Application of KMT2A as target in preparation or screening of product for preventing or treating diabetic peripheral neuralgia disease

By preparing or screening KMT2A inhibitors, especially KMT2A shRNA, and inhibiting KMT2A expression, the problems of DPN neuroinflammation and pain sensitization caused by microglial overactivation were resolved, achieving effective treatment and prevention of DPN.

CN121401418APending Publication Date: 2026-01-27THE FIRST AFFILIATED HOSPITAL OF WENZHOU MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511337561.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-18
Publication Date
2026-01-27

AI Technical Summary

Technical Problem

Current technology has not been able to effectively inhibit the overactivation of microglia, which leads to neuroinflammation and pain sensitization in diabetic peripheral neuropathy (DPN). Current treatments can only relieve symptoms and do not fundamentally address the pathogenesis.

Method used

Using KMT2A as a target, KMT2A inhibitors, such as nucleic acid molecules, nucleic acid constructs, lentiviruses, antibodies, or small molecule compounds, especially KMT2A shRNA, are prepared or screened to inhibit its expression in order to alleviate neuroinflammation and pain sensitization in DPN.

Benefits of technology

Inhibiting KMT2A gene expression significantly alleviated neuroinflammation and pain sensitivity in DPN mice, providing potential molecular evidence for the clinical treatment and prevention of DPN.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121401418A_ABST
    Figure CN121401418A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological pharmacy, and particularly relates to application of KMT2A as a target in preparation or screening of products for preventing or treating diabetic peripheral neuralgia diseases. KMT2A is screened as a key molecule for regulating and controlling diabetic peripheral neuralgia by establishing a diabetic peripheral neuralgia (DPN) model and combining an mRNA (messenger Ribonucleic Acid) sequencing technology. According to the invention, the lentivirus containing the KMT2A gene and a pharmaceutically acceptable carrier for treating diabetic peripheral neuralgia are constructed. The lentivirus system LV-shKMT2A packaging the knock-down KMT2A is injected into a DPN mouse through intrathecal injection, and neuroinflammation and pain sensitization of the DPN mouse can be remarkably improved. The invention provides a novel drug target for prevention and treatment of DPN mice, and has important clinical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biopharmaceutical technology, specifically relating to the application of KMT2A as a target in the preparation or screening of products for the prevention or treatment of diabetic peripheral neuropathy. Background Technology

[0002] Diabetic peripheral neuropathy (DPN) is a common complication of diabetes, characterized by persistent or intermittent pain in the extremities, accompanied by sensory abnormalities such as numbness, tingling, and burning. The pathogenesis of DPN is complex, potentially involving nerve damage caused by hyperglycemia, inflammatory responses, and metabolic disorders. With the increasing number of diabetes patients worldwide, the incidence of DPN is rising annually. Studies show that approximately 50% of diabetic patients develop peripheral neuropathy at different stages of their disease, and about 30% of these develop into DPN. Furthermore, the prevalence of DPN is closely related to poor diabetes control, disease duration, and age; the incidence is significantly higher in elderly patients and those with a longer duration of diabetes. Currently, the treatment of DPN faces significant challenges. Commonly used analgesics have limited effectiveness, and existing treatments only relieve symptoms without addressing the underlying pathogenesis. Therefore, in-depth research into the pathogenesis of DPN, especially the relationship between glucose metabolism disorders and nerve damage, is of significant scientific and clinical value for developing novel treatment strategies.

[0003] In the pathological process of diabetic neuropathy (DPN), microglia activation plays a crucial role. As immune effector cells of the central nervous system, microglia exhibit a significant pro-inflammatory phenotype polarization tendency under hyperglycemic conditions, leading to the secretion of more pro-inflammatory factors. Microglia activation not only causes local neuronal damage but also further exacerbates neuroinflammation by releasing inflammatory factors such as NO, PGE2, and IL-1β. These factors can also alter synaptic transmission and electrophysiological properties, changing neuronal excitability and resulting in enhanced and persistent neuronal pain. Studies have shown that pro-inflammatory factors such as TNF-α not only enhance neuronal responses to pain but may also further promote the occurrence and aggravation of pain by altering neuronal structure and inducing pathological changes such as demyelination. Furthermore, inflammatory mediators secreted by microglia not only directly affect neurons but also exacerbate local inflammatory responses by promoting the recruitment of other immune cells and glial cells. In a hyperglycemic environment, the persistent neuroinflammation creates a vicious cycle, further aggravating nerve damage and neuropathic pain. In this context, excessive activation of microglia and excessive release of inflammatory factors become key pathogenic factors of DPN. However, how to effectively inhibit excessive activation of microglia during the progression of DPN remains unclear. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings and deficiencies of the existing technology and to provide an application of KMT2A as a target in the preparation or screening of products for the prevention or treatment of diabetic peripheral neuropathy.

[0005] The first objective of this invention is to provide the use of KMT2A or its transcript mRNA or mRNA fragment as a target in the preparation or screening of products for the prevention or treatment of diabetic peripheral neuropathy.

[0006] Preferably, the product for preventing or treating diabetic peripheral neuropathy is a molecule or preparation that inhibits the expression of the KMT2A gene or its transcript mRNA or mRNA fragment, prepared or screened with the KMT2A gene or its transcript mRNA or mRNA fragment as the target.

[0007] Preferably, the KMT2A inhibitor is a nucleic acid molecule, a nucleic acid construct, a lentivirus, an antibody, or a small molecule compound.

[0008] Preferably, the KMT2A inhibitor is a nucleic acid molecule or a vector loading the nucleic acid molecule, wherein the nucleic acid molecule is KMT2A shRNA, and the sequence of the KMT2A shRNA is CGCCTTCACTTGACCATAATT.

[0009] A drug for the prevention or treatment of diabetic peripheral neuropathy includes a KMT2A inhibitor, wherein the KMT2A inhibitor is a molecule or preparation prepared or screened with the KMT2A gene or its transcript mRNA or mRNA fragment as a target and has an inhibitory effect on the expression of the KMT2A gene or its transcript mRNA or mRNA fragment.

[0010] Preferably, the KMT2A inhibitor is a nucleic acid molecule, a nucleic acid construct, a lentivirus, an antibody, or a small molecule compound.

[0011] Preferably, the KMT2A inhibitor is a nucleic acid molecule or a vector loading the nucleic acid molecule, wherein the nucleic acid molecule is KMT2A shRNA, and the sequence of the KMT2A shRNA is CGCCTTCACTTGACCATAATT (as shown in SEQ ID NO: 1).

[0012] Preferably, the KMT2A inhibitor is a lentiviral vector loaded with the KMT2A shRNA.

[0013] Preferably, the drug is a stereotactic injection formulation for the brain.

[0014] The method for preparing a drug for the prevention or treatment of diabetic peripheral neuropathy as described above includes the following steps: 1) Prepare expression plasmids containing the KMT2A shRNA sequence. Transform, amplify, extract and purify the expression plasmids containing the KMT2A shRNA sequence to obtain recombinant plasmids containing the KMT2A shRNA sequence. 2) Co-transfect 293T cells with the recombinant plasmid obtained in step 1) and the packaging plasmid to package the virus and collect the viral fluid; 3) Concentrate and purify the viral fluid to obtain a lentivirus containing the KMT2A gene; 4) Mix the lentivirus containing the KMT2A gene with a pharmaceutically acceptable vector.

[0015] The beneficial effects of this invention are as follows: This invention established a type 1 diabetes model through intraperitoneal injection of streptozotocin (STZ) and successfully established a DPN mouse model. Simultaneously, it was confirmed that the levels of inflammatory factors in the dorsal horn of the spinal cord in DPN model mice were significantly increased, while the levels of neuroprotective factors were reduced, demonstrating that DPN is accompanied by neuroinflammation and nerve damage. To further explore the regulatory mechanism of neuroinflammation in DPN, the inventors performed transcriptome analysis on the dorsal horn of the spinal cord in DPN and control mice. Through differential gene screening, GO and KEGG functional enrichment analysis, and the STRING database, a protein-protein interaction (PPI) network was established, identifying lysine methyltransferase 2A (KMT2A) as a potential active molecule. Previous studies have shown that KMT2A, as a core member of the histone H3K4 methyltransferase family, plays a crucial role in epigenetic regulation. Furthermore, KMT2A is closely related to microglial activation, activating the NF-κB and MAPK signaling pathways in microglia through methylation modification of transcription factors, thus promoting the production and release of inflammatory cytokines such as TNF-α and IL-1β. However, no research has yet been found regarding the role of KMT2A in DPN pain sensitization and neuroinflammation.

[0016] This invention further constructed an adeno-associated virus (AAV) for inhibiting the KMT2A gene and observed the effects of KMT2A gene inhibition on neuroinflammation and pain sensitivity in diabetic peripheral neuropathy (DPN). The results showed that KMT2A gene expression was increased in DPN mice, and downregulating KMT2A gene expression alleviated neuroinflammation and pain sensitivity in DPN mice. These results validate that inhibiting KMT2A gene expression can significantly improve neuroinflammation and pain sensitivity in DPN mice, providing potential molecular evidence for the clinical treatment and prevention of diabetic peripheral neuropathy. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, obtaining other drawings based on these drawings without creative effort still falls within the scope of the present invention.

[0018] Figure 1 This demonstrates the successful establishment of the DPN model and the development of spinal dorsal horn nerve inflammation symptoms in DPN mice. a: Blood glucose concentration was measured in mice after intraperitoneal injection of STZ; the STZ group showed a significant increase in blood glucose concentration. b: The mechanical pain threshold was significantly reduced in mice after intraperitoneal injection of STZ, indicating successful establishment of the DPN model. c: The thermal pain threshold was significantly reduced in mice after intraperitoneal injection of STZ, indicating successful establishment of the DPN model. d: The levels of inflammatory factors in the spinal dorsal horn of DPN model mice were significantly increased. e: The levels of neuroprotective factors in the spinal dorsal horn of DPN model mice were significantly decreased.

[0019] Figure 2 Based on transcriptome sequencing results, KMT2A was identified as playing a pivotal role in DPN and its expression was increased in the dorsal horn of the spinal cord. a: Transcriptome sequencing heatmaps of the dorsal horn of the spinal cord in DPN mice and control mice, showing good homogeneity within the two groups; b: KEGG analysis of differentially expressed genes revealed that differentially expressed genes were mainly enriched in key pathways such as neuroinflammation, and KMT2A played a pivotal role in these pathways; c: Volcano plots of transcriptome sequencing of the dorsal horn of the spinal cord in DPN mice and control mice, identifying key differentially expressed genes; d: Western blotting analysis of the dorsal horn of the spinal cord revealed increased KMT2A protein expression in the dorsal horn of the spinal cord in DPN mice.

[0020] Figure 3 Injecting a virus with knockdown of KMT2A expression into the spinal cord of bilateral mice revealed that it could alleviate neuroinflammation and pain sensitization in diabetic peripheral neuropathy (DPN). a: To clarify the role of KMT2A in DPN, we constructed a lentivirus with knockdown of KMT2A and injected it into the spinal cord of mice. Knockdown of KMT2A significantly increased the mechanical pain threshold in DPN mice, suggesting relief of mechanical pain sensitization; b: Knockdown of KMT2A significantly increased the thermal pain threshold in DPN mice, suggesting relief of thermal pain sensitization; c: Knockdown of KMT2A significantly decreased inflammatory factors in the dorsal horn of the spinal cord in DPN mice, suggesting relief of neuroinflammation; d: Knockdown of KMT2A increased neuroprotective factors in the dorsal horn of the spinal cord in DPN mice, reducing nerve damage. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings.

[0022] Example 1: Establishing an STZ-induced DPN mouse model to detect behavioral changes in pain threshold and neuroinflammation levels in mice. 1. Materials This experiment used 3-month-old C57BL / 6 strain mice, all purchased from a certified institution (Beijing Vital Rivers). Before the experiment, the animals were housed individually in cages with strictly maintained environmental parameters: temperature stable at 22 ± 2℃, humidity controlled within 55 ± 10%. They had free access to food and water, and were fed a standard laboratory animal formula to ensure their good health. The diurnal cycle was set to a 12-hour light-dark alternation, with light exposure from 8:00 AM to 8:00 PM daily, simulating natural circadian rhythms. The entire experimental process strictly adhered to animal ethics guidelines and was approved by the Animal Ethics Committee of Wenzhou Medical University.

[0023] 2 / Method 2.1 Establishment of DPN Model After a week of acclimatization, mice were given a 12-hour fast (no food or water) and then injected intraperitoneally with streptozotocin (STZ) at a dose of 150 mg / kg body weight to establish a type 1 diabetes model. The STZ solution was prepared using citrate buffer at pH 4.2–4.5. Fasting blood glucose was measured via tail vein sampling 72 hours post-injection; a blood glucose level ≥16.7 mmol / L was considered a successful model. Mice were then fed continuously for 8–12 weeks to induce diabetic neuropathy (DPN). Model evaluation indicators included measurements of mechanical pain, thermal pain, motor and sensory nerve conduction velocities to ensure model stability and reproducibility.

[0024] 2.2 Mechanical pain threshold behavioral test At least one hour before the formal test, the experimental animal should be transferred to a quiet, temperature-controlled (22-25°C) testing room and gently placed in a specially designed transparent testing cage with a metal mesh bottom, allowing the sole of its foot to be touched. Allow at least 30 minutes for acclimatization until the animal returns to a calm state. After the acclimatization period, observe the animal's baseline behavior when awake, quiet, and with its limbs bearing weight naturally. The operator must be proficient in using a range of calibrated force values ​​(e.g., 0.008g to 6.0g) of Von Frey fibers, practicing vertical, slow application of force, ensuring the fibers bend into a "C" shape when contacting the central area of ​​the sole (avoiding the edge pads) and hold for 3-6 seconds before smoothly withdrawing. The test typically begins with a force near the predicted threshold, applying the stimulus vertically, and closely observing the animal's response during application and for 5-10 seconds after withdrawal. A positive pain response is defined as rapid withdrawal, violent shaking, licking, biting, or persistent lifting of the stimulated foot, while slight positional changes are disregarded. The threshold is determined using the "top-bottom method": if there is no response, a higher-strength fiber is used; if there is a response, a lower-strength fiber is used. Stimulation is applied alternately at different micro-locations on the sole of the foot, with intervals of at least 30 seconds. The intensity and response (positive / negative) are recorded each time. After 4-6 reversals of stimulation, the 50% mechanical withdrawal threshold (PWT) of the limb is calculated using the formula. The same limb can be measured 2-3 times, with a 5-10 minute rest interval, and the average value is taken. If bilateral hind limbs need to be tested, they should be alternated or performed on different days. After each animal is tested, the bottom of the cage is thoroughly cleaned, and the animal number, date, operator, intensity, location, response, and final PWT value are recorded in detail. Throughout the process, the environment should be quiet and the lighting soft. The operator should move gently and use blind methods as much as possible, paying attention to the animal's condition and eliminating abnormal data.

[0025] 2.3 Thermal pain threshold behavioral test At least one hour before the test, place the animal in a quiet, temperature-controlled testing room (22-25°C), gently placing it in a specially designed observation box with a transparent glass bottom so that the soles of its hind limbs are exposed to the heat source below. Allow the animal at least 30 minutes to acclimatize to the environment until it remains calm, alert, and its limbs are naturally bearing weight. Before the formal test, turn on and calibrate the radiant heat pain meter to ensure accurate beam focusing and stable intensity (usually set to an intensity that elicits a normal foot withdrawal response in approximately 10-15 seconds). During the test, the operator precisely focuses the beam emitted by the portable heat source generator onto the central area of ​​the sole of one hind limb of the animal (avoiding the edge of the footpad) and immediately starts the timer. Closely observe the animal's behavior. When the animal rapidly withdraws the stimulated hind limb, licks its foot, or exhibits a clear escape response, quickly remove the heat source and stop the timer. Record the latency (in seconds) from the onset of the heat stimulation to the appearance of a clear foot withdrawal response as a single measurement. Each stimulation should be spaced at least five minutes apart and performed at different small locations on the sole of the foot to avoid tissue damage or changes in sensitivity. Repeat the measurement three times, and take the average of the three latency periods as the thermal pain threshold of the limb. If the animal does not respond within the specified maximum cutoff time (usually 15-20 seconds to prevent tissue burns), record the cutoff time and remove the heat source. Sufficient intervals are required for multiple tests on the same side, and tests on the contralateral side should be performed in multiple sessions or on different days. After each animal is tested, record the number, date, operator, location of each stimulus, latency period, and final threshold in detail. The entire testing process should be conducted in a quiet environment with soft lighting. The operator should move gently and use blind methods as much as possible. Observe the overall condition of the animal carefully and discard data due to non-painful behaviors (such as walking or grooming) or no response (such as lethargy).

[0026] 2.4 Immunoblotting assay Mouse spinal cord tissue was lysed using RIPA lysis buffer containing protease inhibitors. The supernatant was collected by centrifugation, and protein concentration was determined using the BCA method. An equal volume of protein (20-40 μg) was adjusted and mixed with loading buffer, then boiled. Electrophoresis was performed: SDS-PAGE gels of appropriate concentrations were prepared according to the target molecular weight range (TNF-α / IL-1β / BDNF≈15-25 kDa, NG / MAG≈100-130 kDa) (12% gel for low molecular weight indices, 8% gel for high molecular weight indices). Electrophoresis was performed at constant voltage until the bromophenol blue gel bottom was reached. Transfer was performed using a wet transfer method with a constant current of 200-300 mA for 1-2 hours. Blocking was then performed. Blocking with 5% skim milk (or BSA for phosphorylated proteins) in TBST solution at room temperature for 1 hour; Primary antibody incubation: overnight incubation at 4°C with specific primary antibody (TNF-α / IL-1β / BDNF / NG / MAG, 1:1000); Washing and secondary antibody: wash 3 times with TBST for 10 minutes each time, then incubate with corresponding HRP-labeled secondary antibody (1:10000) at room temperature for 1 hour; Development: react with ECL chemiluminescence reagent and then expose to an imaging system; Internal control detection: strip the membrane and incubate with β-actin antibody, then develop using the same method; Quantification: analyze the grayscale ratio of the target band to the internal control using ImageJ.

[0027] 2.5 mRNA sequencing Tissue samples extracted from mouse spinal cord were ground with Trizol lysis buffer to fully release RNA. 200 μL of chloroform was added, mixed, and allowed to stand for 5 minutes to separate the phases. The mixture was then transferred to a high-speed rotary gypsum at 4℃ / 12000g for 10 minutes to form a three-layer structure (aqueous phase / intermediate layer / organic phase). The upper aqueous phase containing RNA was carefully removed. An equal volume of isopropanol was added, mixed, and allowed to stand for 10 minutes to precipitate the nucleic acid. The precipitate was collected by centrifugation under the same conditions. The precipitate was washed with 75% ethanol to remove impurities, centrifuged again to remove the liquid, and air-dried at room temperature for 5-10 minutes to avoid over-drying. After dissolving the precipitate in enzyme-free water, the concentration (ng / μL) and purity (A260 / A280 = 1.8-2.1) were determined using Nanodrop, and integrity (RIN > 7) was assessed using Agilent 2100. Qualified RNA was enriched with mRNA by rRNA removal, and then fragmented into 200-300bp fragments by heating; cDNA was synthesized by reverse transcription, and Illumina adapters were ligated using the VAHTS Universal V8 kit to construct a library; PCR amplification was performed to increase the concentration, and the library quality was finally confirmed by Agilent 2100 (fragments 300-500bp, concentration met the requirements).

[0028] Qualified cDNA libraries were subjected to paired-end high-throughput sequencing on the Illumina HiSeq 4000 platform, producing 30 to 50 million high-quality reads per sample. Data were stored in paired fastq files (R1 / R2) containing sequence and quality scores. Raw sequence quality control employed FastQC to assess Phred scores (Q20 / Q30), GC composition, length distribution, and repetition rate, while MultiQC integrated multi-sample reports. Preprocessing was performed using Trimmomatic, removing adapters and filtering low-quality bases (Phred < 20). Subsequently, effective reads were aligned to the mouse GRCm39 reference genome using HISAT2, featureCounts quantified gene / transcriptional expression, and FPKM normalization eliminated technical bias. Finally, DESeq2 was used to perform differential transcriptional analysis between groups to screen for significantly differentially expressed genes, and multiple validation corrections were applied to control the false detection rate.

[0029] In this embodiment, a type 1 diabetes model was established by intraperitoneal injection of streptozotocin (STZ). Fasting blood glucose was measured 72 hours post-injection via tail vein sampling. A blood glucose level ≥16.7 mmol / L was considered a successful model. The mice were then fed for 8-12 weeks to induce the diabetic peripheral blood neuropathy (DPN) model. Blood glucose levels in the DPN mice were then monitored for 21 consecutive days. Compared to the control group, the DPN mice showed significantly elevated blood glucose levels, indicating a hyperglycemic state and successful model establishment. Figure 1 a). Using von Frey cilia to detect changes in the mechanical pain threshold in mice, it was found that the mechanical pain threshold was significantly reduced in DPN mice ( Figure 1 b), using a hot plate test to detect changes in the thermal pain threshold in mice, the thermal pain threshold of DPN mice was significantly reduced ( Figure 1 c), indicating the successful establishment of diabetic peripheral neuropathy (DPN) mice. Next, changes in neuroinflammation levels in the mice were examined. Compared to the control group, the expression of neuroinflammatory factors TNF-α and IL-1β in the spinal cord of DPN mice was significantly increased ( Figure 1 d), while the expression of neuroprotective factors BDNF, NG, and MAG was significantly reduced ( Figure 1 e).

[0030] Spinal cord tissue from DPN mice was collected, RNA was extracted, a library was constructed, and finally, sequencing analysis was performed. Through mRNA sequencing and combined bioinformatics analysis, KM2TA was preliminarily identified as a potential molecular target. Figure 2 The expression of KM2TA was verified at the protein level, and the expression of KM2TA was significantly increased in DPN mice. Figure 2 d).

[0031] Example 2: Constructing a KMT2A knockdown lentivirus and detecting the effects of spinal injection of KMT2A knockdown virus in mice on pain threshold behavior and neuroinflammation levels in DPN mice. 1. Materials In vector construction, the Fg12 plasmid was double-digested with BamHI / XhoI (1µg plasmid + 1µL restriction enzyme + 2µL buffer + water to 20µL, incubated at 37℃ for 2 hours); the digestion product was ligated with the KMT2A shRNA sequence (CGCCTTCACTTGACCATAATT) using T4 ligase (50ng vector + 10ng insert + 1µL enzyme + 1µL buffer + water to 10µL, incubated overnight at 16℃). The ligation product was transformed into DH5α competent cells and cultured overnight on ampicillin LB plates at 37℃; single colonies were picked for plasmid amplification, and the plasmid was purified using a large-scale extraction kit, with purity measured by Nanodrop (A260 / A280 = 1.8-2.0). Virus packaging stage: HEK293T cells were cultured to 80% confluency and then replaced with serum-free medium. The target vector (10 µg) and helper plasmids (pRSV 5 µg + pMDLg 5 µg + pMDG 2.5 µg) were transfected using Lipofectamine 2000. The mixture contained 50 µL of transfection reagent and serum-free medium, with the final volume brought to 1 mL. Forty-eight hours after transfection, the supernatant was collected, filtered through a 0.45 µm membrane to remove impurities, and concentrated using ultrafiltration at 20000 g / 4℃ for 2 hours. The concentrated virus particles were then stored at -80℃ (titer ≥ 1 × 10⁻⁶). 8 IU / mL). Infection verification: N2a cells were pretreated with poly-L-lysine to enhance viral adsorption, and concentrated lentivirus was added and cultured for 48 hours. Finally, the KMT2A knockdown efficiency was confirmed by Western blotting or quantitative PCR.

[0032] 2. Methods 2.1 Stereotactic Injection Surgery Experimental animals were anesthetized with intraperitoneal injection of 1% sodium pentobarbital (50 mg / kg) and fixed in a specialized rack to ensure body stability. Using a stereotactic map of the mouse spinal cord, the target segment coordinates (T10-L1 segments, 0.5 mm from the dorsal surface) were determined by vertebral landmarks. A microinjector connected to a pump control system was used to precisely inject 1 μL / side of KMT2A shRNA lentivirus into the bilateral target areas of the spinal cord at a rate of 100 nL / min, maintaining a uniform injection rate to prevent tissue damage; the needle was left in place for 15 minutes to prevent reflux and diffusion of the solution. Respiratory and heart rates were continuously monitored intraoperatively to maintain stable vital signs. Postoperatively, the muscle layer and skin were aseptically sutured, and an antibacterial ointment was applied topically to the wound to prevent infection. The animals were then transferred to a warming pad until awakening.

[0033] 2.2 Mechanical Pain Threshold Behavioral Experiment The behavioral steps are the same as in Example 1: 2.2.

[0034] 2.3 Thermal pain threshold behavioral experiment The behavioral steps are the same as in Example 1: 2.3.

[0035] 2.4 Immunoblotting assay Same as Example 1: 2.4.

[0036] In this embodiment, a lentivirus containing KM2TA shRNA was designed and packaged. Its knockdown efficiency was verified at the cellular level. Bilateral spinal cord injection of the lentivirus containing KM2TA shRNA into DPN mice revealed behavioral results showing that KM2TA knockdown significantly increased the mechanical pain threshold in DPN mice. Figure 3 a), while significantly increasing its thermal pain threshold ( Figure 3 b). Next, changes in neuroinflammation levels in mice were examined. Compared to DPN mice, knockdown of KM2TA significantly reduced the expression of neuroinflammatory factors TNF-α and IL-1β in the spinal cord of DPN mice. Figure 3 c), while the expression of neuroprotective factors BDNF, NG, and MAG was significantly increased ( Figure 3 d).

[0037] The above description discloses only preferred embodiments of the present invention and should not be construed as limiting the scope of the present invention. Therefore, equivalent variations made in accordance with the claims of the present invention are still within the scope of the present invention.

Claims

1. The application of KMT2A or its transcription product mRNA or mRNA fragment as a target in the preparation or screening of products for the prevention or treatment of diabetic peripheral neuropathy.

2. The application according to claim 1, characterized in that: The product for the prevention or treatment of diabetic peripheral neuropathy is a molecule or preparation that targets the KMT2A gene or its transcript mRNA or mRNA fragment and has an inhibitory effect on the expression of the KMT2A gene or its transcript mRNA or mRNA fragment.

3. The application according to claim 2, characterized in that: The KMT2A inhibitor is a nucleic acid molecule, nucleic acid construct, lentivirus, antibody, or small molecule compound.

4. The application according to claim 3, characterized in that: The KMT2A inhibitor is a nucleic acid molecule or a vector carrying the nucleic acid molecule, wherein the nucleic acid molecule is shRNA, and the sequence of the KMT2A shRNA is CGCCTTCACTTGACCATAATT.

5. A medicament for the prevention or treatment of diabetic peripheral neuropathy, characterized in that: The invention includes a KMT2A inhibitor, which is a molecule or preparation that inhibits the expression of the KMT2A gene or its transcript mRNA or mRNA fragment, prepared or screened with the KMT2A gene or its transcript mRNA or mRNA fragment as the target.

6. The medicament for the prevention or treatment of diabetic peripheral neuropathy according to claim 5, characterized in that: The KMT2A inhibitor is a nucleic acid molecule, nucleic acid construct, lentivirus, antibody, or small molecule compound.

7. The medicament for the prevention or treatment of diabetic peripheral neuropathy according to claim 6, characterized in that: The KMT2A inhibitor is a nucleic acid molecule or a vector loading the nucleic acid molecule, wherein the nucleic acid molecule is KMT2A shRNA, and the sequence of the KMT2A shRNA is CGCCTTCACTTGACCATAATT.

8. The medicament for the prevention or treatment of diabetic peripheral neuropathy according to claim 7, characterized in that: The KMT2A inhibitor is a lentiviral vector loaded with the KMT2A shRNA.

9. The medicament for the prevention or treatment of diabetic peripheral neuropathy according to claim 8, characterized in that: The drug is a stereotactic injection preparation for the brain.

10. The method for preparing a medicament for the prevention or treatment of diabetic peripheral neuropathy as described in claim 8, characterized in that, Includes the following steps: 1) Prepare expression plasmids containing the KMT2A shRNA sequence. Perform chemical transformation, amplification, extraction and purification on the expression plasmids containing the KMT2A shRNA sequence to obtain recombinant plasmids containing the KMT2A shRNA sequence. 2) Co-transfect 293T cells with the recombinant plasmid obtained in step 1) and the packaging plasmid to package the virus and collect the viral fluid; 3) Concentrate and purify the viral fluid to obtain a lentivirus containing the KMT2A gene; 4) Mix the lentivirus containing the KMT2A gene with a pharmaceutically acceptable vector.