Kluyveromyces marxianus engineering strain for recombinant expression of hydroxylated human III-type collagen and application of kluyveromyces marxianus engineering strain
By recombinantly expressing proline hydroxylase and human type III collagen genes in engineered strains of *Kluyveromyces martensii*, the problems of low expression levels and low hydroxylation efficiency in existing technologies have been solved, achieving efficient and safe collagen production suitable for beauty, cosmetics, and food additives.
Patent Information
- Application Number
- CN202511287343.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-10
- Publication Date
- 2026-01-27
AI Technical Summary
Existing technologies are insufficient for the efficient expression and hydroxylation of human type III collagen, resulting in low yields that cannot meet industrial demands, and also raise concerns about biosafety and immunogenicity.
Using engineered strains of Kluyveromyces martensii, KmTavC3S1 and KmTavC3S2 were constructed by recombinantly expressing proline hydroxylase and human type III collagen genes, achieving efficient secretion, expression, and hydroxylation of human type III collagen C3S1 and C3S2.
It achieved efficient expression and hydroxylation of human type III collagen, with yields of 4.0 g/L and 6.0 g/L, and purities of 87% and 93%, respectively, making it suitable for use in beauty, cosmetics, food additives and other fields.
Smart Images

Figure CN121406471A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to a recombinant strain of *Kluyveromyces martensii* expressing hydroxylated human type III collagen and its applications. Background Technology
[0002] Human type III collagen is mainly found in the skin, blood vessel walls, lungs, uterus, intestines, and other internal organs. It is a structural protein present in connective tissues and has a wide range of biological functions. Type III collagen has high elasticity, and its presence in the skin, blood vessel walls, and intestines helps these tissues maintain their shape and function. Due to its unique proline hydroxylation and excellent biocompatibility, type III collagen can be used in the preparation of wound dressings. [1-2] It participates in wound repair and helps restore the integrity of the wound. [3] Type III collagen can increase the elasticity and pressure resistance of blood vessels, preventing rupture and helping to prevent excessive stretching and damage to tissues, among other benefits. It plays a crucial role in maintaining the structural stability and functional integrity of various tissues in the body, especially those requiring elasticity and rapid repair. Therefore, human type III collagen has been widely used in biomedicine, tissue engineering, beauty and skincare, and food and health products, showing great potential in repair, regeneration, and anti-aging. [4-5] .
[0003] Traditional methods for producing collagen involve extracting it from animal tissues using acid, alkali, and enzymatic hydrolysis. Common sources include collagen-rich tissues such as pigskin, cowskin, and beef tendons. However, type III collagen extracted using these traditional methods loses some of its biological activity. Animal-derived collagen presents certain biosafety and immunogenicity issues, particularly in medical and pharmaceutical applications. Its safety risks are high in tissue-engineered products and pharmaceuticals. Furthermore, topical collagen requires proline hydroxylation to acquire bioactive GFO and GPO fragments that can contribute to wound repair in medicine. [6] Therefore, it is necessary to find a non-traditional way to obtain active type III collagen.
[0004] With the rapid development of synthetic biology technology, some research institutions at home and abroad have obtained recombinant collagen by recombining human collagen genes into chassis cells and then using high-density fermentation and purification methods. However, recombinant collagen technology typically has high barriers to entry, high production costs, and low expression yields, failing to meet the demands of industrial-scale production. Currently, there are various systems for expressing recombinant collagen, each with its own advantages. These include bacterial, yeast, mammalian, plant cell, and insect cell expression systems. Among these systems, the most economical and efficient mainstream production methods are the prokaryotic expression system using *E. coli* and the yeast expression system using *Pichia pastoris*. *E. coli*, as a prokaryotic expression system, has advantages such as rapid growth, clear genetic background, and fast protein production rate; however, as a prokaryote, its post-translational modification ability is relatively low. Existing reports indicate that the yield of recombinant type III collagen (Mr = 38 kDa) expressed in *E. coli* can reach 0.09 g / L, and collagen hydroxylation can be achieved through co-expression of collagen and hydroxylase. [7] After utilizing proline hydroxylase derived from Bacillus anthracis, the hydroxylation efficiency reached a maximum of 63.6%. Pichia pastoris, initially isolated from chestnut tree exudate in France, has become one of the most promising hosts for expressing heterologous proteins after years of research and modification. Highly efficient secretory expression of various heterologous proteins can be achieved using a methanol-induced strong promoter. Regarding recombinant type III collagen expression, existing studies have reported the expression of full-length human type III collagen (Mr = 90 kDa) without the N and C precursors in Pichia pastoris, achieving a yield of 4.68 g / L in a 30 L fermenter system. However, hydroxylation of the recombinant collagen was not achieved in this study. [8] Another study used the human type III collagen α1 chain encoding gene as a template to express recombinant collagen (Mr = 55 kDa) in Pichia pastoris cells, with an expression level of 3.81 g / L in a 12.5 L fermenter system. [9] .
[0005] The key to the effectiveness of recombinant collagen lies in two aspects: the proline hydroxylation modification of collagen and the presence of short peptides such as GKE, GRE, and GPO.
[10] On the other hand, it forms a procollagen fiber structure composed of three collagen proteins. Proline-hydroxylated collagen exhibits antioxidant and anti-inflammatory effects; the trimeric procollagen fibers, due to collagen's unique biocompatibility, can serve as biodegradable scaffolds and raw materials for wound dressings and other medical materials in biomedicine. Type III collagen is mainly used in beauty and medical fields. However, due to the low yield and hydroxylation requirement of recombinant collagen expression, it is difficult to meet the demands of industrial production. The *Kluyveromyces martensii* engineered strain and the method for preparing collagen using this strain provided by this invention allow for the hydroxylation modification of recombinant collagen C3S1 and C3S2, similar to the modification of natural collagen. The recombinant C3S1 and C3S2 show significant advantages in yield and quality, thus possessing good application value and prospects.
[0006] References:
[0007] [1]Sharma, S., Rai, VK, Narang, RK, & Markandeywar, TS (2022). Collagen-based formulations for wound healing: A literature review. Life Sciences, 290, 120096. https: / / doi.org / 10.1016 / j.lfs.2021.120096.
[0008] [2]Andonegi,M.,Heras,KL,Santos-vizcaíno,E.,Igartua,M.,Hernandez,RM,Caba,KDL,&Guerrero,P.(2020).Structure-properties relationship ofchitosan / collagen films with potential for biomedical applications.Carbohydrate Polymers,237,116159.https: / / doi.org / 10.1016 / j.carbpol.2020.116159.
[0009] [3]Konitsiotis,AD,Raynal,N.,Bihan,D.,Hohenester,E.,Farndale,RW,&Leitinger,B.(2008).Characterization of High Affinity Binding Motifs for theDiscoidin Domain Receptor DDR2in Collagen.Journal of Biological Chemistry,283(11),6861-6868.https: / / doi.org / 10.1074 / jbc.M709290200.
[0010] [4] Zhao, Z., Deng, J., & Fan, D. (2023). Biomaterials Science, 11(16), 5439-5461. https: / / doi.org / DOI:10.1039 / d3bm00724c.
[0011] [5] Fu Rongzhan, Fan Daidi, Yang Wanjuan, Chen Liang, Qu Ci, Yang Shulin & Xu Liming. (2022). Industrial development history and biomedical application prospects of recombinant collagen. Chinese Journal of Biotechnology (09), 3228-3242. https: / / doi:10.13345 / j.cjb.220061.
[0012] [6] Lisman, T., Raynal, N., Groeneveld, D., Maddox, B, Peachey, AR, Huizinga, EG, De groot, PG, & Farndale, RW (2006). A single high-affinity binding site for Willebrand factor in collagen III, identified using synthetic triple-helical Peptides.Blood,108(12),3753-3756.https: / / doi.org / 10.1182 / blood-2006-03-011965.
[0013] [7]Rutschmann,C.,Baumann,S.,Cabalzar,J.,Luther,KB,&Hennet,T.(2013).Recombinant expression of hydroxylated human collagen in Escherichiacoli.Applied Microbiology and Biotechnology, 98(10), 4445-4455. https: / / doi.org / 10.1007 / s00253-013-5447-z.
[0014] [8]Li,L.,Fan,D.,Ma,X.,Deng,J.,&He,J.(2015).High-level secretoryexpression and purification of unhydroxylated human collagenα1(III)chain inPichia pastoris GS115.Biotechnology and Applied Biochemistry, 62(4), 467-475. https: / / doi.org / 10.1002 / bab.1297.
[0015] [9] Liu Bin. High-density fermentation expression of recombinant human collagen by Pichia pastoris genetically engineered strain [D]. Nanjing University of Science and Technology, 2012.
[0016]
[10] Hua, C., Zhu, Y., Xu, W., Ye, S., Zhang, R., Lu, L., & Jiang, S. (2019). Characterization by high-resolution crystal structure analysis of a triple-helix region of human collagen type III with potent cell adhesionactivity. Biochem Bioph Res Comm.,508(4),1018-1023. https: / / doi.org / 10.1016 / j.bbrc.2018.12.018. Summary of the Invention
[0017] The purpose of this invention is to provide a recombinant *Kluyveromyces martensii* strain expressing hydroxylated human type III collagen and its applications.
[0018] The *Kluyveromyces martensii* strain recombinantly expressing hydroxylated human type III collagen provided by this invention is obtained by recombinantly expressing proline hydroxylase and the human type III collagen gene in *Kluyveromyces martensii*; wherein:
[0019] The human type III collagen is C3S1 or C3S2;
[0020] The gene sequence encoding human type III collagen C3S1 is shown in SEQ ID NO.1; the amino acid sequence is shown in SEQ ID NO.2.
[0021] The gene sequence encoding human type III collagen C3S2 is shown in SEQ ID NO.3; the amino acid sequence is shown in SEQ ID NO.4.
[0022] The Kluyveromyces martensii engineered strain is derived from the Kluyveromyces martensii FIM1 strain by knocking out the uracil synthase gene URA3 in its genome, which is obtained as FIM1Δura3 strain. The Kluyveromyces martensii FIM1 strain is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 10621.
[0023] The cells of Kluyveromyces martensii contain recombinantly expressed proline hydroxylase; the recombinant expression can be performed by cloning the proline hydroxylase encoding gene into the Kluyveromyces martensii expression vector LHZ-412, or by integrating the expression unit containing the proline hydroxylase encoding gene into the Kluyveromyces martensii genome.
[0024] Furthermore:
[0025] The proline hydroxylase may be vP4H, hP4HA, or hP4HB, and their coding sequences are shown in SEQ ID NO.5, SEQ ID NO.7, and SEQ ID NO.9, respectively.
[0026] The recombinant human type III collagen C3S1 expressed therein is a part of human type III collagen, and the proline of the expressed C3S1 collagen is hydroxylated.
[0027] The recombinant human type III collagen C3S1 is obtained by cloning the coding gene (SEQ ID NO.1) of type III collagen C3S1 onto the 132-C29T secretory expression vector (SEQ ID NO.12), then transforming it into the Kluyveromyces martensii engineered strain containing proline hydroxylase, and obtaining it in the supernatant of the fermentation broth through liquid fermentation.
[0028] The recombinant human type III collagen C3S2 expressed therein is a part of human type III collagen, and the proline of the expressed C3S2 collagen is hydroxylated.
[0029] The recombinant human type III collagen C3S2 is obtained by cloning the coding gene (SEQ ID NO.3) of type III collagen C3S2 into the Kluyveromyces martensii secretory expression vector 132-C29T, then transforming the recombinant Kluyveromyces martensii engineered strain expressing proline hydroxylase, and obtaining it in the supernatant of the fermentation broth through liquid fermentation.
[0030] The specific steps for constructing the recombinant Kluyveromyces marxoiris engineered strain expressing hydroxylated human type III collagen provided by this invention are as follows:
[0031] (1) Based on the structure of human type III collagen, collagen truncated genes C3S1 and C3S2 in the proline-rich region were designed; then the codons of proline hydroxylase genes and truncated collagen genes from different species were optimized and synthesized.
[0032] (2) The sequence-optimized proline hydroxylase was linked with the ADH1 promoter sequence and the ADH1 terminator sequence of Saccharomyces cerevisiae to construct a proline hydroxylase expression cassette. Then, it was expressed in Kluyveromyces Marcius strain FIM-1Δura3 in chromosome-integrated expression or in centromere free plasmid pLHZ-412 to construct Kluyveromyces Marcius strain FIM-1Δura3 / vP4H, FIM-1Δura3 / hP4H or FIM-1Δura3 / hP4HB that express proline hydroxylase in chromosome-integrated expression.
[0033] (3) The synthesized C3S1 or C3S2 gene was constructed into the Kluyveromyces martensii secretory expression vector pUKD132-C29T to obtain the recombinant secretory collagen expression vector pUKD132-C29T / C3S1 or pUKD132-C29T / C3S2.
[0034] (4) The recombinant expression vector from step (3) was introduced into the Kluyveromyces martensii FIM-1Δura3 / vP4H, FIM-1Δura3 / hP4H or FIM-1Δura3 / hP4HB constructed in step 2, respectively. After screening, Kluyveromyces martensii engineered strains that simultaneously expressed proline hydroxylase and type III collagen C3S1 or C3S2 were obtained and named KmTavC3S1 and KmTavC3S2, respectively.
[0035] Furthermore:
[0036] The collagen truncated genes C3S1 and C3S2 in the proline-rich region mentioned in step (1) contain amino acid residues at positions 154-321 and 661-783 rich in the three sequences GPO, GFO, GEK, and GER, which are beneficial for promoting wound repair. The collagen truncated variant encoded by these residues is C3S1(gly 661 -pro 783 ) and C3S2 (gly 154 -pro 321 This region has a high proline content and a high level of hydroxylation.
[0037] The proline hydroxylase gene mentioned in step (1) can be one of the vP4H gene (GenBank: YP_010777505.1) from Acanthamoeba polyphagamimivirus (APMV) or the human-derived hP4H (hP4HA (GenBank: NM_001017962.3) and hP4HB (GenBank: NM_000918) genes.
[0038] Preferably, the proline hydroxylase gene is the vP4H gene derived from Acanthamoeba polyphaga mimivirus (APMV).
[0039] The codon optimization described in step (1) involves using the Codon Adaptation Index (CAI) and Minimum Free Energy (MFE) as dual indicators to optimize the sequences of type III collagen and proline hydroxylase genes. The optimized C3S1 and C3S2 genes have the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.3, and the amino acid sequences shown in SEQ ID NO.2 and SEQ ID NO.4, respectively. The optimized vP4H, hP4H, and hP4HB genes have the nucleotide sequences shown in SEQ ID NO.5, SEQ ID NO.7, and SEQ ID NO.9, respectively, and the amino acid sequences shown in SEQ ID NO.6, SEQ ID NO.8, and SEQ ID NO.10, respectively.
[0040] The Kluyveromyces martensii strain mentioned in step (2) is the FIM1Δura3 auxotrophic strain. It was constructed by knocking out the uracil synthase gene URA3 on the genome of the Kluyveromyces martensii FIM1 strain (accession number: CGMCCNo.10621) preserved at the China General Microbiological Culture Collection Center.
[0041] The *Kluyveromyces martensii* expression vector pLHZ-412 described in step (2) has the nucleotide sequence shown in SEQ ID NO. 11. The vector contains a hygromycin resistance selection marker, a *Kluyveromyces martensii* centromere sequence, a *Saccharomyces cerevisiae* ADH1 Promoter, and an ADH1 Terminator sequence.
[0042] The subsequent chromosome integration expression described in step (2) involves integrating the proline hydroxylase expression cassette into the Kluyveromyces maculae genome.
[0043] The centromere vector expression described in step (2) involves cloning the proline hydroxylase expression cassette into the expression vector pLHZ-412 and then transforming it into the Kluyveromyces martensii strain FIM1Δura3.
[0044] Preferably, the proline hydroxylase vP4H expression cassette of the bacteriophage virus is cloned into the expression vector pLHZ-412 and then transformed into the Kluyveromyces martensii strain FIM1Δura3.
[0045] The *Kluyveromyces martensii* expression vector pUKD132-C29T described in step (3) has the nucleotide sequence shown in SEQ ID NO.12. The vector contains a URA3 selection marker gene, a pKD autonomous replication region, an inulinase promoter, a signal, and an inulinase terminator. The signal can be an inulinase signal derived from *Kluyveromyces martensii* itself, or an α-factor signal from *Saccharomyces cerevisiae*. Using the pUKD132-C29T vector, the recombinantly expressed type III collagen C3S1 and C3S2 are secreted into the supernatant.
[0046] The screening process described in step (4) consists of the following steps: First, auxotrophic screening is used to obtain positive clones, specifically yeast transformants grown on a medium without uracil, which indicate that the recombinant expression vector pUKD132-C29T / C3S1 or C3S2 carrying the URA3 selection marker gene has been transformed into the host strain FIM1Δura3; Second, the yeast positive clones are boiled and PCR is performed to identify the gene C3S1 or C3S2; Third, positive clones with higher expression levels of type III collagen secretion are screened.
[0047] The two engineered strains of Kluyveromyces martensii (including KmTavC3S1 and KmTavC3S2) prepared by this invention can be used for recombinant expression of human type III collagen C3S1 or C3S2. That is, strain KmTavC3S1 is used for recombinant expression of human type III collagen C3S1, and KmTavC3S2 is used for recombinant expression of human type III collagen C3S2. The human type III collagen C3S1 or C3S2 recombinantly expressed in Kluyveromyces martensii can be hydroxylated, similar to the hydroxylation of natural type III collagen.
[0048] The specific steps are as follows:
[0049] (1) The two Kluyveromyces engineered strains KmTavC3S1 and KmTavC3S2 were fermented at high density in a fermenter for 2-5 days, and the supernatant fermentation broth containing collagen III C3S1 or C3S2 was obtained by centrifugation.
[0050] (2) The fermentation broth in step 1 is separated and purified by ion exchange column to obtain III collagen C3S1 or C3S2.
[0051] Furthermore:
[0052] In step (1), the high-density fermentation is carried out in a 5L fermenter with aeration and stirring. Specifically, KmTavC3S1 or KmTavC3S2 is inoculated into YPD medium and cultured at 30℃ and 220rpm for 16-24 hours, and then inoculated into a 1.5L fermentation medium for high-density fermentation. Glucose is added during the fermentation process, and ammonia is used to control the pH of the fermentation broth at 6.5-6.0. The fermentation time is 48-96 hours.
[0053] The fermentation medium described above contains: 0.5-3% glucose, 0.5-2% corn steep liquor, 0.5-2% yeast extract, 0.5-1.5% ammonium sulfate, 0.1-1% magnesium sulfate, 0.5-2% potassium dihydrogen phosphate, 0.05-0.2% calcium chloride, 1-5 mg / L zinc sulfate, 0.1-0.5 mg / L manganese chloride, 0.1-0.5 mg / L cobalt chloride, 1-5 mg / L ferrous sulfate, 0 Sodium borate 0.1-1 mg / L, sodium iodide 0.01-0.1 mg / L, biotin 0.1-0.5 μg / L, inositol 10-100 μg / L, thiamine 0.5-2 μg / L, pyridoxine 0.5-2 μg / L, para-aminobenzoic acid 10-100 μg / L, riboflavin 1-20 μg / L, calcium pantothenate 0.05-0.2 μg / L, folic acid 0.05-0.2 μg / L.
[0054] In step (2), the ion exchange chromatography separation and purification of collagen C3S1 or C3S2 specifically involves separating and purifying collagen C3S1 using a complex ligand medium MMC chromatography column and separating and purifying collagen C3S2 using a strongly positive SP medium ion exchange column.
[0055] The equilibration buffer used for ion exchange chromatography was (50 mM NaAc-HAc, pH 4.0), and the eluent was (50 mM NaAc-HAc, 1 M NaCl, pH 4.0).
[0056] The *Kluyveromyces martensii* strain provided by this invention can express proline hydroxylase in yeast cells and simultaneously secrete human type III collagen C3S1 or C3S2. The secretory expression level of recombinant human type III collagen C3S1 reaches 4.0 g / L, and the secretory expression level of recombinant type III collagen C3S2 reaches 6.0 g / L. Like natural type III collagen, the secreted C3S1 or C3S2 can be hydroxylated. After one-step ion exchange chromatography purification, the purity of type III collagen C3S1 reaches over 87%, and the purity of type III collagen C3S2 reaches over 93%.
[0057] The recombinant hydroxylated type III collagen (C3S1 and C3S2) obtained by this invention can be used in the fields of beauty, cosmetics, and food additives. For example, it can be used to prepare cosmetic formulations, daily chemical product formulations, medical devices, or biopharmaceutical formulations, etc. Attached Figure Description
[0058] Figure 1 This is a schematic diagram of the design of human type III collagen C3S1 and C3S2, along with hydroxylation sites from the database.
[0059] Figure 2 RNA secondary structures of optimized sequences of human type III collagen C3S1 and C3S2.
[0060] Figure 3 Western blot identification of recombinant intracellular expression of proline hydroxylase in *Kluyveromyces martensii*. Four lanes represent four distinct positive clones.
[0061] Figure 4 C3S1 and C3S2 were detected and identified by Western blot during shake-flask fermentation in *Kluyveromyces martensii*. In the figure, (a) and (b) show the protein bands of KMTaC3S1 and KMTaC3S2 in the supernatant of the fermentation broth after 72 h of YG shake-flask fermentation, analyzed by SDS-PAGE; (c) and (d) show the Western blot identification of the protein bands in (a) and (b), respectively.
[0062] Figure 5 SDS-Page analysis was performed on the secretory expression of C3S1 and C3S2 in shake flasks of engineered *Kluyveromyces martensii* strains containing hydroxylase.
[0063] Figure 6 The secretion and expression of C3S1 and C3S2 in a 5L fermenter were analyzed using SDS-PAGE. 20 μL of fermentation broth supernatant was used for SDS-PAGE analysis. In the figure, (a) and (b) show the expression levels of C3S1 and C3S2 at different fermentation times, respectively.
[0064] Figure 7 This study analyzed the secretory expression of C3S1 in engineered Kluyveromyces martensii strains. The figures show: (a) serially diluted samples of the standard protein β-lactoglobulin analyzed by SDS-PAGE, and samples diluted 5-fold and 10-fold from the supernatant of KMTavC3S1 fermentation broth after 60 and 72 hours of fermentation; (b) SDS-PAGE gel images converted to 8-bit grayscale images; and (c) a standard curve plotted based on the grayscale values of the protein standards.
[0065] Figure 8 This study analyzed the secretory expression of C3S2 in engineered Kluyveromyces martensii strains. The figures show: (a) serially diluted samples of the standard protein β-lactoglobulin analyzed by SDS-PAGE, and samples diluted 5-fold and 10-fold from the supernatant of KMTavC3S1 fermentation broth after 60 and 72 hours of fermentation; (b) SDS-PAGE gel images converted to 8-bit grayscale images; and (c) a standard curve plotted based on the grayscale values of the protein standards.
[0066] Figure 9 This image shows the results of SDS-PAGE electrophoresis detection of C3S1 and C3S2 purified by ion exchange chromatography. TavC3S1-FS is a protein sample prepared from the supernatant obtained from high-density fermentation, and TavC3S1-EB is the purification result after purification using an MMC column. TavC3S2-FS is a protein sample prepared from the supernatant obtained from high-density fermentation, and TavC3S2-EB is the purification result after purification using an SP column. The loading volume for both samples was 20 μL.
[0067] Figure 10 Mass spectrometry detection of total ion chromatograms for secretory expression of C3S1(a) and C3S2(b) hydroxylation modifications (raw data).
[0068] Figure 11This is a schematic diagram of the hydroxylation sites of recombinant collagen peptides obtained by database comparison of raw total ion chromatogram data. Blue represents hydroxylated proline sites, and the boxes contain the GFO, GEK, GER, and GPO tripeptide structures. The "O" in GFO and GPO refers to the hydroxylated proline (P).
[0069] Figure 12 This is a schematic diagram comparing the hydroxylation modification sites of collagen peptides recombinantly expressed in *Kluyveromyces martensii* with the corresponding hydroxylation modification regions of human collagen fragments in the database.
[0070] Figure 13 To determine the cytotoxic effects of C3S1, C3S2, and commercially available recombinant collagen (Pp-col3) using HaCat cells; a. relative cell viability after 1 h of CCK-8 treatment; b. relative cell viability after 2 h of CCK-8 treatment.
[0071] Figure 14 Scratch assays were performed on HaCat cells, with images taken at the same location every 20 hours. The yellow box indicates the scratch area drawn using ImageJ software.
[0072] Figure 15 The results of the HaCat cell scratch assay are presented after data analysis. Detailed Implementation
[0073] The present invention will be further illustrated below with reference to specific embodiments and accompanying drawings. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0074] Example 1: Design and codon optimization of human type III collagen
[0075] Based on the amino acid sequence of the α1 chain of human type III collagen (NM_000090.4), this invention designed a full-length human type III collagen containing 1466 amino acid residues. The regions of amino acid residues 154-321 and 661-783 are rich in GPO, GFO, GEK, and GER sequences, which are beneficial for promoting wound repair. Furthermore, these regions have high proline content and high hydroxylation levels. In addition, full-length collagen is difficult to recombinantly secrete. This invention designed two truncated variants, C3S1(gly 661 -pro 783 ) and C3S2 (gly 154 -pro 321 ()( Figure 1 The amino acid sequences are shown in SEQ ID NO.2 and SEQ ID NO.4.
[0076] We used both Codon Adaptation Index (CAI) and Minimum Free Energy (MFE) as dual indicators to optimize the codons of type III collagen C3S1 and C3S2. To determine the optimization standard for CAI, we statistically analyzed the CAI values of proteins successfully expressed in *Kluyveromyces martensii*. The results showed a minimum CAI value of 0.63, and 90% of the sequences had CAI values above 0.70. Therefore, a CAI value greater than 0.70 was adopted as the optimization standard for CAI. According to the literature, the optimization standard for MFE is "the lower the MFE value, the more stable the mRNA structure."
[0077] Codon optimization of human type III collagen C3S1 and C3S2 was performed using a dual-index optimization algorithm based on CAI and MFE, yielding five optimized sequences for each. The CAI of these optimized sequences all reached above 0.8, and the maximum difference in MFE values among the optimized sequences was within 30 kcal / mol, indicating relatively small differences in MFE values (see Tables 1 and 2). Further considering the ΔG values of the CDS region RNA secondary structure, the ΔG value of the 5'UTR region RNA secondary structure, and conservation, one coding sequence was selected from each of the optimized codon sequences of human type III collagen C3S1 and C3S2, specifically shown in SEQ ID NO.1 (C3S1-seq5) and SEQ ID NO.3 (C3S2-seq5), respectively. The selected codon-preferred sequences from *Kluyveromyces martensii* were sent to a gene synthesis company for whole-genome synthesis.
[0078] Table 1: Optimized sequence characteristics of human type III collagen C3S1
[0079] C3S1-Seq1 C3S1-Seq2 C3S1-Seq3 C3S1-Seq4 C3S1-Seq5 CAI 0.89 0.89 0.89 0.89 0.89 Full-length sequence ΔG (kcal / mol) -210.30 -215.10 -213.20 -220.50 -220.80 ΔG (kcal / mol) in the 5'UTR region -66.20 -77.90 -77.00 -86.60 -79.40 CDS region ΔG (kcal / mol) -144.10 -137.20 -136.20 -133.90 -141.40 GC content (%) 60.53% 60.53% 60.53% 60.53% 60.27%
[0080] Table 2: Optimized sequence characteristics of human type III collagen C3S2
[0081] C3S2-Seq1 C3S2-Seq2 C3S2-Seq3 C3S2-Seq4 C3S2-Seq5 CAI 0.89 0.89 0.89 0.89 0.87 Full-length sequence ΔG (kcal / mol) -270.50 -257.70 -284.20 -270.20 -275.10 ΔG (kcal / mol) in the 5'UTR region -105.30 -76.10 -84.60 -86.90 -75.70 CDS region ΔG (kcal / mol) -165.20 -181.60 -199.60 -183.30 -199.40 GC content (%) 59.02% 59.02% 59.02% 59.02% 59.22% .
[0082] Example 2: Recombinant expression of proline hydroxylase in Kluyveromyces martensii
[0083] Based on the NCBI proline hydroxylase sequences vP4H (YP_010777505.1), hP4H (hP4HA (NM_001017962.3), and hP4HB (NM_000918), codon optimization was performed on *Kluyveromyces martensii* (using the same selection method as C3S1 and C3S2). The synthesized genes were then sent to a gene synthesis company for whole-genome synthesis. The synthesized genes contain a 6hi sequence at the 3' end. The codon-optimized sequences of the proline hydroxylase encoding genes vP4H, hP4HA1, and hP4HB are shown in SEQ ID NO. 5, SEQ ID NO. 7, and SEQ ID NO. 9.
[0084] The proline hydroxylase gene vP4H was cloned into the intracellular expression vector LHZ412 of *Kluyveromyces martensii* and transformed into *Kluyveromyces martensii* FIM1Δura3 cells. Transformants were identified by PCR, confirming the formation of positive clones. The positive clones were cultured in shake flasks at 220 rpm for 72 hours, and yeast cells were harvested. After cell disruption, Western blotting revealed a distinct band at 27.9 kDa, consistent with the predicted molecular weight of vP4H. This indicates recombinant expression of vP4H in *Kluyveromyces martensii* cells. Figure 3 ).
[0085] Another method for recombinant expression of proline hydroxylase in *Kluyveromyces martensii* is to link vP4H with the ADH1 promoter and ADH1 terminator, then clone it into the yeast chromosome 302 locus using CRISPR. Positive clones were obtained by PCR, and after shake-flask fermentation and Western blotting, strains capable of recombinantly expressing proline hydroxylase were obtained. This strain was named Tav.
[0086] in:
[0087] The bidirectional primers for identifying vP4H are:
[0088] JP-Geno-302-F: GATCTAGACCTCGATTAAGCAACTGACCTGAC;
[0089] JP-vP4H-R:ACGAATGGCTTGTTATATGGGTCATC;
[0090] The amplification conditions for PCR are:
[0091] Step 1: 94℃ for 5 minutes;
[0092] Step 2: 94℃ for 30s, 59℃ for 30s, 72℃ for 2min, repeat 34 cycles;
[0093] Step 3: 72℃ for 5 minutes;
[0094] Step 4: Keep at 20℃ until ready to be taken out.
[0095] To identify recombinant expression of vP4H in *Kluyveromyces martensii*, Western blotting was performed. The primary antibody was Proteintech mouse anti-His antibody (1:10000), and the secondary antibody was KPL goat anti-mouse antibody (1:5000), which was incubated for 3 hours. The cells were then washed three times with TBST for 15 minutes each time, and exposed to Western blotting for 3 minutes.
[0096] The solid medium used to culture Kluyveromyces martensii was YPD solid medium (Glucose 20 g / L; Polypeptone 20 g / L; Yeast extract 10 g / L); 0.25% hygromycin was added to YPD to screen for single clones successfully transformed with the vP4H gene.
[0097] The liquid medium used for fermenting Kluyveromyces martensii was YG liquid medium (Yeast extract 20 g / L; Glucose 40 g / L). 50 ml of YG liquid medium was added to a 150 ml Erlenmeyer flask, and the mixture was incubated at 220 rpm for 72 h in a constant temperature shaker at 30 °C to complete the shake flask fermentation. The fermentation broth was centrifuged at 8000 rpm, and the cells were collected, broken up, and the expression of proline hydroxylase was identified.
[0098] The procedure for identifying hP4HAB is the same as that for identifying vP4H.
[0099] Example 3: Construction of a Kluyveromyces martensii engineered strain that secretes and expresses human type III collagen C3S1.
[0100] The human type III collagen C3S1 encoding gene was cloned into the *Kluyveromyces martensii* secretory expression vector 132-C29T. The vector contained an inulinase promoter, secretion signal, terminator, autonomous replication region of *Kluyveromyces martensii*, and the URA3 selection marker. The recombinant vector containing the C3S1 encoding gene was transformed into the *Kluyveromyces martensii* FIM1Δura3 auxotrophic strain. Positive transformants were obtained through auxotrophic selection. Twelve well-growing positive transformants were selected and confirmed as positive transformants by boil-in PCR. These were then subjected to YG shake-flask fermentation at 30°C for 72 h at 220 rpm. After fermentation, the fermentation broth was centrifuged, and the supernatant was collected. 100 μL of fermentation broth was mixed with 5x SDS-Loading Buffer, boiled, and then used as a protein sample. SDS-PAGE analysis revealed a clear expression band at 14.5 kDa, consistent with the predicted molecular weight of C3S1. This confirmed that human type III collagen C3S1 can be secreted and expressed in *Kluyveromyces martensii*. Figure 4 ).
[0101] The recombinant vector 132-C29T containing the C3S1 encoding gene was transformed into the engineered strain vP4H of *Kluyveromyces martensii* expressing proline hydroxylase. Positive transformants were identified by boil-cell PCR. Following this, shake-flask liquid fermentation was performed to identify the secretory expression of C3S1. The results showed that the secretory expression of type III collagen C3S1 was obtained in the proline hydroxylase-expressing strain. Figure 5 The strain was named KMTavC3S1.
[0102] The bidirectional primers used to identify C3S1 are:
[0103] F_C3S1:ttacaagagagacggtgaccccgggggtccaccaggtttggcc;
[0104] R_C3S1: cggccttaagcggccgcttaatggtgatggtgatgatgtggtggaccagtttcacctct;
[0105] The amplification conditions for PCR are:
[0106] Step 1: 94℃ for 5 minutes;
[0107] Step 2: 94℃ for 30s, 57℃ for 30s, 72℃ for 1min, repeat 34 cycles;
[0108] Step 3: 72℃ for 5 minutes;
[0109] Step 4: Keep at 20℃ until ready to be taken out.
[0110] The concentration of agarose gel was 1%; the concentration of SDS-PAGE gel was 15%.
[0111] Example 4: Construction of a Kluyveromyces martensii engineered strain that secretes and expresses human type III collagen C3S2.
[0112] Following the same procedure as in Example 3, the first step was to determine whether human type III collagen C3S2 could be secreted and expressed in *Kluyveromyces martensii*. The gene encoding human type III collagen C3S2 was cloned into the *Kluyveromyces martensii* secretory expression vector 132-C29T, transformed into the *Kluyveromyces martensii* FIMΔura3 auxotrophic strain, and positive transformants were screened for auxotrophic transformation. After identification by boil-cell PCR, YG shake-flask fermentation and SDS-PAGE analysis of the fermentation supernatant revealed a clear expression band at the 22 kDa position, consistent with the predicted molecular weight of C3S2, confirming that human type III collagen C3S2 can be secreted and expressed in *Kluyveromyces martensii*. Figure 4 ).
[0113] Subsequently, the recombinant vector 132-C29T containing the C3S2 encoding gene was transformed into the engineered strain Tav of *Kluyveromyces martensii* expressing proline hydroxylase. Identification was performed by boil-cook PCR, YG shake-flask liquid fermentation, and SDS-PAGE analysis of the fermentation supernatant. The results showed that the secretion of type III collagen C3S2 was achieved in the proline hydroxylase-expressing strain. Figure 5 The strain was named KMTavC3S2.
[0114] The bidirectional primers used to identify C3S2 are:
[0115] F_C3S2:ttacaagagagacggtgaccccgggggtccacctggccctcc;
[0116] R_C3S2: cggccttaagcggccgcttaatggtgatggtgatgatgtgggaaaccagcggtgc;
[0117] The amplification conditions for PCR (Takara-Taq enzyme) are as follows:
[0118] Step 1: 94℃ for 5 minutes;
[0119] Step 2: 94℃ for 30s, 57℃ for 30s, 72℃ for 1min, repeat 34 cycles;
[0120] Step 3: 72℃ for 5 minutes;
[0121] Step 4: Keep at 20℃ until ready to be taken out.
[0122] The concentration of agarose gel was 1%; the concentration of SDS-PAGE gel was 15%.
[0123] Example 5: High-density fermentation of engineered *Kluyveromyces martensii* strain and expression of human collagen III.
[0124] Kluyveromyces martensii engineered strains KMTavC3S1 and KMTavC3S1, capable of secreting large amounts of C3S1 or C3S2, were inoculated into shake flasks with seed culture, and then transferred to 5L fermenters for high-density fermentation. The initial OD600 was 5. Fermentation was carried out with agitation and ventilation. Glucose was continuously added during fermentation, and ammonia was automatically added to control the pH at 6.0-6.5. Glucose addition was stopped one hour before fermentation was to be stopped. Fermentation was stopped after 3-4 days, and the supernatant was collected by filtering the cells. SDS-PAGE analysis was performed on the secreted C3S1 or C3S2 expression in the fermentation supernatant at different time points. Figure 6 Using grayscale scanning, the yield of C3S1 or C3S2 can be quantified. Figure 7 , Figure 8 ).
[0125] in:
[0126] The formula for the shake-flask seed culture is as follows: 150 ml of seed culture contains 20 g / L glucose, 10 g / L yeast extract, and 20 g / L polypeptone. The seed culture conditions are 30℃, 220 rpm, and incubation for 14 hours until the OD600 reaches 10.
[0127] The fermenter substrate consisted of: 1.5L water, 2% glucose, 2% corn steep liquor, 1% yeast extract, 1% ammonium sulfate, 0.5% magnesium sulfate, 1% potassium dihydrogen phosphate, 0.1% calcium chloride, 2mg / L zinc sulfate, 0.3mg / L manganese chloride, 0.3mg / L cobalt chloride, 3mg / L ferrous sulfate, 0.5mg / L sodium borate, 0.05mg / L sodium iodide, 0.3μg / L biotin, 50μg / L inositol, 1μg / L thiamine, 1μg / L pyridoxine, 50μg / L para-aminobenzoic acid, 10μg / L riboflavin, 0.01μg / L calcium pantothenate, and 0.1μg / L folic acid. The added glucose concentration was 1300g glucose + 1100ml water.
[0128] Feeding control: The feeding rate is 5 ml / h when the rotation speed reaches 400 rpm; 10 ml / h when the rotation speed reaches 500 rpm; 15 ml / h when the rotation speed reaches 600 rpm; 20 ml / h when the rotation speed reaches 700 rpm; 25 ml / h when the rotation speed reaches 800 rpm; and 30 ml / h when the rotation speed reaches 850 rpm.
[0129] Quantitative protein yield analysis using grayscale scanning: SDS-PAGE gel images were converted to 8-bit grayscale images using GenoSens Analysis image analysis software. After color inversion, grayscale analysis was performed, and the grayscale values were recorded. A quantitative standard curve was constructed using β-lactoglobulin standards with similar molecular weights. The sample grayscale values were substituted into the standard curve to calculate the protein yield. The results showed that the secretory expression levels of recombinant human type III collagen C3S1 and C3S2 reached 4.0 g / L and 6.0 g / L, respectively. Figure 7 and 8 ).
[0130] Example 6: Isolation and purification of recombinant human III collagen
[0131] The supernatant from high-density fermentation of *Kluyveromyces martensii* in a fermenter was purified using ion exchange chromatography. Four ion exchange media for ligands DEAE, CM, SP, and Q, and a composite ligand media MMC were tested. The MMC media used is a multimode cation exchanger, exhibiting different selectivity compared to traditional ion exchangers. It possesses high dynamic binding capacity under high conductivity. Test results showed that the composite ligand medium Smac MMC chromatography column was most effective for separating and purifying collagen C3S1, while the strongly positive ion exchange column Smac SP was more effective for collagen C3S2.
[0132] Specifically, the purification process of collagen C3S1 includes the following steps:
[0133] (1) The supernatant of the fermentation broth of the engineered strain of Kluyveromyces martensii expressing C3S1 was centrifuged at 10,000 rpm and 4℃ for 15 min. The clarified supernatant was diluted 4 times with Buffer A (50 mM NaAC-HAC, pH 4.0) and then filtered through a 0.45 μm filter membrane.
[0134] (2) Equilibrate the pre-packed Smac MMC column with Buffer A buffer to equilibrate 5 column volumes (CV) at a flow rate of 1 ml / min.
[0135] (3) The collagen C3S1 sample clarified by filtration was loaded onto a pre-packed Smac MMC column at a flow rate of 1 ml / min and a loading rate of 13 CV.
[0136] (4) After loading the sample, rebalance with Buffer A buffer for 5CV at a flow rate of 1ml / min until the baseline is level.
[0137] (5) Elute collagen C3S1 with 50% Buffer B buffer (50mM NaAC-HAC, 1M NaCl, pH4.0) at a volume of 4-5CV and a flow rate of 1ml / min.
[0138] Specifically, the purification process of collagen C3S2 includes the following steps:
[0139] (1) The supernatant of the fermentation broth of the engineered strain of Kluyveromyces martensii expressing C3S2 was centrifuged at 10,000 rpm and 4℃ for 15 min. The clarified supernatant was diluted 4 times with Buffer A (50 mM NaAC-HAC, pH 4.0) and then filtered through a 0.45 μm filter membrane.
[0140] (2) Equilibrate the Smac SP pre-packed column with Buffer A buffer to equilibrate 5 column volumes (CV) at a flow rate of 1 ml / min.
[0141] (3) The collagen C3S2 sample clarified by filtration was loaded onto a pre-packed Smac MMC column at a flow rate of 1 ml / min and a loading rate of 13 CV.
[0142] (4) After loading the sample, rebalance with Buffer A buffer for 5CV at a flow rate of 1ml / min until the baseline is level.
[0143] (5) Elute collagen C3S1 with 50% Buffer B buffer (50mM NaAc-HAc, 1M NaCl, pH4.0) at a volume of 4-5CV and a flow rate of 1ml / min.
[0144] SDS-PAGE analysis showed that Smac MMC and Smac SP media ion exchange chromatography could effectively separate and purify collagen C3S1 and C3S2 from the fermentation supernatant, respectively. Figure 9 Furthermore, the purity of collagen C3S1 and C3S2 purified by ion exchange chromatography was detected by high performance liquid chromatography, and the results showed that their purities reached over 87% and 93%, respectively.
[0145] Example 7: Hydroxyl modification analysis of collagen truncated molecules C3S1 and C3S2
[0146] The purified C3S1 and C3S2 were sent to Beijing Baitai Biotechnology Co., Ltd. for multi-hydroxylation detection, and the total ion chromatogram was obtained. Figure 10 Database comparative analysis revealed hydroxylation modifications at the proline sites of C3S1 and C3S2, similar to those found in natural human collagen III, and the presence of a triple structure of GFO, GEK, GER, and GPO that promotes wound healing. Figure 11 The obtained recombinant collagen modification results were compared and analyzed with the corresponding human collagen fragment regions in the database. Figure 12 It can be seen that the hydroxylation efficiency of recombinant collagen C3S1 is 100% of that of natural collagen, and the hydroxylation efficiency of recombinant collagen C3S2 is 91.6% of that of natural collagen. Furthermore, the hydroxylation sites of the two proteins have a similarity of more than 50%.
[0147] Example 8: Comparison of cell proliferation activity between collagen C3S1 and C3S2 and recombinant Pichia pastoris Col3 (Pp-col3).
[0148] Purified C3S1 and C3S2 were desalted by ultrafiltration and then lyophilized under vacuum at low temperature. The lyophilized C3S1 and C3S2 were dissolved in DMEM liquid medium for culturing HaCat cells. HaCat cells were cultured in 96-well plates until 70% confluence. The medium was then discarded, and 100 μL of DMEM liquid medium containing different concentrations of C3S1, C3S2, and recombinant Pichia pastoris collagen Col3 (Pp-col3) was added. The concentrations were set at 0.00 mg / mL, 0.01 mg / mL, 0.03 mg / mL, 0.05 mg / mL, 0.1 mg / mL, and 0.3 mg / mL. After adding the medium, 10 μL of CCk-8 solution was added, and the absorbance at 450 nm was measured after 0 h, 1 h, and 2 h. The results showed that the expressed collagen had no significant toxic effect on cells, and C3S2 at a concentration of 0.05 mg / mL significantly promoted cell proliferation. When collagen Col3, recombinantly expressed in Pichia pastoris, is supplemented with collagen C3S2 at a concentration of 0.01-0.3 mg / ml, the cell proliferation-promoting effect is significantly enhanced. This indicates that hydroxylated collagen is crucial for its cell proliferation activity.
[0149] We then conducted a scratch assay to verify cell proliferation activity. HaCat cells were cultured in 6-well plates to 95%-99% confluence. Straight scratches were then made using a 10µL pipette tip, and cell culture medium containing different concentrations of C3S2 was added, with final concentrations of 0.00 mg / ml, 0.01 mg / ml, 0.05 mg / ml, 0.1 mg / ml, 0.5 mg / ml, and 1.0 mg / ml. Cell positions were recorded by photographing the same location every 20 hours, and migration effects were analyzed using ImageJ software. The results demonstrated that C3S2 at a concentration of 0.05 mg / ml indeed promoted cell proliferation and migration.
[0150] Materials and methods involved in the embodiments
[0151] Max Kluyveromycete plasmid transformation
[0152] Pick bacteria into 3 mL LYPD tubes and incubate at 30 °C on a shaker for 18-19 h. Take 1 mL of bacterial culture, centrifuge at 8000 rpm, discard the supernatant, wash with 1 mL of sterile water, centrifuge at 8000 rpm, and discard the supernatant. Wash with 1 mL of 1×TE / LiAc (0.1 M / L LiAc, 10 mM / L Tris, 1 mM / L EDTA), centrifuge at 8000 rpm, discard the supernatant, and repeat once. Add 10 μL of ligation product (or 3-4 μL of plasmid), 600 μL of PEG solution (0.1 M / L LiAc, 10 mM / L Tris, 1 mM / L EDTA, 40% PEG 4000), and DTT (final concentration 10 mmol). Incubate at 30 °C for 15 min, then at 47 °C for 15 min. Centrifuge briefly, discard the supernatant, add 100 μL of sterile water, resuspend, plate, and incubate at 30 °C.
[0153] High-density fermentation of Max Kluyveromycin
[0154] The engineered bacterial strain was inoculated onto YPD solid medium and activated by static incubation at 30°C for 48 hours. Then, single clones were picked and inoculated into synthetic medium containing glucose, ammonium sulfate, potassium dihydrogen phosphate, magnesium sulfate, vitamins, and trace elements, and cultured overnight at 30°C and 220 ppm for 14-18 hours. The seed culture was then inoculated at a ratio of 10% into a 5L fermenter containing 1.5L of synthetic medium. During fermentation, aeration and stirring were maintained, and feeding was done in a fed-batch manner. The temperature was controlled at 25-35°C, and the pH was maintained between 4.0 and 6.0 using ammonia. The fermentation time was controlled at 48-96 hours. The fermentation process was monitored by measuring OD... 600 Biomass was monitored, and recombinant proteins were detected by SDS-PAGE.
Claims
1. A Kluyveromyces martensii engineered strain recombinantly expressing hydroxylated human type III collagen, characterized in that, It was constructed by recombinantly expressing proline hydroxylase and the human type III collagen gene in *Kluyveromyces martensii*; wherein: The human type III collagen is C3S1 or C3S2; The gene sequence encoding human type III collagen C3S1 is SEQ ID NO.1; the amino acid sequence is SEQ ID NO.2; The gene sequence encoding human type III collagen C3S2 is SEQ ID NO.3; the amino acid sequence is SEQ ID NO.
4.
2. The engineered strain of *Kluyveromyces martensii* according to claim 1, characterized in that, The Kluyveromyces macrocarpa engineered strain is derived from the Kluyveromyces macrocarpa FIM1 strain by knocking out the uracil synthase gene URA3 in its genome, which is obtained as FIM1Δura3 strain. The Kluyveromyces macrocarpa FIM1 strain is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 10621.
3. The engineered strain of *Kluyveromyces martensii* according to claim 2, characterized in that, The recombinant expression method involves cloning the proline hydroxylase-encoding gene into the Kluyveromyces martensii expression vector LHZ-412, or integrating an expression unit containing the proline hydroxylase-encoding gene into the Kluyveromyces martensii genome.
4. The engineered strain of *Kluyveromyces martensii* according to claim 3, characterized in that, The proline hydroxylase is vP4H, or hP4HA, or hP4HB, with coding sequences of SEQ ID NO.5, SEQ ID NO.7, and SEQ ID NO.9, respectively.
5. The engineered strain of *Kluyveromyces martensii* according to claim 4, characterized in that: The recombinant human type III collagen C3S1 expressed therein is a part of human type III collagen, and the proline of the expressed C3S1 collagen is hydroxylated. The recombinant human type III collagen C3S1 is obtained by cloning the coding gene of type III collagen C3S1 into the 132-C29T secretory expression vector, then transforming it into the Kluyveromyces martensii engineered strain containing proline hydroxylase, and obtaining it in the supernatant of the fermentation broth through liquid fermentation. The recombinant human type III collagen C3S2 expressed therein is a part of human type III collagen, and the proline of the expressed C3S2 collagen is hydroxylated. The recombinant human type III collagen C3S2 is obtained by cloning the coding gene of type III collagen C3S2 into the Kluyveromyces martensii secretory expression vector 132-C29T, then transforming the recombinant Kluyveromyces martensii engineered strain expressing proline hydroxylase, and obtaining it in the supernatant of the fermentation broth through liquid fermentation.
6. A method for constructing a Kluyveromyces martensii engineered strain that recombinantly expresses hydroxylated human type III collagen, characterized in that, The specific steps are as follows: (1) Based on the structure of human type III collagen, collagen truncated genes C3S1 and C3S2 in the proline-rich region were designed; then the codons of proline hydroxylase genes and truncated collagen genes from different species were optimized and synthesized. (2) The sequence-optimized proline hydroxylase was linked with the ADH1 promoter sequence and the ADH1 terminator sequence of Saccharomyces cerevisiae to construct a proline hydroxylase expression cassette. Then, it was expressed in Kluyveromyces Marcius strain FIM-1Δura3 in chromosome-integrated expression or in centromere free plasmid pLHZ-412 to construct Kluyveromyces Marcius strain FIM-1Δura3 / vP4H, FIM-1Δura3 / hP4H or FIM-1Δura3 / hP4HB that express proline hydroxylase in chromosome-integrated expression. (3) The synthesized C3S1 or C3S2 gene was constructed into the Kluyveromyces martensii secretory expression vector pUKD132-C29T to obtain the recombinant secretory collagen expression vector pUKD132-C29T / C3S1 or pUKD132-C29T / C3S2. (4) The recombinant expression vector from step (3) was introduced into the Kluyveromyces martensii FIM-1Δura3 / vP4H, FIM-1Δura3 / hP4H or FIM-1Δura3 / hP4HB constructed in step 2, respectively. After screening, Kluyveromyces martensii engineered strains that simultaneously expressed proline hydroxylase and type III collagen C3S1 or C3S2 were obtained and named KmTavC3S1 and KmTavC3S2, respectively.
7. The construction method according to claim 6, characterized in that: In step (1): The collagen truncated genes C3S1 and C3S2 in the proline-rich region contain amino acid residues at positions 154-321 and 661-783 rich in the GPO, GFO, GEK, and GER sequences, which are beneficial for promoting wound repair. The collagen truncated variant encoded by these residues is C3S1(gly 661 -pro 783 ) and C3S2 (gly 154 -pro 321 ); The proline hydroxylase gene is the vP4H gene from bacteriophage virus APMV or the human-derived hP4H or hP4HB. The codon optimization involved using codon fitness index (CAI) and minimum folding free energy (MFE) as dual indicators to optimize the sequences of type III collagen and proline hydroxylase genes. The optimized C3S1 and C3S2 genes have the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.3, and the amino acid sequences shown in SEQ ID NO.2 and SEQ ID NO.4, respectively. The optimized vP4H, hP4H, and hP4HB genes have the nucleotide sequences shown in SEQ ID NO.5, SEQ ID NO.7, and SEQ ID NO.9, respectively, and the amino acid sequences shown in SEQ ID NO.6, SEQ ID NO.8, and SEQ ID NO.10, respectively. In step (2): The Kluyveromyces martensii strain is a FIM1Δura3 auxotrophic strain. It was constructed by knocking out the uracil synthase gene URA3 in the genome of Kluyveromyces martensii strain FIM1 (accession number: CGMCC No. 10621) which is deposited at the China General Microbiological Culture Collection Center. The *Kluyveromyces martensii* expression vector pLHZ-412 has the nucleotide sequence shown in SEQ ID NO.
11. The vector contains a hygromycin resistance selection marker, a *Kluyveromyces martensii* centromere sequence, a *Saccharomyces cerevisiae* ADH1 promoter, and an ADH1 terminator sequence. The chromosome integration expression refers to the integration of the proline hydroxylase expression cassette into the genome of Kluyveromyces martensii. The centromere vector expression involves cloning the proline hydroxylase expression cassette into the expression vector pLHZ-412 and then transforming it into the Kluyveromyces martensii strain FIM1Δura3. In step (3), the *Kluyveromyces martensii* expression vector pUKD132-C29T has the nucleotide sequence shown in SEQ ID NO.
12. The vector contains a URA3 selection marker gene, a pKD autonomous replication region, an inulinase promoter, a signal, and an inulinase terminator. The signal originates from the inulinase signal of *Kluyveromyces martensii* itself or from the α-factor signal of *Saccharomyces cerevisiae*. Using the pUKD132-C29T vector, the recombinantly expressed type III collagen C3S1 and C3S2 are secreted into the supernatant. In step (4), the screening process consists of the following steps: First, auxotrophic screening is used to obtain positive clones, specifically yeast transformants grown on a medium without uracil, which represent that the recombinant expression vector pUKD132-C29T / C3S1 or C3S2 carrying the URA3 selection marker gene has been transferred into the host strain FIM1Δura3; Second, the yeast positive clones are boiled and PCR is performed to identify the gene C3S1 or C3S2; Third, positive clones with higher expression levels of type III collagen secretion are screened.
8. The application of the *Kluyveromyces martensii* engineered strain as described in any one of claims 1-5 in the recombinant expression of human type III collagen C3S1 or C3S2, specifically: strain KmTavC3S1 is used for recombinant expression of human type III collagen C3S1, and KmTavC3S2 is used for recombinant expression of human type III collagen C3S2; the human type III collagen C3S1 or C3S2 recombinantly expressed in *Kluyveromyces martensii* can be hydroxylated, similar to the hydroxylation of natural type III collagen.
9. The application according to claim 8, characterized in that, The specific steps are as follows: (1) The two Kluyveromyces engineered strains KmTavC3S1 and KmTavC3S2 were fermented at high density in a fermenter for 2-5 days, and the supernatant fermentation broth containing collagen III C3S1 or C3S2 was obtained by centrifugation. (2) The fermentation broth in step 1 is separated and purified by ion exchange column to obtain III collagen C3S1 or C3S2.
10. The application according to claim 9, characterized in that: The high-density fermentation described in step (1) is carried out in a 5L fermenter with aeration and stirring. Specifically, KmTavC3S1 or KmTavC3S2 is inoculated into YPD medium and cultured at 30℃ and 220rpm for 16-24h. Then, it is inoculated into a 1.5L fermentation medium for high-density fermentation. Glucose is added during the fermentation process, and the pH of the fermentation broth is controlled at 6.5-6.0 using ammonia water. The fermentation time is 48-96 hours. In step (2), collagen C3S1 or C3S2 is obtained by ion exchange chromatography separation and purification. Collagen C3S1 is separated and purified using a complex ligand medium MMC chromatography column, and collagen C3S2 is separated and purified using a strongly positive SP medium ion exchange column.
11. Hydroxylated human III collagen, including C3S1 and C3S2, recombinantly expressed by engineered strains of *Kluyveromyces martensii* obtained by the application described in claims 8-10.
12. The use of the recombinant hydroxylated collagen as described in claim 11 in the preparation of cosmetic formulations, daily chemical product formulations, medical device or biopharmaceutical formulations.