Hap1 existed in four cucumber subgroups, while Hap2 only existed in cultivated cucumbers (East Asian type and Eurasian type). This distribution pattern indicated that Hap2 might be formed during the cultivation process, while Hap1 was preserved in a wider genetic background. Statistically, the relative abundance of Pseudomonas_ASV4 showed significant correlation with different haplotype types. The germplasms in Hap1 showed significantly lower Pseudomonas_ASV4 abundance compared with Hap2 (East Asian type: p = 0.012, Eurasian type: p = 0.026). This result indicated that Hap2 germplasms could more significantly enrich Pseudomonas_ASV4.

[0039] To further explore the candidate genes regulating the accumulation of Pseudomonas_ASV4 in the xylem, according to the linkage disequilibrium (LD) decay of the genomic region containing the most significant signal, the genes within the range of 15 kb upstream and downstream of the most significant SNP (Chr3_24 847 328) were searched in detail, and combined with their functional annotations, the candidate genes that may be involved in regulating the accumulation of the ASV were screened out.

[0040] The results show that there are 3 genes within the range of 15 kb upstream and downstream of the significant SNP (Chr3_24 847 328) (i.e. the sequence of 24832328-24862328 bp of Cucumber (Chinese Long) v3 Genome chr3, see http: / / www.cucurbitgenomics.org / blast / report / 606429). Figure 2 The nucleotide sequence of CsaV3_3G028410 is as follows, which encodes a Subtilisin-like serine protease. This kind of protease belongs to the serine hydrolase family and can hydrolyze proteins into small peptides, which can act as signal molecules or ligands to bind to receptors and participate in cell signal transduction. In plants, the Subtilisin family (SBT) is widely involved in the development regulation and environmental stress response of plants. The nucleotide sequence of CsaV3_3G028420 is as follows, which encodes a Tetratricopeptide repeat (TPR) superfamily protein. TPR is a conserved protein domain, usually containing about 34 amino acids, forming a right-handed helical structure with an amphiphilic channel. The main function of the TPR domain is as a protein-protein interaction module, which is involved in various biological processes such as cell cycle regulation, gene expression, and protein degradation. In plants, TPR proteins usually act as assembly scaffolds of multi-protein complexes, participating in intracellular signal transduction and metabolic regulation. The nucleotide sequence of CsaV3_3G028430 is as follows, which encodes a xyloglucan galactosyltransferase belonging to the KATAMARI1 protein family. This protein plays a role in the endoplasmic reticulum and Golgi apparatus of plant cells, mainly participating in cell wall synthesis, regulation of cytoskeleton organization, and normal cell elongation and development.

[0041] CsaV3_3G028410 (i.e. the sequence of 24844997-24842049 bp of Cucumber (Chinese Long) v3 Genome chr3, see http: / / www.cucurbitgenomics.org / blast / report / 607033).

[0042] CsaV3_3G028420 (i.e. the sequence of 24852569~24854245 bp of Cucumber (Chinese Long) v3 Genome chr3, see http: / / www.cucurbitgenomics.org / blast / report / 607032).

[0043] CsaV3_3G028430 (i.e. the sequence of 24857735~24854365 bp of Cucumber (Chinese Long) v3 Genome chr3, see http: / / www.cucurbitgenomics.org / blast / report / 607029).

[0044] To further explore the effects of Hap1 and Hap2 on the expression levels of genes, the expression levels of three genes near the SNP (Chr3_24 847 328) were quantitatively analyzed using the stem transcriptome data. The results are shown in Table 2. Figure 3 It was found that only CsaV3_3G028420 showed significant expression difference between Hap1 and Hap2. CsaV3_3G028420 gene was annotated as Tetratricopeptide Repeat (TPR)-like superfamily protein. This protein has been shown to be involved in abiotic stress response and hormone signaling. Considering that xylem is the main pathway for water transport in plants and is essential for photosynthesis, it can be inferred that microorganisms in xylem may interact with this gene.

[0045] The above research results show that Hap1 shows lower expression level of CsaV3_3G028420 gene and abundance of Pseudomonas_ASV4, while Hap2 shows higher expression level of CsaV3_3G028420 gene and abundance of Pseudomonas_ASV. Combined with the frequencies of these two alleles in India, Xishuangbanna, East Asia and Eurasian Asia, it is speculated that during the domestication of cultivated cucumber, the Hap2 haplotype was differentiated and formed, up-regulated the expression of CsaV3_3G028420 gene, so that the cucumber obtained stronger ability to recruit Pseudomonas_ASV4.

[0046] Example 2 Isolation and identification of strains Xylem sap sampling: Xylem sap was collected from the stems of healthy cucumber plants.

[0047] Bacterial isolation: The xylem sap samples were gradient diluted and spread on R2A, NA and TSA media plates, respectively, with three replicates for each dilution. The plates were incubated at 30°C for 5 days.

[0048] Purification and preservation: Single colonies were picked according to the colony morphological characteristics and purified by three streaking methods. The purified strain was stored in a medium containing 50% (v / v) glycerol at -80°C to obtain strain ivf-220.

[0049] 16S rDNA gene identification: The 16S rDNA gene fragment of isolated strain ivf-220 was amplified by PCR using universal primers 27F and 1492R. The PCR system used Phanta Max Master Mix kit P515, containing 1.25 μL of primer pair (10 μM) and 1.25 μL of genomic DNA. The PCR program was 95°C for 3 minutes; 95°C for 15 seconds, 56°C for 30 seconds, 72°C for 90 seconds, 30 cycles; 72°C for 5 minutes. After sequencing, sequence alignment identification was performed using the BLAST algorithm.

[0050] The nucleotide sequence of the 16S rDNA of strain ivf-220 is shown as SEQ ID NO. 2, specifically:

[0051] Core strain screening: The 16S rDNA gene V4 region of the isolated strains was aligned with pre-defined core ASVs (operational taxonomic units) (using SnapGene software), and strains with sequence similarity ≥ 97% were identified as core strains and subjected to subsequent studies. Finally, strain ivf-220 was obtained, and strain ivf-220 was identified as Pseudomonas fulva Pseudomonas fulva ).

[0052] Example 3 Whole genome sequencing and analysis of strain ivf-220 DNA extraction: Genomic DNA of the core strains was extracted using TIANamp Bacteria DNA Kit.

[0053] Library construction and sequencing: Sequencing libraries were constructed using Watchmaker DNA Library Prep Kit (PCR-free) and subjected to PE150 sequencing on the Illumina NovaSeq X plus platform.

[0054] Genome assembly and annotation: After quality control of raw data, genome de novo assembly was performed using SPAdes (v3.15.4) (contigs with length < 300 bp were removed). Gene prediction was performed using Prokka (v1.14.6), and functional annotation (GO, COG, KEGG) was performed by eggNOG v5.0 database.

[0055] Phylogenetic and ANI analysis: Maximum likelihood phylogenetic tree was constructed based on 92 core gene sets using UBCG (v3.0). Average nucleotide identity (ANI) between strains and type strains was calculated using FastANI (v1.32).

[0056] The whole genome maximum likelihood phylogenetic tree based on 92 core genes is shown in Figure 4 ; the average nucleotide identity (ANI) value of strain ivf-220 and the closest type strain is shown in Figure 5 ; and the genome circle diagram of strain ivf-220 is shown in Figure 6 . The whole genome sequence of strain ivf-220 has been submitted to the National Center for Genome Science Data, and the accession number is: CRA02506.

[0057] The present application identifies the core strain ivf-220 isolated from the xylem juice of cucumber as Pseudomonas fulva Pseudomonas fulva). The genome size of this strain is 5,126,730 bp with a GC content of 61.42%, encoding 4,807 predicted genes.

[0058] Functional annotation analysis showed that the genome of strain ivf-220 contains genes related to indole-3-acetic acid (IAA) biosynthesis, proteases, cellulases, beta-galactosidases and amylases, as well as gene clusters involved in phosphate solubilization and nitrogen metabolism Figure 6 ).

[0059] Example 4 In vitro plant growth promoting and antagonistic properties determination of strain ivf-220 1. Ammonia production determination: strain ivf-220 was inoculated in LB medium and incubated at 28°C, 200 rpm for 2 days. 200 μΐ of the culture supernatant was added with 3 drops of Nessler's reagent in a white porcelain plate. The presence of yellow or reddish-brown precipitate indicated positive ammonia production.

[0060] 2. Phosphate solubilization determination: NBRIP medium was used to determine the phosphate solubilization ability of strain ivf-220 according to Nautiyal's method. The transparent halo around the colonies was observed. The specific steps were as follows: strain ivf-220 was inoculated in LB liquid medium and incubated at 28°C, 200 rpm for 2 days. The bacterial cells were collected to prepare a bacterial suspension, and the bacterial concentration was adjusted to an OD600 value of 0.1. 10 μΐ of the adjusted bacterial suspension was added to the center of the NBRIP solid medium plate. The inoculated plate was inverted and placed in a constant temperature incubator for static culture at 28°C for 3-4 days. The transparent halo around the colonies was observed to determine the phosphate solubilization ability of strain ivf-220 to inorganic phosphorus.

[0061] Strain ivf-220 was inoculated in LB liquid medium and incubated at 28°C, 200 rpm for 2 days. The bacterial cells were collected to prepare a bacterial suspension, and the bacterial concentration was adjusted to an OD600 value of 0.1. 10 μΐ of the adjusted bacterial suspension was added to the center of the NBRIP solid medium plate. The inoculated plate was inverted and placed in a constant temperature incubator for static culture at 28°C for 3-4 days. The transparent halo around the colonies was observed to determine the phosphate solubilization ability of strain ivf-220 to inorganic phosphorus.

[0062] 3. Siderophore production capacity determination: The determination was performed using Chromium Azure S (CAS) blue agar plates according to the method of Schwyn and Neilands, observing the orange halo around the colonies. The specific steps are as follows: Inoculate strain ivf-220 into LB liquid medium and incubate at 28℃ and 200 rpm for 2 days with shaking. Collect the bacterial cells to prepare a bacterial suspension, adjusting the bacterial concentration to an OD600 value of 0.1. Use an inoculation loop to pick up a small amount of the bacterial suspension and spot it onto the surface of a CAS blue agar plate. After incubation for 3-4 days, observe the color change of the medium around the colonies.

[0063] 4. Antagonism experiment: 5 mL of Ralstonia solanacearum grown to the stationary phase was tested. Ralstonia solanacearum Mix the bacterial suspension with 45 mL of pre-melted and cooled NA medium to 50°C, then pour the mixture onto a plate. Add 5 mL of the culture of the test strain ivf-220, grown to the stationary phase, to the center of the plate. Incubate at 28°C for 3 days, then measure the diameter of the inhibition zone.

[0064] All of the above experiments were repeated three times.

[0065] 5. Results The results of the phosphorus-solubilizing ability of strain ivf-220 for inorganic phosphorus are as follows: Figure 7 As shown; the results of the phosphorus-solubilizing ability test of strain ivf-220 for organophosphates are as follows. Figure 8 As shown; the results of the siderophore production capacity assay for strain ivf-220 are as follows. Figure 9 As shown; the results of the ammonium production capacity test of strain ivf-220 are as follows. Figure 10 As shown; the antagonistic effect of strain ivf-220 against Ralstonia solanacearum is as follows: Figure 11 As shown.

[0066] Strain ivf-220 showed positive results in all the above tests, indicating that it possesses the ability to solubilize both organic and inorganic phosphorus, produces siderophores, exhibits ammonium production capabilities, and effectively inhibits Ralstonia solanacearum, with an inhibition zone diameter of 2.07 ± 0.12 cm. These results suggest that this strain, as a core member of the xylem flora, has potential plant growth-promoting properties.

[0067] Example 5 Cucumber seedling inoculation growth promotion experiment Cucumber growth promotion experiments were conducted using cucumber varieties NK1 (germplasm number CG5539) with Hap1 (TTG) genotype and NK60 (germplasm number CG1083) with Hap2 (CCA) genotype.

[0068] Preparation of bacterial suspension: Incubate strain ivf-220 overnight in LB broth at 30°C and 220 rpm with shaking. Collect bacterial cells by centrifugation, resuspend in sterile deionized water, and adjust OD. 600to 0.2 (about 2 x 10 8 Strain ivf-220 bacterial suspension was prepared at OD600=0.2 (about 2 x 10

[0069] Seed treatment: After the husk of cucumber seeds was removed, the seeds were soaked in 75% ethanol for 15 seconds, and then washed with sterile water for 3 times. Then the seeds were sterilized with sodium hypochlorite solution (about 1.6% available chlorine) for 15 minutes, and then washed with sterile water for 5 times, 5 minutes each time. The final washing water was plated to confirm that the surface was sterile.

[0070] Seeding and inoculation: After the sterilized seeds were germinated on MS medium, they were transplanted into plastic pots containing sterilized nutrient soil and vermiculite mixture. Non-inoculated control and inoculated strain ivf-220 treatment were set. The inoculation method was as follows: root irrigation inoculation: 200 mL of bacterial suspension (OD600=0.2) was irrigated for each seedling.

[0071] Culture and measurement: The seedlings were cultured under controlled conditions in a greenhouse (30°C day / 25°C night; 16 hours light / 8 hours dark). After 2 weeks of inoculation, the plant height, stem diameter, leaf area, fresh weight, and dry weight were measured. The content of 4-methylene glutamine in the xylem sap of cucumber was detected by mass spectrometry.

[0072] The results are shown in Figure 12~25 The results are shown in Figure 12 The results are shown in Figure 13 The results are shown in Figure 14 The results are shown in Figure 15 The results are shown in Figure 16 The results are shown in Figure 17 The results are shown in Figure 18 The results are shown in Figure 19 The results are shown in Figure 20 The results are shown in Figure 21 The results are shown in Figure 22Figure of the effect of strain ivf-220 on the leaf area of Hap2 (CCA) genotype cucumber varieties; Figure 23 Figure of the effect of strain ivf-220 on the fresh weight of Hap2 (CCA) genotype cucumber varieties; Figure 24 Figure of the effect of strain ivf-220 on the dry weight of Hap2 (CCA) genotype cucumber varieties; Figure 25 Figure of the effect of strain ivf-220 on the relative content of 4-methylene glutamine in Hap2 (CCA) genotype cucumber varieties.

[0073] By Figure 12~25 The results show that strain ivf-220 can significantly promote the growth of Hap2 (CCA) genotype cucumber varieties, increase the plant height, stem diameter, leaf area, fresh weight and dry weight of cucumber. Meanwhile, it can also significantly increase the content of 4-methylene glutamine in cucumber. Strain ivf-220 has no significant effect on the growth of Hap1 (TTG) genotype cucumber varieties, nor can it significantly increase the content of 4-methylene glutamine in cucumber. This shows that strain ivf-220 only has obvious growth-promoting effect on Hap2 (CCA) genotype cucumber varieties, and that strain ivf-220 promotes the growth of cucumber by specifically promoting the content of 4-methylene glutamine in the xylem sap of a single haplotype cucumber germplasm (NK60), which further promotes the growth of cucumber. The growth-promoting effect of strain ivf-220 on cucumber varieties has genotype dependence.

[0074] Example 6 Verification of xylem colonization of GFP-labeled strains GFP labeling: Through triparental mating, the donor plasmid pBBRMCS2-GFP-Km was introduced into strain ivf-220 using the helper plasmid pRK600 to obtain GFP-labeled strains.

[0075] The information of pBBRMCS2-GFP-Km can be found in “A genetic tool for production of GFP-expressing Rhodopseudomonas palustris for visualization of bacterial colonization”.

[0076] Inoculation and sampling: Hap2 (CCA) genotype cucumber variety NK60 (germplasm number CG1083) seedlings were soaked in GFP-labeled strain ivf-220 bacterial suspension (the preparation method of strain ivf-220 bacterial suspension is the same as that in Example 5, and the viable bacterial count of strain ivf-220 bacterial suspension was 10 7 CFU / mL) for 20 minutes. After transplanting, 50 mL of 107 CFU / mL strain ivf-220 bacterial suspension. Three weeks after inoculation, xylem sap was collected from surface-sterilized plants.

[0077] Microscopy observation: GFP fluorescence signal in xylem sap samples was observed using a Leica TCS SP8 confocal laser scanning microscope.

[0078] The results are shown in Figure 26 The results show that confocal microscopy observation of GFP-labeled strain ivf-220 colonization in cucumber xylem sap (green fluorescence). Strong GFP fluorescence was observed in the xylem sap of the inoculated group, confirming that strain ivf-220 can endophytically colonize cucumber xylem.

[0079] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

1. A cucumber SNP molecular marker associated with Pseudomonas recruitment, characterized in that, The SNP molecular marker includes Chr3_24847315, Chr3_24847328 and Chr3_24847344 on chromosome 3 of cucumber; Chr3_24847315 is located at 51bp of SEQ ID NO.1; Chr3_24847328 is located at 64bp of SEQ ID NO.1; Chr3_24847344 is located at 80bp of SEQ ID NO.1; the polymorphism of Chr3_24847315 is T / C; the polymorphism of Chr3_24847328 is T / C; the polymorphism of Chr3_24847344 is G / A.

2. The SNP molecular marker of claim 1, wherein, The sequence of the SNP molecular marker is CCA to improve the abundance of Pseudomonas in the xylem of cucumber; the sequence of the SNP molecular marker is TTG to reduce the abundance of Pseudomonas in the xylem of cucumber.

3. The SNP molecular marker of claim 2, wherein, The Pseudomonas includes Pseudomonas fulva ivf-220.

4. The SNP molecular marker of any one of claims 1-3 is applied to genetic diversity analysis and / or assisted selection breeding of cucumber.

5. A Pseudomonas agent that interacts with the SNP molecular marker of any one of claims 1 to 3. The Pseudomonas agent includes Pseudomonas fulva (Pseudomonas fulva) Pseudomonas fulva ) ivf-220, the Pseudomonas fulva ivf-220 has a preservation number of CGMCC No. 36162.

6. A microbial preparation, characterized in that, The Pseudomonas agent of claim 5 is included.

7. A method for the preparation of the microbial preparation according to claim 6, characterized in that, The Pseudomonas agent is included. The Pseudomonas agent is cultured in a culture medium to obtain a microbial preparation.

8. The microbial preparation prepared by the Pseudomonas agent of claim 5, the microbial preparation of claim 6 or the preparation method of claim 7 is applied to preparation of a plant pathogenic bacteria inhibiting agent; the plant pathogenic bacteria includes Ralstonia solanacearum.

9. The microbial preparation prepared by the Pseudomonas agent of claim 5, the microbial preparation of claim 6 or the preparation method of claim 7 is applied to promoting the growth of cucumber; the cucumber includes the cucumber with the SNP molecular marker of any one of claims 1-3 being CCA.

10. The microbial preparation prepared by the Pseudomonas agent of claim 5, the microbial preparation of claim 6 or the preparation method of claim 7 is applied to improving the content of 4-methylene glutamine in cucumber; the cucumber includes the cucumber with the SNP molecular marker of any one of claims 1-3 being CCA.

Images