Amplification primers of kasp markers on d03 chromosome for high lint content variety selection of cotton
By developing amplification primers for the KASP marker on chromosome D03, the problem of distinguishing the genotypes of high lint percentage varieties in cotton breeding was solved, achieving efficient molecular marker-assisted selection and improving the accuracy of cotton breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-22
- Publication Date
- 2026-03-31
AI Technical Summary
Existing technologies are insufficient to efficiently distinguish the genotypes of cotton varieties with high lint percentages, resulting in a lack of tools for molecular marker-assisted selection in cotton breeding.
Amplification primers for the KASP marker on chromosome D03 were developed for the breeding of high lint percentage cotton varieties. These primers include forward and reverse primers with FAM and HEX fluorescent markers, which are used for the KASP reaction to distinguish between high and low lint percentage genotypes.
Effectively distinguishing the genotypes of cotton varieties with high lint percentage provides a useful tool for molecular marker-assisted selection in cotton breeding, improving the accuracy and efficiency of breeding.
Smart Images

Figure CN121380432B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular-assisted breeding technology, and in particular to an amplification primer for the KASP marker on chromosome D03 used in the breeding of high-yield cotton varieties. Background Technology
[0002] Cotton is one of the world's most important economic crops, with upland cotton (Gossypium hirsutum L.) being the main cultivated variety, accounting for over 90% of the natural raw materials (fibers) used in the global textile industry. Increasing cotton fiber yield has always been a crucial issue for cotton breeders. Among the components of cotton yield, lint percentage (LP) reflects the proportion of lint in seed cotton and is a key indicator determining fiber yield. Therefore, increasing lint percentage is an effective strategy to increase cotton yield without expanding the planting area.
[0003] Cotton fibers originate from highly elongated single-celled epidermal hairs on the surface of the ovule. Fiber development involves four distinct but continuous stages: initiation, elongation, secondary cell wall thickening, and maturity. Fiber initiation occurs two days before and after flowering (DPA), during which specific epidermal cells begin to differentiate and protrude outwards. The timing of fiber protrusion determines cell fate: protrusions formed early develop into long fibers (lint), while those formed later develop into short fibers (velvet). Notably, fiber density on the day of flowering (0 DPA) is positively correlated with lint percentage, and auxin accumulation in fiber cells also begins at this stage. Therefore, 0 DPA is a critical developmental period affecting fiber initiation efficiency and ultimately determining lint percentage.
[0004] As a complex quantitative trait, lint percentage is influenced by multiple genetic factors and environmental regulation, with major loci explaining approximately 60%-70% of phenotypic variation. Over the past few decades, genetic mapping studies of parental offspring and natural populations have identified more than 1400 QTLs associated with lint percentage on all 26 cotton chromosomes, of which more than 60 are considered stable major QTLs. For example, Liu et al. (2023) used recombinant inbred lines constructed from two short-season cotton varieties, 'Dong 3' and 'Dong 4', to identify three stable QTLs and 28 candidate genes associated with lint percentage; although they confirmed the differential expression of these candidate genes, they did not conduct further functional validation through additional biological experiments. Similarly, Chen et al. (2022) constructed a genome-wide association analysis (GWAS) using 254 upland cotton materials and 41,413 high-quality single nucleotide polymorphisms (SNPs), identifying 22 stable QTLs that were significantly associated with lint percentage under various environments. In addition, weighted gene co-expression network analysis (WGCNA) found a significant correlation between the expression of Gh_D07G0463 and Gh_D01G0162, but this study did not develop molecular markers that can be directly used for breeding.
[0005] These studies have greatly expanded the scope of research on pelvic segment-related loci, but most QTLs are identified using low-density molecular markers such as SSRs (simple sequence repeats), resulting in wide confidence intervals and difficulty in accurately locating candidate genes. Therefore, high-resolution mapping and integrative omics methods have become necessary means to elucidate the genetic structure of pelvic segments and achieve gene-level mapping.
[0006] Building upon these QTL studies, several functional genes associated with lint percentage and fiber initiation have been identified in recent years, revealing the complex molecular mechanisms behind this trait. For example, the UGT71C4 gene, encoding UDP-glucosyltransferase, regulates seed size by influencing lignin and flavonoid metabolic pathways, thereby modulating lint percentage; the transcription factor GaHD1 mediates the interaction of H2O2 and Ca during fiber initiation. 2 The early signaling cascade of ⁺ is an upstream regulator of epidermal hair differentiation. In addition, transcriptional regulators homologous to the Arabidopsis MYB-bHLH-WD40 complex (such as GhMYB25, GhMYB109 and GhHD-1) have also been shown to be involved in cotton fiber initiation and elongation.
[0007] However, despite these advances, no well-defined and conserved regulatory complex similar to the Arabidopsis epidermal trichotomy system has been found in cotton, suggesting that fiber initiation and lint formation may involve unique and complex transcriptional networks. Integrated analysis of transcriptome and QTL data has identified more than 90 candidate lint genes preferentially expressed during fiber initiation and elongation, but key regulatory elements and their genetic hierarchy remain unclear. Summary of the Invention
[0008] The purpose of this invention is to provide an amplification primer for the KASP marker on chromosome D03 for the breeding of cotton varieties with high lint percentage. This primer can effectively distinguish genotypes with significant differences in lint percentage, providing a useful tool for molecular marker-assisted selection in cotton breeding.
[0009] The technical solution adopted by this invention to solve its technical problem is:
[0010] A primer for amplifying the KASP marker on chromosome D03 for breeding high-skin-weight cotton varieties includes:
[0011] Forward primer F1 with FAM fluorescent label:
[0012] GAAGGTGACCAAGTTCATGCTCTCGGTGTTTTGAAAGTTAAACTAC;
[0013] Forward primer F2 with HEX fluorescent label:
[0014] GAAGGTCGGAGTCAACGGATTCTCGGTGTTTTGAAAGTTAAACTAG;
[0015] Reverse primer: AAATTTTACTCCTTTGCCCGAGG.
[0016] The cotton variety in question is upland cotton.
[0017] A kit for detecting KASP markers on chromosome D03 used in the breeding of high-yield cotton varieties, the kit comprising the aforementioned amplification primers.
[0018] A PCR reagent for detecting KASP markers on chromosome D03 used in the breeding of high-yield cotton varieties, the PCR reagent comprising the aforementioned amplification primers.
[0019] Application of the aforementioned amplification primer in the breeding of high-saturation cotton varieties.
[0020] A molecular marker-assisted breeding method for high-lint-ratio upland cotton varieties is disclosed. The method utilizes amplification primers for the KASP marker on chromosome D03, as described above for breeding high-lint-ratio cotton varieties. The cotton sample is subjected to a KASP reaction, and the reaction products are detected. If only FAM fluorescent marker fluorescence is detected, the cotton sample is a high-lint-ratio genotype. If only HEX fluorescent marker fluorescence is detected, the cotton sample is a low-lint-ratio genotype.
[0021] The beneficial effects of this invention are: it can effectively distinguish genotypes with significant differences in lint percentage, providing a useful tool for molecular marker-assisted selection in cotton breeding. Attached Figure Description
[0022] Figure 1 This study presents phenotypic variation and correlation analysis of clothing percentage under four environmental conditions. AD: Frequency distribution of clothing percentage under the four environmental conditions, A: E1 (Sanya-2022-2023), B: E2 (Liaocheng-2023), C: E3 (Huanggang-2023), and D: E4 (Sanya-2023-2024); E: Distribution of BLUP values of clothing percentage under multiple environmental conditions; F: Correlation matrix of clothing percentage among the four environmental conditions.
[0023] Figure 2This is a scanning electron microscopy analysis of fiber initiation in 'TM-1' and 'CRI50' ovules. Ovule observation periods are -1, 0, and 1 DPA. A: Schematic diagram of cotton ovary (red arrows indicate ovules); B, C: Statistical count of epidermal protrusions at 0 DPA and 1 DPA (**P<0.01); DI: 'TM-1' ovules; D, F, H are overall views of the ovules, E, G, I are magnified views of fiber initiation cells in the central region of the ovule; JO: 'CRI50' ovules; J, L, N are overall views of the ovules, K, M, O are magnified views of fiber initiation cells in the central region of the ovule. Scale bars: 0.2 mm for overall views, 40 μm for magnified views; all scale bars are marked in the lower right corner of the image.
[0024] Figure 3 This is QTL mapping based on BSR-seq. A: Distribution of identified SNPs on chromosomes; B: Functional classification of detected SNPs; C: QTL mapping based on allele frequency differences (ΔSNP-index), with blue and red lines representing 95% and 99% confidence intervals, respectively; D: QTL mapping based on G' values, with the red line representing the significance threshold.
[0025] Figure 4 This is an analysis of differentially expressed genes within the qLP-D03-1 locus. A: Differentially expressed genes between two extreme pools within the qLP-D03-1 region; white numbers indicate FPKM values. BE: qPCR validation of differentially expressed genes in the parents ('TM-1' and 'CRI50') at -1, 0, and 1 DPA. B represents Ghicr24_D03G124100, C represents Ghicr24_D03G124300, D represents Ghicr24_D03G124400, and E represents Ghicr24_D03G135300. Data are expressed as mean ± standard deviation; asterisks indicate significant differences between parents (*P<0.05, **P<0.01).
[0026] Figure 5 This section presents the fine mapping of qLP-D03-1 and tissue-specific expression analysis of candidate genes. A: Manhattan plot of qLP-D03-1 region association analysis; B: Linkage disequilibrium (LD) pattern within candidate regions; C: Schematic diagram of overlap between candidate regions and reported garment-related QTLs, with gray vertical lines representing chromosome D03, red segments representing qLP-D03-1 regions, thick red horizontal lines highlighting key subregions (D03:42056420-42306503), colored horizontal lines representing reported QTLs (see Table S11), and red arrows marking the location of GhLPA1 in the genome; D: Tissue-specific expression profile of GhLPA1.
[0027] Figure 6Silencing GhLPA1 reduces cotton lint percentage. A: Phenotypic comparison between GhLPA1-silenced plants and control plants (pCLCrV:00); B: Relative expression levels of GhLPA1 in leaves of pCLCrV:00 and pCLCrV:GhLPA1 plants; C: Lint percentage comparison between GhLPA1-silenced plants and control plants; D, E: Representative images of bolls and seeds from GhLPA1-silenced plants and control plants, with blue boxes representing pCLCrV:GhLPA1 and red boxes representing pCLCrV:00; F: Boll weight (BW), G: Seed index (SI), both based on 3 technical replicates (20 bolls and 100 seeds per replicate, samples from different plants); H: Seed length, I: Seed width (50 seeds measured); J: Phenotypic comparison of pCLCrV:00 and pCLCrV:GhLPA1 plants at -1, 0, and 1 Expression levels of GhLPA1 in DPA ovules; expression levels of fiber development-related genes (GhPDF1, GhHOX3, GhEXPA1, GhEXPA2, GhHDA5) in KO:pCLCrV:00 and pCLCrV:GhLPA1 plants. Data are expressed as mean ± standard error of at least three independent biological replicates. Significance was determined by Student's t-test: *P<0.05, **P<0.01.
[0028] Figure 7 This study focuses on haplotype analysis of GhLPA1 and its application in cotton genetic improvement. A: Genomic structure and SNP distribution of the 2 kb upstream and downstream regions of GhLPA1. SNP nucleotide positions are: Pos.1 (rsD03_42213681), Pos.2 (rsD03_42214174), Pos.3 (rsD03_42214210), Pos.4 (rsD03_42214745), Pos.5 (rsD03_42215602), Pos.6 (rsD03_42215603), Pos.7 (rsD03_42215686); B: Haplotype classification of GhLPA1 in 355 cotton accessions; C: Haplotypes of Gaoyi cotton varieties bred in different breeding years. D: Frequency variation of haplotypes; E: Fst analysis of SNPs near GhLPA1; F: Nucleotide diversity (π) of SNPs around GhLPA1; F: Comparison of haplotype weight distribution, blue indicates 'CRI50' haplotype (Hap1), pink indicates 'TM-1' haplotype (Hap2); G: Comparison of haplotype weight distribution; H: Genotyping results of GhLPA1 haplotype in recombinant inbred line population based on developed KASP markers, blue indicates Hap1 ('CRI50' type), pink indicates Hap2 ('TM-1' type); I: Comparison of haplotype weight distribution phenotypes of the two haplotypes in recombinant inbred line population. Detailed Implementation
[0029] The technical solution of the present invention will be further described in detail below through specific embodiments.
[0030] In this invention, unless otherwise specified, all raw materials and equipment used are commercially available or commonly used in the field. Unless otherwise specified, the methods in the following embodiments are conventional methods in the field.
[0031] Example 1:
[0032] 1. Materials and Methods
[0033] 1.1 Experimental Materials and Construction of the Mapping Population
[0034] To elucidate the genetic basis of lint percentage in upland cotton, this study constructed a recombinant inbred line (RIL) population using two parents with significantly different lint percentages. The maternal parent, 'CRI50', is characterized by high lint percentage, early maturity, and stable yield. It is a conventional variety containing insect-resistant genes and exhibits strong stress resistance and agronomic adaptability. The paternal parent, 'TM-1', is a standard genetic line whose entire genome has been sequenced, revealing its clear genetic background. It is a widely used reference genome in cotton genome research.
[0035] A recombinant inbred line population of 300 lines was constructed through continuous self-pollination of the F2 generation. F1 hybrids were bred at the Pingshan Experimental Station of Zhejiang A&F University in 2019; the F2 population was planted in Sanya, Hainan in 2019-2020; and F2:3 and F2:4 populations were planted in Liaocheng, Shandong in 2021 and 2022, respectively. Seeds from F2:5 to F2:8 generations were used for multi-environment phenotypic identification and genetic analysis to ensure the stability and heritability of lint percentage measurements. Furthermore, a genome-wide association study (GWAS) was conducted using a natural population containing 355 upland cotton accessions (Li LB, Zhang C, Huang JQ, Liu QB, Wei HL, Wang HT, Liu G Y, Gu LJ, Yu SX. 2021. Genomic analyses reveal the genetic basis of early maturity and identification of loci and candidate genes in upland cotton (Gossypium hirsutum L.). Plant Biotechnology Journal, 19, 109–123.).
[0036] 1.2 Field identification and phenotypic data collection
[0037] During the growing seasons of 2022-2024, phenotypic identification was conducted on 300 recombinant inbred line families and their parents at four locations in my country. The experimental locations and years are as follows: Sanya, Hainan (2022-2023 and 2023-2024, designated as E1 and E4 respectively); Liaocheng, Shandong (2023, designated as E2); Huanggang, Hubei (2023, designated as E3); and Hangzhou, Zhejiang (2024, designated as E5).
[0038] All field trials employed a randomized complete block design with three replicates, and were managed uniformly according to local standard agronomic practices. During the boll opening period in September, 20 fully opened cotton bolls from each line were manually harvested. After ginning using a laboratory gin, the lint weight and seed cotton weight were measured separately and calculated using the formula LP (%) = (lint weight / seed cotton weight) × 100%.
[0039] The environmental correlation analysis and variance analysis (ANOVA) of cloning fraction were performed using R software; the generalized heritability (HbA1c) was estimated based on a linear mixed-effects model using the "lme4" package. 2) (Bates D, Maechler M, Bolker B, Walker S. 2014. Fitting linear mixed-effects models using lme4. Statistics & Computing, 1406, 133–199.). Phenotypic data on lint percentage and boll weight (BW) of natural populations were obtained from published literature (Su JJ, FanSL, LiLB, WeiHL, WangCX, WangHT, SongMZ, ZhangC, GuLJ, ZhaoSQ, MaoGZ, WangCS, PangCY, YuSX. 2016. Detection of favorable QTLalleles and candidate genes for lint percentage by GWAS in Chinese uplandcotton. Frontiers in Plant Science. 7, 1576.; FengZ, LiLB, TangMQ, LiuQB, JiZH, SunDL, LiuGD, ZhaoSQ, HuangCJ, ZhangYN, ZhangGZ, YuSX. 2022. Detection of Stable elite haplotypes and potential candidate genes of boll weight across multiple environments via GWAS in upland cotton. Frontiers in Plant Science. 13, 929168.).
[0040] 1.3 Comparative observation of parental ovule development using scanning electron microscopy
[0041] Ovules from both parents at different developmental stages were collected and immediately fixed in 0.2 mol / L phosphate-buffered saline (PBS, pH 7.2) containing 3% glutaraldehyde at 0–4 °C for 2 h. After washing three times with PBS, the samples were dehydrated using a gradient of ethanol (30%, 50%, 70%, 80%, 90%, 95%, 100%). The dehydrated samples were replaced with tert-butanol and then freeze-dried. After gold sputtering, the dried samples were observed using a Hitachi S-3000N scanning electron microscope (Hitachi High-Technologies, Japan). All experiments were performed in triplicate.
[0042] 1.4 BSR-seq Library Construction and Association Analysis
[0043] Based on the best linear unbiased prediction (BLUP) values of lint percentage in four environments (E1-E4), 20 high-lint percentage lines and 20 low-lint percentage lines were selected from the recombinant inbred line population to construct high-lint percentage pools (LP-high) and low-lint percentage pools (LP-low), respectively. Parental lines and materials from the two extreme pools were planted in the E5 environment, and ovules (42 genotypes in total) were collected on the day of flowering (0 DPA) and RNA sequencing was performed by Wuhan Bena Technology Co., Ltd.
[0044] After quality control of the sequencing data using Fastp (v0.12.4) software, high-quality reads were aligned to the 'ZM24' reference genome using HISAT2 (v2.2.1) software. Variant sites were detected and annotated according to the established variant detection protocol in the laboratory (Li LB, Chang H, Zhao SQ, Liu RJ, Yan MY, Li FF, El-Sheery NI, Feng Z, Yu SX. 2024. Combining high-throughput deep learning phenotyping and GWAS to reveal genetic variants of fruit branch angle in upland cotton. Industrial Crops and Products, 220, 119-180.).
[0045] The criteria for screening high-quality SNPs are: reference allele frequency of 0.3-0.7, total sequencing depth of 100-5000, and genotype quality (ΔSNP) score ≥99. High-quality SNPs are analyzed using the QTLseqr R package to identify genomic regions associated with garment segmentation. The G' statistic for each SNP is calculated, and sites with a q value ≤0.01 are considered to be significantly associated with garment segmentation. The critical value corresponding to the 99th percentile of the G' distribution is 45.
[0046] 1.5 Differentially expressed genes and functional enrichment analysis
[0047] We used R packages to analyze and visualize differentially expressed genes (DEGs): we used the ggplot2 package to create volcano plots, the pheatmap package (https: / / github.com / raivokolde / pheatmap) to create heatmaps, and the VennDiagram package to create Venn diagrams.
[0048] TBtools-II software was used to perform gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) functional enrichment analyses on the screened differentially expressed genes. GO enrichment and KEGG enrichment analysis modules were applied, and the KEGG results were visualized using the ggplot2 package.
[0049] 1.6 Gene Expression Analysis by Real-Time Quantitative PCR (qRT-PCR)
[0050] To analyze target gene expression, ovules from 'TM-1' and 'CRI50' plants at -1, 0, and 1 DPA, as well as ovules from plants silenced with GhLPA1 (i.e., the ZM24 reference genome number Ghicr24_D03G124100) under the 'CRI50' background, were collected, and total RNA was extracted. Total RNA extraction, cDNA synthesis, and real-time quantitative PCR (qRT-PCR) analysis were performed according to the method described by Chang et al. (Chang H, Ji HH, Liu RJ, Feng JL, Wang JY, Zhao SQ, Li W, Qiu ZH, Elsheery NI, Yu SX, Li LB, Feng Z. 2025. Genome-wide association study reveals significant loci and candidate genes for fruitbranch length in upland cotton. Plant Genome, 18, e70041.). Each reaction was performed in triplicate, and the results were visualized using GraphPad Prism (v8.0.2.263).
[0051] 1.7 Subcellular localization of GhLPA1
[0052] To determine the subcellular localization of GhLPA1, its coding sequence was fused into the green fluorescent protein (GFP) gene frame and inserted into the pCAMBIA1305 vector controlled by the dual 35S promoter (d35S), constructing the recombinant vector d35S::GhLPA1-GFP. The recombinant plasmid and the empty vector control (d35S::GFP) were transformed into Agrobacterium tumefaciens strain GV3101, respectively.
[0053] Nicotiana benthamiana plants were cultured in an artificial climate chamber (model LT-36VL; Percival Scientific, USA) under the following conditions: 25°C, 16 h light / 8 h dark, and a light intensity of 150 μmol m⁻. 2 s⁻ 1The relative humidity was 60%. Leaves from 4-week-old plants were selected and infiltrated with Agrobacterium suspension containing GhLPA1-GFP fusion vector or GFP control vector (for specific methods, refer to: Voinnet O, Rivas S, Mestre P, Baulcombe D. 2003. An enhanced transient expression system in plants based on suppression of genesilencing by the p19 protein of tomato bushy stunt virus. The Plant Journal, 33, 949–956.). After 36–48 hours of infiltration, fluorescence signals were observed using a Zeiss LSM 900 confocal laser scanning microscope (Carl Zeiss AG, Germany).
[0054] 1.8 Association analysis and population genetic analysis of the qLP-D03-1 region
[0055] Based on resequencing data from 355 upland cotton germplasm resources, 3,050 SNPs were identified in the qLP-D03-1 region. Genome-wide association analysis of lint was performed using the linear mixture model (LMM) in GEMMA (v0.98.3) software. Manhattan plots were generated using the ggplot2 package in R language to display the association analysis results. Nucleotide diversity (π) was estimated using VCFtools (v0.1.16) software. The fixation index (Fst) of 355 cultivated materials and 68 semi-wild materials within the candidate genome region was calculated to quantify the degree of population differentiation.
[0056] 1.9 Development and Genotyping of the KASP Marker for the Ghicr24_D03G124100 Gene
[0057] To verify the association between the Ghicr24_D03G124100 gene and pelvic floor cells, a KASP marker was developed targeting a homozygous SNP (rsD03_42213681) in the 3' untranslated region (UTR) of this gene. Allele-specific forward primers [KASP-F1 (GAAGGTGACCAAGTTCATGCTCTCGGTGTTTTGAAAGTTAAACTAC, SEQ ID No.1) / KASP-F2 (GAAGGTCGGAGTCAACGGATTCTCGGTGTTTTGAAAGTTAAACTAG, SEQ ID No.2)] and reverse primers (KASP-R: AAATTTTACTCCTTTGCCCGAGG, SEQ ID No.3) with FAM and HEX fluorescent markers were designed using Primer Premier 5 and Phytozome software. Genotyping was performed on the LGC high-throughput genotyping platform (Shanghai Likong Biotechnology Co., Ltd.).
[0058] 1.10 Functional Verification of GhLPA1 Based on VIGS
[0059] To verify the function of GhLPA1 via VIGS, a specific fragment of the gene was cloned into the pCLCrV vector to construct the pCLCrV:GhLPA1 recombinant vector, which was then introduced into Agrobacterium tumefaciens strain LBA4404. Agrobacterium bacterial suspensions containing pCLCrV:GhLPA1, pCLCrV:00 (negative control), and pCLCrV:GhCLH (positive control) were mixed with the helper vector (pCLCrVB) and used to soak the cotyledons of 12-day-old 'CRI50' seedlings (for specific methods, refer to: Ma L, Hu TL, Kang M, Fu XK, Chen PY, Wei F, Jian HL, Lü XY, Zhang M, Yang Y L. 2024. Identification of candidate genes for early-maturity traits by combining BSA-seq and QTL mapping in upland cotton (Gossypium hirsutum L.). Journal of Integrative Agriculture, 23, 3472–3486.; Yuan WM, Li Y, Zhang WJ, Ju JS, Guo XF, Yang J N, Lin H, Wang CX, Ma Q, Su J J. 2025. Pinpointing MQTLs and candidate genes related). to early maturity in upland cotton through the integration ofmetaanalysis, RNA-seq, and VIGS approaches. Industrial Crops&Products, 223,120195.).
[0060] After soaking, the plants were cultured in a greenhouse and observed regularly for the appearance of yellowing phenotype. The silencing efficiency was analyzed by qRT-PCR. When comparing the chromatin content with the control group, only plants that were confirmed to have been successfully silenced were included in the final analysis.
[0061] 2 Results
[0062] 2.1 Phenotypic variation and heritability analysis of peltate in recombinant inbred lines
[0063] Phenotypic analysis of the recombinant inbred line population revealed significant and stable differences in lint percentage between the parents: the lint percentage of the paternal parent 'TM-1' was significantly lower than that of the maternal parent 'CRI50' in all environments, with differences ranging from 16.42% to 20.13%. The lint percentage phenotypic values and their best linear unbiased prediction (BLUP) values exhibited a near-normal continuous distribution. Figure 1 The AE in the data shows a significant correlation between the different environments. Figure 1 (F in the middle).
[0064] In all environments, the pelt percentage of the recombinant inbred lines showed out-of-parent segregation, with a broad-sense heritability of 81.65%. Genetic analysis confirmed that pelt percentage is a quantitative trait dominated by genetic factors.
[0065] 2.2 QTL Localization Analysis Based on BSR-seq
[0066] Based on the pelargoniographic values and BLUP values of recombinant inbred lines in three environments, 20 high-pelargoniographic lines and 20 low-pelargoniographic lines were selected to construct a high-pelargoniographic pool (LP-high) and a low-pelargoniographic pool (LP-low), respectively. The pelargoniographic phenotypes of the two pools were significantly different.
[0067] To determine the optimal sampling time, the fiber development of the parental ovules was observed using an electron microscope at -1, 0, and 1 DPA. Figure 2 In the A, D, F, H, J, L, N range: -1 DPA, no protrusions were observed on the epidermis of either parent ovule ( Figure 2 (E, K in the text); protrusions begin to appear at 0 DPA, and the protrusions elongate significantly at 1 DPA; and at both 0 DPA and 1 DPA, the number of protrusions in 'CRI50' is greater than that in 'TM-1' ( Figure 2 (B, C, G, I, M, O in the text).
[0068] Based on the above observations, transcriptome sequencing was performed on mixed pool samples and parental 0 DPA ovules. The sequencing yield for each sample was approximately 10 Gb, with an average sequencing depth of 6×. 33,475,141 sequences were obtained from the high-leaf and low-leaf pools, and 44,585,495 sequences were obtained from the low-leaf pools. After quality control, the high-quality sequences were aligned to the upland cotton 'ZM24' genome.
[0069] A total of 95,230 high-quality SNPs were identified through variant site detection. These were relatively evenly distributed across the At subgenome (46,617) and Dt subgenome (48,613), with a higher SNP density on the Dt chromosome than on the At chromosome. Figure 3 Of the 95,205 annotable SNPs, approximately 29% are located in exon regions, of which 62% are non-synonymous SNPs. Figure 3 The B in the figure indicates that there are significant genetic differences between the parents.
[0070] BSR-seq analysis was performed on 95205 SNPs using the QTLseqr R package. The ΔSNP exponent and G' value after tricube smoothing were calculated using a 4Mb sliding window. A total of 8 QTLs with confidence intervals exceeding 95% and 99% were identified. Figure 3 In the C), 5 QTLs have G' values exceeding 45 ( Figure 3 (D in the text). On chromosomes A08 and D03, both methods detected three QTLs. Among them, the region with the highest G' value in the 39.34-44.79 Mb interval of chromosome D03 was identified as a candidate region and named qLP-D03-1. This region contains 226 annotated genes.
[0071] 2.3 Identification of differentially expressed genes in the qLP-D03-1 region
[0072] Transcriptomic analysis of 0 DPA ovules revealed two distinct expression clusters: the high-expression cluster clustered with 'CRI50' and the low-expression cluster clustered with 'TM-1', confirming the reliability of the transcriptomic data.
[0073] Differential expression analysis revealed 2,138 differentially expressed genes (DEGs) between the parents and 537 differentially expressed genes between the extreme pools; among them, 135 differentially expressed genes showed consistent expression patterns in both parents and extreme pools.
[0074] Gene Ontology (GO) enrichment analysis revealed that these genes are primarily involved in basal metabolic processes, including translation, ribosome activity, and membrane and cytoplasmic components, suggesting that differences in basal metabolism may be one of the reasons for differences in garment phenotype.
[0075] Within the qLP-D03-1 region, four differentially expressed genes (Ghicr24_D03G124100, Ghicr24_D03G124300, Ghicr24_D03G124400, and Ghicr24_D03G135300) showed consistent expression trends between the parental and extreme pools. Among them, Ghicr24_D03G124100 had the highest expression level, with expression levels in the high-weight pool and 'CRI50' being 5.78 times and 2.55 times higher than those in the low-weight pool and 'TM-1', respectively. Figure 4 (A in the middle).
[0076] Real-time quantitative PCR validation showed that at -1 DPA and 0 DPA, the expression levels of these four genes in 'CRI50' were significantly higher than those in 'TM-1'. Figure 4 (BE in the text). In summary, these genes may be potential candidate genes related to lining percentage.
[0077] 2.4 Association localization and candidate gene identification of qLP-D03-1 site
[0078] To narrow down the candidate region and identify potential candidate genes related to lint percentage, association analysis was performed on the qLP-D03-1 site using the average lint percentage of 355 upland cotton materials in four environments. A linear mixture model was used to analyze 3,050 high-quality SNPs within this region, detecting two significant association peaks exceeding the threshold, and nearby SNPs exhibited strong linkage disequilibrium (LD).
[0079] The most significant SNP (rsD03_42178383) is the -log 10 The value of (P) is 4.31 ( Figure 5 Linkage disequilibrium analysis further narrowed the candidate region to a 250.1 kb interval (D03:42056420-42306503), which contained 23 annotated genes (A in the original text). Figure 5 (B in the middle).
[0080] This interval overlaps with 7 previously reported QTLs related to clothing percentage, with LOD values ranging from 5.07 to 110.1. Figure 5 The region (C) was confirmed as a major hotspot QTL region. Notably, the differentially expressed gene Ghicr24_D03G124100 was located within this region, flanked by two significant SNPs and overlapping with six already mapped QTLs. Based on these consistent genetic results, this gene was named GhLPA1 for further research.
[0081] GhLPA1 shares approximately 84.35% amino acid sequence identity with its Arabidopsis homology gene (At3g62870), which encodes a ribosomal protein involved in cell proliferation. This high degree of conservation suggests that GhLPA1 may play a role in translation-related processes during fiber development. Public transcriptome data show that GhLPA1 expression peaks in early ovule development (-1, 0, 5 DPA). Figure 5 The D in the figure suggests that it may be involved in the regulation of fiber initiation.
[0082] 2.5 GhLPA1 is a positive regulator of cotton lint percentage.
[0083] To explore the potential biological functions of GhLPA1, its subcellular localization was first analyzed: fluorescence microscopy showed that the GhLPA1-GFP fusion protein was distributed in both the cytoplasm and the nucleus, indicating that GhLPA1 may play a role in these two regions.
[0084] Since the expression level of GhLPA1 in 'CRI50' was significantly higher than that in 'TM-1' at 0 DPA ( Figure 4 (A and B in the original text), therefore 'CRI50' was chosen as the recipient material for the VIGS experiment. During the boll opening stage, pCLCrV:GhCLH plants exhibited the expected leaf yellowing phenotype ( Figure 6 (A) confirms the effectiveness of the VIGS system.
[0085] Real-time quantitative PCR analysis showed that the expression level of GhLPA1 in the leaves of silenced plants was significantly reduced, only 44%-63% of that in pCLCrV:00 control plants. Figure 6 In the B group, the lint percentage in GhLPA1-silenced plants decreased to 37%, significantly lower than the 43% in control plants. Figure 6 (C); while boll weight (BW) showed no significant difference between the two groups of plants (C); Figure 6 (D and F in the text). Notably, the seed index (SI) of GhLPA1 silent plants was significantly increased, and both seed length and width were significantly increased (D and F in the text). Figure 6 In addition, the transcriptional level of GhLPA1 in ovules of silent plants at -1, 0, and 1 DPA was significantly lower than that in the control (E, GI); Figure 6 J in the middle.
[0086] At 0 DPA, several key fiber development-related genes (including GhPDF1, GhHOX3, GhEXPA1, GhEXPA2, and GhHDA5) were significantly downregulated in silenced plants. Figure 6 The expression of GhPDF2, GhHOX1, and GhPIN1a was upregulated, while the expression of GhMML3, GhHD1, and GhMYB25 remained unchanged.
[0087] 2.6 Haplotype Analysis and KASP Marker Development of GhLPA1
[0088] Based on SNPs within the 2 kb region upstream and downstream of GhLPA1, 355 upland cotton natural population materials were divided into two haplotypes: 'CRI50' (Hap1) and 'TM-1' (Hap2). This gene contains two non-synonymous mutations ( Figure 7 (A) Of the 355 materials, 242 belonged to Hap1 and 98 belonged to Hap2. Figure 7 (B in the middle).
[0089] An analysis of 328 cultivars from my country's four major cotton-growing regions revealed that Hap1 and Hap2 frequencies were roughly equal in the Northwest Inland Cotton Region, while Hap1 frequency was higher in the other three regions. Over the past 20 years, the proportion of Hap1 materials has gradually increased, rising from 14.4% to 49.7%. Figure 7 (C in the middle).
[0090] The fixation index (Fst) of the genomic region surrounding GhLPA1 exceeds 0.2 ( Figure 7 (D in the text), and genetic diversity shows a decreasing trend over time ( Figure 7 These results (E in the text) collectively indicate that Hap1 has been subject to artificial selection in recent breeding processes.
[0091] Furthermore, the lint percentage of Hap1 material was significantly higher than that of Hap2, while there was no significant difference in boll weight between the two groups of materials. Figure 7 The F and G values indicate that Hap1 can increase cotton lint yield without affecting boll weight.
[0092] To apply GhLPA1 to breeding practices, SNPs within a 2 kb region upstream and downstream of this gene were screened for the development of KASP markers. One SNP, rsD03_42213681, was identified in the 3' untranslated region (UTR), with C for Hap1 and G for Hap2.
[0093] Target sequences that cover the SNP:
[0094] CTCGGTGTTTTGAAAGTTAAACTACAAAATATATAAGTAATCCTCGGGCAAAGGAGTAAAATTT (SEQ ID No. 4, SNP site located at position 25 of the sequence, exhibiting C / G polymorphism) Specific primers were designed to develop a functional KASP marker. The developed KASP marker amplification primers are as follows:
[0095] Forward primer F1 with FAM fluorescent label:
[0096] GAAGGTGACCAAGTTCATGCTCTCGGTGTTTTGAAAGTTAAACTAC (SEQ ID No. 1);
[0097] Forward primer F2 with HEX fluorescent label:
[0098] GAAGGTCGGAGTCAACGGATTCTCGGTGTTTTGAAAGTTAAACTAG (SEQ ID No. 2);
[0099] Reverse primer: AAATTTTACTCCTTTGCCCGAGG (SEQ ID No. 3).
[0100] Genotyping of 278 randomly selected recombinant inbred lines and their parents using this marker clearly distinguished two haplotypes. Figure 7In the H section: 98 lines carried the 'CRI50' haplotype, and 180 lines carried the 'TM-1' haplotype; the pelvic fraction of recombinant inbred lines carrying the 'CRI50' genotype was significantly higher than that of families with the 'TM-1' genotype. Figure 7 (I in the text). Further validation in natural populations also confirmed that the lint percentage of Hap1 material was significantly higher than that of Hap2. These results indicate that the KASP marker can be used for breeding cotton with high lint percentage.
[0101] 3. Discussion
[0102] 3.1 Field phenotypic survey and statistical analysis for screening extreme germplasm resources
[0103] Among the main components of cotton yield, lint percentage is a key indicator determining total fiber yield. It reflects the proportion of lint in seed cotton and directly affects lint yield. Compared with other yield components such as boll number per plant and boll weight, lint percentage exhibits greater stability under different environments, making it crucial for genetic improvement of cotton yield. The upland cotton genetic standard line 'TM-1' was developed from the Deltapine 14 variety through 17 generations of pedigree selection, exhibiting a highly homozygous genetic background and a stable lint percentage of approximately 37%. In contrast, 'CRI50', a control variety used in regional cotton trials in the Yangtze River basin of my country, has a higher lint percentage (approximately 43%) and stable yield performance under various environmental conditions. Under the same environmental conditions, the significant and stable differences in lint percentage between the two parents indicate significant genetic differentiation at loci related to lint yield.
[0104] The recombinant inbred line population constructed from these two parents is an ideal genetic material for elucidating the genetic basis of garment segmentation. Because the recombinant inbred line population has a nearly homozygous genetic background, it allows for precise genotype-phenotype association analysis and reduces interference from residual heterozygosity.
[0105] In this study, the broad-sense heritability of lint percentage under the four experimental conditions was 81.65%, consistent with the heritability reported in other cotton populations (61.21%-91.47%). High heritability indicates that lint percentage is significantly influenced by genetic factors, and also confirms that this recombinant inbred line population is suitable for subsequent multi-omics QTL identification and functional gene mining.
[0106] 3.2 Multi-omics analysis reveals that qLP-D03-1 is a stable QTL controlling cotton lint percentage.
[0107] This study integrated BSR-seq, GWAS, and transcriptome analysis of recombinant inbred lines, significantly improving the resolution and reliability of QTL mapping in upland cotton and identifying the stable locus qLP-D03-1. Traditional cotton QTL mapping is often limited by factors such as wide confidence intervals and complex genetic backgrounds, leading to ambiguous signals and false positives. Previous studies using low-density markers such as SSR or SLAF-seq (specific locus amplification fragment sequencing) often identified QTLs covering 5-10 Mb or even larger genomic regions, greatly hindering the precise mapping of candidate genes.
[0108] In contrast, the recombinant inbred line BSR-seq method used in this study has two major advantages: First, compared with temporary mapping populations such as F2, recombinant inbred line BSR-seq can reduce false positive signals and ensure that allele frequencies and expression differences reflect real genetic effects rather than random segregation noise.
[0109] Secondly, BSR-seq provides a cost-effective, high-resolution method for analyzing the complex traits of large-scale genome species. For polyploid crops such as upland cotton (with a genome of approximately 2.3 Gb), whole-population resequencing or high-density GWAS still presents economic and computational challenges; while BSR-seq, by sequencing only the mixed pool of phenotypic extremes, efficiently captures major allelic variations at a lower cost. Similar strategies have been successfully applied to the fine mapping of yield-related loci in millet and wheat.
[0110] Combining GWAS with this approach allowed for the efficient narrowing of qLP-D03-1 to a 250.1 kb region containing 23 annotated genes. Importantly, this region overlapped with several previously reported lint-related QTLs across different populations, confirming it as a recurring, stable hotspot QTL region. Furthermore, the expression level of GhLPA1 at 0 DPA was highly consistent with the allelic variations revealed by BSR-seq and GWAS. The integration of linkage, association, and expression analyses provided strong mechanistic evidence for a direct causal relationship between genotype and phenotype, strongly supporting GhLPA1 as a reliable candidate gene. This multi-level validation strategy has been successfully applied to the identification of stable QTLs for wheat yield and quality traits, as well as to watermelon fruit quality studies, but its application in cotton is limited.
[0111] 3.3 Functional validation of the GhLPA1 candidate gene
[0112] This study identified GhLPA1 as a key candidate gene for the major-effect QTL qLP-D03-1, which has a positive regulatory effect on lint secretion in upland cotton. To further explore its molecular basis and potential biological functions, this study analyzed its subcellular localization and compared its amino acid sequence with homologous genes in Arabidopsis thaliana.
[0113] Fluorescence microscopy revealed that GhLPA1 is located in both the cytoplasm and nucleus, consistent with its predicted ribosomal protein function, involving translation and cellular metabolic processes. Sequence analysis showed that GhLPA1 shares approximately 84.35% amino acid sequence identity with the Arabidopsis homology gene RPL7aB (At3g62870), a structural component of the 60S ribosomal large subunit. The 60S subunit is assembled from 5.8S, 25S, and 5S rRNA and approximately 40–48 ribosomal proteins (RPLs). In plant cells, these subunits form in the nucleus and are subsequently transported to the cytoplasm for maturation, explaining why many RPL proteins exhibit nucleoplasmic dual localization.
[0114] Although RPL proteins are crucial for ribosome biogenesis and translation, mounting evidence suggests that many RPL proteins also have extraribosome functions regulating plant development. However, their potential roles in cotton fiber development remain poorly understood.
[0115] Previous studies have shown that the rosette leaves and leaf blades of the At3g62870 mutant are significantly smaller than those of the wild type, which is due to reduced cell proliferation. Furthermore, the mutant also exhibits reduced chlorophyll a and b content, fewer chloroplasts, and pale, reticulate leaves, indicating that this gene is involved in cell proliferation and chloroplast biosynthesis. Given that cotton fiber initiation requires rapid epidermal cell expansion and increased metabolic activity, these findings suggest that GhLPA1 may promote active cell growth in the early stages of ovule development.
[0116] Consistent with this hypothesis, silencing GhLPA1 can significantly reduce lint content ( Figure 6 (C in the middle); although there was no significant difference in bell weight ( Figure 6 The F in the text, but while the lint percentage decreased, the seed size and seed index increased, indicating a developmental balance between fiber and seed growth (F), but the lint percentage decreased while the seed size and seed index increased, indicating a developmental balance between fiber and seed growth (F). Figure 6 In addition, at 0 DPA, several key fiber development-related genes (GhPDF1, GhHOX3, GhEXPA1, GhEXPA2, and GhHDA5) were significantly downregulated in silenced plants. Figure 6 These genes (JO in the gene pool) are known to play key roles in fiber initiation and elongation. In summary, these results suggest that GhLPA1 may be a candidate gene involved in fiber development.
[0117] 3.4 GhLPA1 is subject to selection during the breeding process
[0118] The identification of two major haplotypes at the GhLPA1 locus revealed the contribution of allelic differentiation to lint percentage variation in upland cotton. Materials carrying the 'CRI50' haplotype (Hap1) had significantly higher lint percentages than those carrying the 'TM-1' haplotype (Hap2), consistent with parental phenotypic differences. Since there was no significant difference in boll weight between the two haplotypes, the increased lint percentage associated with Hap1 could directly increase lint yield without reducing boll weight, highlighting its potential value in yield improvement.
[0119] Based on seven SNPs (including two non-synonymous mutations) identified within a 2 kb region upstream and downstream of GhLPA1, 355 cotton varieties were mainly divided into two haplotypes: 'CRI50' (Hap1) and 'TM-1' (Hap2). Figure 7 The KASP marker (rsD03_42213681) developed based on the GhLPA1 3' untranslated region (UTR) SNP can effectively distinguish between high and low lint percentage phenotypes in recombinant inbred lines and natural populations. This marker has promising applications in molecular breeding to improve lint percentage.
[0120] 4. Conclusion
[0121] This study combined BSR-seq, GWAS, and transcriptome analysis of recombinant inbred lines to identify the major-effect QTL qLP-D03-1 and the candidate gene GhLPA1 controlling cotton lint percentage. VIGS validation confirmed that GhLPA1 can positively regulate lint yield without affecting boll weight. In addition, a functional KASP marker developed based on the 3' untranslated region (UTR) SNP of GhLPA1 can effectively distinguish high lint percentage haplotypes, providing a valuable resource for cotton yield improvement.
[0122] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other variations and modifications are possible without departing from the technical solutions described in the claims.
Claims
1. An amplification primer for KASP marker on D03 chromosome for high lint content variety selection of cotton, characterized in that, Comprising: Forward primer F1 with FAM fluorescent label: GAAGGTGACCAAGTTCATGCTCTCGGTGTTTTGAAAGTTAAACTAC; Forward primer F2 with HEX fluorescent label: GAAGGTCGGAGTCAACGGATTCTCGGTGTTTTGAAAGTTAAACTAG; Reverse primer: AAATTTTACTCCTTTGCCCGAGG; The cotton variety is Gossypium hirsutum.
2. A kit for detecting KASP markers on D03 chromosome for high lint content variety selection of cotton, characterized in that, The kit comprises the amplification primer of claim 1, and the cotton variety is Gossypium hirsutum.
3. A PCR reagent for detecting KASP marker on D03 chromosome for high lint content variety selection of cotton, characterized in that, The PCR reagent comprises the amplification primer of claim 1, and the cotton variety is Gossypium hirsutum.
4. The use of the amplification primer of claim 1 in the breeding of high lint percentage cotton varieties, characterized in that, The cotton variety is Gossypium hirsutum.
5. A molecular marker-assisted breeding method for high-yield upland cotton varieties, characterized in that, The amplification primer of the KASP marker on the D03 chromosome for high lint percentage cotton variety selection of claim 1 is used for KASP reaction of the cotton to be tested, the reaction product is detected, and only the fluorescence of the FAM fluorescent label is detected in the reaction product, so that the cotton to be tested is high lint percentage genotype cotton.
Citation Information
Patent Citations
Cotton lint percentage molecular marker and application thereof
CN109504796A
SSR molecular marker for identifying upland cotton plant height and application thereof
CN116024377A