Recombinant lactobacillus plantarum with high yield of nicotinamide mononucleotide, construction method and application thereof

By overexpressing the nicotinic acid phosphoribosyltransferase genes pncB1 and/or pncB2 in Lactobacillus plantarum WCFS1, a high-copy expression vector was constructed, which solved the problem of low NMN yield in Lactobacillus plantarum and achieved efficient NMN production.

CN121406555BActive Publication Date: 2026-07-07BINZHOU MEDICAL COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511982410.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-07-07
Estimated Expiration
2045-12-26

Smart Images

  • Figure CN121406555B_ABST
    Figure CN121406555B_ABST
Patent Text Reader

Abstract

The present application belongs to genetic engineering, and particularly relates to a recombinant Lactobacillus plantarum with high yield of nicotinamide mononucleotide (NMN), a construction method and application. The recombinant Lactobacillus plantarum is obtained by overexpressing endogenous nicotinic acid phosphoribosyltransferase genes pncB1 and / or pncB2 in a host strain. The present application first constructs a strain capable of efficiently synthesizing NMN by taking Lactobacillus plantarum as a chassis, wherein the endogenous NMN synthesis pathway is directly strengthened by specifically expressing endogenous nicotinic acid phosphoribosyltransferase pncB1 and pncB2, so that the yield of Lactobacillus plantarum NMN is greatly improved. The endogenous nicotinic acid phosphoribosyltransferase of Lactobacillus plantarum is modified by using genetic engineering technology, and the problems of weak expression capacity of exogenous genes and substrate absorption and conversion are successfully solved, thereby providing a feasible solution for NMN production of other probiotics.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention pertains to genetic engineering modification, specifically relating to a recombinant Lactobacillus plantarum that produces high levels of nicotinamide mononucleotide, its construction method, and its applications. Background Technology

[0002] Nicotinamide mononucleotide (NMN) is a key precursor to nicotinamide adenine dinucleotide (NAD⁺) and is widely involved in cellular energy metabolism, redox reactions, and aging-related physiological processes. With the rapid development of the anti-aging nutrition, metabolic health, and functional food market, the demand for safe, high-purity, and low-cost NMN continues to grow.

[0003] Currently, NMN is mainly prepared through chemical synthesis, enzymatic synthesis, and microbial fermentation. Chemical synthesis involves complex reaction routes, high costs, and difficulty in meeting food-grade safety requirements; enzymatic methods require large amounts of purified enzymes, which are also costly; while fermentation using GRAS-grade lactic acid bacteria has become an important direction for the industrial production of NMN due to its high safety, applicability in the food industry, and cost advantages.

[0004] Currently, research on NMN microbial synthesis mainly focuses on model organisms such as *Escherichia coli* and *Saccharomyces cerevisiae*. Although some engineered strains have achieved relatively high NMN yields (recombinant *E. coli* yields up to 46.66 g / L), these strains often face certain safety challenges in food-grade applications. In contrast, while GRAS-grade probiotics such as *Lactobacillus plantarum* have high safety profiles, existing research indicates that their wild-type strains generally have low natural NMN yields, typically ranging from micrograms to low milligrams, making it difficult to directly meet the high-efficiency requirements of large-scale industrial production.

[0005] Therefore, it is necessary to develop a genetic engineering strategy that can significantly improve the NMN biosynthesis capacity of Lactobacillus plantarum, thereby achieving food-grade, efficient, and low-cost NMN production. Summary of the Invention

[0006] The purpose of this invention is to provide a recombinant Lactobacillus plantarum that produces high levels of nicotinamide mononucleotide, its construction method, and its applications.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] A recombinant Lactobacillus plantarum that produces high levels of nicotinamide mononucleotide was obtained by overexpressing the endogenous nicotinic acid phosphoribosyltransferase genes pncB1 and / or pncB2 in a host strain.

[0009] The host strain is Lactiplantibacillus plantarum WCFS1.

[0010] A method for constructing a recombinant Lactobacillus plantarum with high nicotinamide mononucleotide production involves inserting the endogenous nicotinic acid phosphoribosyltransferase genes pncB1 and / or pncB2 of Lactobacillus plantarum into a high-copy expression vector, and then transforming it into Lactobacillus plantarum WCFS1 to obtain a recombinant strain overexpressing the pncB1 and / or pncB2 genes.

[0011] Furthermore, using PCR technology and the Lactobacillus plantarum WCFS1 genome as a template, primers were designed to amplify the endogenous pncB1 and pncB2 genes, and the linear fragments were recovered. The plasmid pKLH32 was digested with Bam HI and Eco RI, and the linear fragments were recovered. The linear fragments pncB1 and / or pncB2 were ligated to the linearized vector pKLH32 using a seamless cloning method and transformed to obtain a recombinant vector. The recombinant vector was then transformed into Lactobacillus plantarum WCFS1 using electroporation to obtain a recombinant strain overexpressing the pncB1 and / or pncB2 genes.

[0012] The primers used to amplify the endogenous pncB1 and pncB2 genes are:

[0013] pncB1-F: GCCAAACCATGGGTACTGCAGATGACGCAATCTATCCG;

[0014] pncB1-R: ATATATCATAGTATGTCCATTCTGTCAACAACTATAGCGCTTTAGTAAGCTTCCTCCTC;

[0015] pncB2-F:ATGGACATACTATGATATATATGCGCAATTTATCTTTATTAACC;

[0016] pncB2-R:ATTTTGGTTCAAAGAAAGCTTTTAATCTGCTAGTATCGTCATTT.

[0017] The application of the recombinant Lactobacillus plantarum that produces high levels of nicotinamide mononucleotide (NMN), specifically its application in the production of NMN.

[0018] Application of the recombinant Lactobacillus plantarum that produces high levels of nicotinamide mononucleotide in the production of nicotinamide mononucleotide using nicotinamide as a substrate.

[0019] Advantages of this invention:

[0020] 1. Significantly Increased Yield: This invention is the first to construct a strain of *Lactobacillus plantarum* capable of efficiently synthesizing NMN. Specifically, the endogenous NMN synthesis pathway is directly enhanced by the specific expression of endogenous nicotinic acid phosphoribosyltransferases pncB1 and pncB2, resulting in a significant increase in NMN yield from *Lactobacillus plantarum*. The use of genetic engineering techniques to modify the endogenous nicotinic acid phosphoribosyltransferases in *Lactobacillus plantarum* successfully solves the problems of weak exogenous gene expression (eliminating the need to consider codon bias between different hosts) and substrate absorption and transformation, providing a feasible solution for NMN production from other probiotics.

[0021] 2. High Technological Innovation: Using the recognized safe *Lactobacillus plantarum* as the production host, the production process is green and environmentally friendly, and the final product is suitable for food, health products, and other fields with high requirements for human safety. This invention reveals for the first time the crucial role of regulating the *Lactobacillus plantarum*'s own pncB gene in enhancing its NMN synthesis capacity. This technical method has not been disclosed in existing technologies and has produced unexpected technical effects. This invention not only provides a highly efficient NMN production method, but the recombinant bacteria itself can also be used directly as a live NMN production plant for the development of probiotic preparations, functional foods, etc. Attached Figure Description

[0022] Figure 1 The plasmid map constructed in this embodiment of the invention is shown in Figure A, where A is pKLH32-pncB1 and B is pKLH32-pncB2.

[0023] Figure 2 The pKLH32-pncB1-pncB2 plasmid map constructed for an embodiment of the present invention.

[0024] Figure 3 The difference in pncB1 and pncB2 gene expression levels between the genetically engineered strain WCFS1 / pKLH32-pncB1-pncB2 and the control strain WCFS1 / pKLH32 provided in the embodiments of the present invention.

[0025] Figure 4 This diagram illustrates the NMN production yield using engineered strains WCFS1 / pKLH32-pncB1, WCFS1 / pKLH32-pncB2, and control strain WCFS1 / pKLH32, as part of an embodiment of the present invention.

[0026] Figure 5 This diagram illustrates the NMN production yield using engineered strain WCFS1 / pKLH32-pncB1-pncB2 and control strain WCFS1 / pKLH32, as part of an embodiment of the present invention. Detailed Implementation

[0027] The following examples are used to further illustrate the present invention, but do not limit the scope of protection of the present invention.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0029] This invention relates to a recombinant Lactobacillus plantarum strain capable of high NMN production. By enhancing the expression of the endogenous nicotinic acid phosphoribosyltransferase genes pncB1 and / or pncB2, the strain's NMN synthesis capacity is significantly enhanced, thereby solving the problems of low NMN fermentation yield and lack of efficient strains for food-grade production.

[0030] Example 1: Construction of a genetically engineered strain of *Lactobacillus plantarum* with high expression of pncB1 and pncB2 genes

[0031] (1) Using the Lactobacillus plantarum WCFS1 genome (NCBI accession number: NC_004567.2, https: / / www.ncbi.nlm.nih.gov / nuccore / NC_004567.2) as a template, the pncB1 and pncB2 gene fragments in Lactobacillus plantarum were amplified using primers pncB1-F / pncB1-R and pncB2-F / pncB2-R, respectively.

[0032] The primer sequences are as follows:

[0033] pncB1-F: GCCAAACCATGGGTACTGCAGATGACGCAATCTATCCG (sequence 1)

[0034] pncB1-R: ATATATCATAGTATGTCCATTCTGTCAACAACTATAGCGCTTTAGTAAGCTTCCTCCTC (sequence 2)

[0035] pncB2-F: ATGGACATACTATGATATATATGCGCAATTTATCTTTATTAACC (Sequence 3)

[0036] pncB2-R: ATTTTGGTTCAAAGAAAGCTTTTAATCTGCTAGTATCGTCATTT (sequence 4);

[0037] The PCR reaction conditions were: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, and 72℃ extension for 1.5 minutes, repeated 30 times; 72℃ extension for 5 minutes, and storage at 4℃. The pncB1 gene size is 1479 bp, and the pncB2 gene size is 1434 bp; the sequences are as follows:

[0038] pncB1 gene sequence

[0039]

[0040] pncB2 gene sequence

[0041]

[0042] (2) The PCR products of the pncB1 and pncB2 genes obtained by the above amplification were recovered using a gel extraction kit. The lactic acid bacteria high expression vector pKLH32 (PMID: 31117359) was digested with restriction endonucleases BamHI and EcoRI, and the resulting vector frame size was approximately 6.9 kb. The vector digestion products were recovered using a gel extraction kit. The PCR products (pncB1 and pncB2) and the vector digestion products were ligated to each other using Infusion seamless cloning technology and transformed into Escherichia coli DH5α competent cells and cultured at 37°C for 16 hours. Single colonies on the plates were cultured in liquid culture. Using the colonies as templates, PCR amplification was performed using primers pncB1-F / pncB1-R and pncB2-F / pncB2-R to verify the transformants.

[0043] (3) The colony PCR bands were approximately 1600 bp in size, consistent with the expected size. Transformants validated by culture PCR were subjected to plasmid extraction and sent to Qingke Biotechnology Co., Ltd. for sequencing. Sequencing results showed that pncB1 from *Lactobacillus plantarum* was correctly inserted into the pKLH32 expression vector, and the plasmid was named pKLH32-pncB1. Figure 1 The pncB2 gene from *Lactobacillus plantarum* was correctly inserted into the pKLH32 expression vector, and the plasmid was named pKLH32-pncB2. Figure 1 ).

[0044] (4) The recombinant plasmids pKLH32-pncB1, pKLH32-pncB2 and pKLH32 plasmid were transformed into Lactobacillus plantarum WCFS1 competent cells by electroporation, and the pncB1 and pncB2 overexpression strains were named WCFS1 / pKLH32-pncB1, WCFS1 / pKLH32-pncB2 and control strain WCFS1 / pKLH32.

[0045] The preparation and electroconversion methods of competent Lactobacillus plantarum cells are as follows:

[0046] Streaking of WCFS1 bacterial suspension onto plates and incubating overnight for 36 hours. After single colonies grow to 1-2 mm, pick a single colony and transfer it to MRS liquid medium for activation and incubation twice. Then, transfer the bacterial suspension to 50 mL SGMRS (MRS medium + 1% glycine + 0.3 mol sucrose) medium at a 2% (v / v) inoculation rate and incubate at 37°C until the bacterial growth rate reaches OD. 600After adjusting the concentration to 0.3-0.4, transfer the cells to 50 mL sterile centrifuge tubes, incubate on ice for 20 min, centrifuge, and discard the supernatant. Wash the cells with SM buffer (5 mmol MgCl2, 952 mmol sucrose), centrifuge at 5000 rpm, 4 °C for 10 min, discard the supernatant, and repeat the washing process three times. Finally, resuspend the cells in 1 mL of pre-chilled SM buffer, aliquot into 100 μL containers, and store at -80 °C.

[0047] Add 1 μL of pKLH32-pncB1, pKLH32-pncB2, and pKLH32 plasmids to competent cells (1 μL of sterile water for the control group), mix gently, transfer to ice-cold electroporation cuvettes, electroporate at 2.5 kV, add 900 μL of SMRS (MRS medium + 0.3 mol sucrose) medium, and incubate at 37°C for 3 h. Centrifuge at 4500 rpm for 5 min, discard 900 μL of supernatant, resuspend the bacterial cells in the remaining 100 μL of supernatant, spread, and incubate at 37°C for 48 h.

[0048] Example 2: Construction of a genetically engineered strain of *Lactobacillus plantarum* co-expressing pncB1 and pncB2 genes

[0049] (1) Using the Lactobacillus plantarum WCFS1 genome (NCBI accession number: NC_004567.2, https: / / www.ncbi.nlm.nih.gov / nuccore / NC_004567.2) as a template, primers pncB1-F and pncB2-R were used to amplify the pncB1 and pncB2 gene fusion fragments in Lactobacillus plantarum.

[0050] The primer sequences are as follows:

[0051] pncB1-F: GCCAAACCATGGGTACTGCAGATGACGCAATCTATCCG

[0052] pncB2-R:ATTTTGGTTCAAAGAAAGCTTTTAATCTGCTAGTATCGTCATTT

[0053] The PCR reaction conditions were: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, and 72℃ extension for 3 minutes, repeated 30 times; 72℃ extension for 5 minutes, and storage at 4℃. The pncB1 and pncB2 gene fusion fragment size was 2954 bp.

[0054] pncB1-pncB2 gene sequence

[0055]

[0056] (2) The PCR products of the above pncB1 and pncB2 gene fusion fragments were recovered using a gel extraction kit. The lactic acid bacteria high expression vector pKLH32 (PMID: 31117359) was digested with restriction endonucleases BamHI and EcoRI, and the resulting vector frame size was approximately 6.9 kb. The vector digestion products were recovered using a gel extraction kit. The PCR products (pncB1 and pncB2 gene fusion fragments) and the vector digestion products were ligated using Infusion seamless cloning technology and transformed into Escherichia coli DH5α competent cells and cultured at 37°C for 16 hours. Single colonies from the plates were cultured in liquid culture, and the transformants were verified by PCR amplification using primers pncB1 and pncB2-R, respectively, using the colonies as templates.

[0057] (3) The colony PCR bands were approximately 3200 bp in size, consistent with the expected size. Transformants validated by culture PCR were subjected to plasmid extraction and sent to Qingke Biotechnology Co., Ltd. for sequencing. Sequencing results showed that the fusion fragment of the pncB1 and pncB2 genes from *Lactobacillus plantarum* was correctly inserted into the pKLH32 expression vector, and the plasmid was named pKLH32-pncB1-pncB2 (…). Figure 2 ).

[0058] (4) The pKLH32-pncB1-pncB2 recombinant plasmid was transformed into Lactobacillus plantarum WCFS1 competent cells using an electroporator, and the resulting strain overexpressing pncB1 and pncB2 genes was named WCFS1 / pKLH32-pncB1-pncB2.

[0059] The preparation of competent Lactobacillus plantarum cells is as described in Example 1.

[0060] Add 1 μL of pKLH32-pncB1-pncB2 plasmid to competent cells, mix gently, transfer to an ice-cold electroporation cuvette, electroporate at 2.5 kV, then add 900 μL of SMRS (MRS medium + 0.3 mol sucrose) medium and incubate at 37°C for 3 h. Centrifuge at 4500 rpm for 5 min, discard 900 μL of supernatant, resuspend the bacterial cells in the remaining 100 μL of supernatant, spread the mixture, and incubate at 37°C for 48 h.

[0061] Example 3: Synthesis of NMN using Lactobacillus plantarum WCFS1 / pKLH32-pncB1 and WCFS1 / pKLH32-pncB2

[0062] Single colonies of WCFS1 / pKLH32-pncB1, WCFS1 / pKLH32-pncB2, and the control strain WCFS1 / pKLH32 were picked from MRS plates and inoculated into 1 mL of MRS liquid medium containing 10 µg / mL erythromycin. The cultures were incubated statically at 37°C for 12 h. Seed culture OD of WCFS1 / pKLH32-pncB1, WCFS1 / pKLH32-pncB2, and the control strain WCFS1 / pKLH32 was then collected. 600 Adjustment to consistency (OD) 600 =10), and then transferred to 50 mL of MRS liquid medium (OXOID CM1175) containing 0.1% (w / v) nicotinamide at a 1% (v / v) inoculum and fermented for 12 h. The OD of the samples was measured using a spectrophotometer. 600 Centrifuge at 4℃ and 8000 rpm for 3 min, discard the supernatant, resuspend the cells twice with PBS buffer, wash twice, resuspend in double-distilled water, and adjust all OD values. 600 Values ​​consistent (OD) 600 =10), cells were disrupted using an ultra-high pressure continuous flow cell disruptor. Centrifuged at 12000 rpm, 4℃ for 2 min, and the supernatant was used for NMN content determination. The following reaction was performed: 69 μL of sample was taken, and 27.7 μL of 20% acetophenone and 27.7 μL of 2 mol KOH solution were added. After shaking and mixing, the mixture was incubated on ice for 2 min. 125 μL of 85% formic acid was added, and the reaction was carried out at 37℃ for 10 min. 200 μL of the reaction solution was taken and the fluorescence intensity was measured at 382 nm / 445 nm using a microplate reader to calculate the NMN content of each sample. From Figure 3 It was found that when pncB1 or pncB2 genes were overexpressed in a medium supplemented with 0.1% (w / v) nicotinamide substrate, the NMN content of the recombinant *Lactobacillus plantarum* strains WCFS1 / pKLH32-pncB1 or WCFS1 / pKLH32-pncB2 reached 130 µmol / L, while the NMN production of the control strain containing only the pKLH32 expression vector was only 80 µmol / L. Endogenous pncB1 or pncB2 overexpression increased the NMN production of the recombinant strains by more than 1.5 times, significantly enhancing the NMN synthesis capacity of *Lactobacillus plantarum*.

[0063] Example 4: Expression level analysis of pncB1 and pncB2 genes in engineered strain WCFS1 / pKLH32-pncB1-pncB2

[0064] The expression levels of pncB1 and pncB2 genes in engineered strain WCFS1 / pKLH32-pncB1-pncB2 and control strain WCFS1 / pKLH32 were compared using real-time quantitative PCR (RT-qPCR). Following the fermentation method described in Example 3, WCFS1 / pKLH32-pncB1-pncB2 and control strain WCFS1 / pKLH32 were picked from MRS plates and transferred at 1% (v / v) inoculum to 50 mL of MRS liquid medium (OXOID CM1175) containing 0.1% (w / v) nicotinamide for 12 h of fermentation. The cells were then centrifuged at 12000 rpm for 2 min at 4 °C to collect the cells for RNA extraction. The samples were resuspended with 20 mg / mL lysozyme and treated at 37 °C for 10 min to extract RNA (Trizol, Sangon Biotech). RNA concentration and purity were determined using Nanodrop, and its integrity was assessed by agarose gel electrophoresis. DNA was removed from the RNA using the Takara PrimeScript RT kit, and the resulting cDNA was reverse transcribed and used as a template for RT-qPCR. The reaction mixture consisted of 0.5 μL cDNA, 0.5 μL forward and reverse primers, 10 μL SYBR Premix Ex Taq (Takara), and 8.5 μL ddH2O, using a Lightcycle 96 real-time PCR system (Roche). RT-qPCR conditions were: pre-denaturation at 95℃ for 30 s, 95℃ for 5 s, and 60℃ for 30 s, for 40 cycles. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control gene. The genes and primers used for RT-qPCR are as follows:

[0065] GAPDH-real-F:ATGGTTTCGGACGTATCGGTCG (sequence 8)

[0066] GAPDH-real-R:GATGAGCCAACAATGCAGGTGAAG (sequence 9)

[0067] pncB1-real-F:ATGACGCAAATCTATCCGGATGATAGT (Sequence 10)

[0068] pncB1-real-R:GAAAGAACACTTCAAACACCGCAT (Sequence 11)

[0069] pncB2-real-F:AACAGTGACCTCGACTACTTCCG (Sequence 12)

[0070] pncB2-real-R:CGAGGAAAGACCGGGGTTC (sequence 13)

[0071] All RT-qPCR runs were performed with three biological replicates. -ΔΔCt Methods analysis of relevant gene expression data showed that the expression levels of pncB1 and pncB2 genes in the genetically engineered strain WCFS1 / pKLH32-pncB1-pncB2 were more than 60 times higher than those in the control strain (see [link]). Figure 4 This result further indicates that the enhanced NMN synthesis capacity is associated with the high expression of pncB1 and pncB2 genes in Lactobacillus plantarum WCFS1 / pKLH32-pncB1-pncB2.

[0072] Example 5: Synthesis of NMN using Lactobacillus plantarum WCFS1 / pKLH32-pncB1-pncB2 as a substrate with nicotinamide

[0073] Following the seed culture method in Example 3, single colonies of WCFS1 / pKLH32-pncB1-pncB2 and the control strain WCFS1 / pKLH32 were picked from MRS plates and inoculated into 1 mL of MRS liquid medium containing 10 µg / mL erythromycin. The cultures were incubated statically at 37°C for 12 h. The OD values ​​of the seed cultures of WCFS1 / pKLH32-pncB1-pncB2 and the control strain WCFS1 / pKLH32 were then calculated. 600 Adjustment to consistency (OD) 600 =10), and then transferred to 100 mL of MRS liquid medium (OXOID CM1175) containing 0.1% (w / v) nicotinamide at a 1% (v / v) inoculum and fermented for 12 h. The OD of the samples was measured using a spectrophotometer. 600 Centrifuge at 4℃ and 8000 rpm for 3 min, discard the supernatant, resuspend the cells twice with PBS buffer, wash twice, resuspend in double-distilled water, and adjust all OD values. 600 Values ​​consistent (OD) 600 =10), and the cells were disrupted using an ultra-high pressure continuous flow cell disruptor. Centrifuged at 12000 rpm, 4℃ for 2 min, the supernatant was collected, and the NMN content of the engineered strain WCFS1 / pKLH32-pncB1-pncB2 was determined according to the NMN content determination method in Example 4. From Figure 5 It was found that, compared with the control, the NMN content of the recombinant strain WCFS1 / pKLH32-pncB1-pncB2 of Lactobacillus plantarum reached 388 µmol / L when 0.1% (w / v) of nicotinamide substrate was added. The co-overexpression of endogenous pncB1 and pncB2 genes increased the NMN production by more than 4 times, which significantly improved the NMN synthesis capacity of Lactobacillus plantarum.

[0074] The above embodiments are merely basic illustrations of the inventive concept and do not limit the scope of the invention. Any equivalent modifications made based on the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. The application of a recombinant Lactobacillus plantarum that produces high levels of nicotinamide mononucleotide, characterized in that: Application of the recombinant Lactobacillus plantarum with high nicotinamide mononucleotide production in nicotinamide mononucleotide production; Recombinant *Lactobacillus plantarum* with high nicotinamide mononucleotide production was obtained by overexpressing the endogenous nicotinic acid phosphoribosyltransferase genes pncB1 and / or pncB2 in a host strain; the nucleotide sequence of pncB1 is shown in Sequence 5, and the nucleotide sequence of pncB2 is shown in Sequence 6.

2. The application of the recombinant Lactobacillus plantarum with high nicotinamide mononucleotide production according to claim 1, characterized in that: The method for constructing the recombinant Lactobacillus plantarum with high nicotinamide mononucleotide production is as follows: inserting the endogenous nicotinic acid phosphoribosyltransferase genes pncB1 and / or pncB2 of Lactobacillus plantarum into a high-copy expression vector, and then transforming it into Lactobacillus plantarum WCFS1 to obtain a recombinant strain with overexpression of pncB1 and / or pncB2 genes.

3. The application of the recombinant Lactobacillus plantarum with high nicotinamide mononucleotide production according to claim 2, characterized in that: Using PCR technology and with the Lactobacillus plantarum WCFS1 genome as a template, primers were designed to amplify the endogenous pncB1 and pncB2 genes, and the linear fragments were recovered. The plasmid pKLH32 was digested with Bam HI and Eco RI, and the linear fragments were recovered. The linear fragments pncB1 and / or pncB2 were ligated to the linearized vector pKLH32 using a seamless cloning method and transformed to obtain a recombinant vector. The recombinant vector was then transformed into Lactobacillus plantarum WCFS1 by electroporation to obtain a recombinant strain overexpressing the pncB1 and / or pncB2 genes.

4. The application of the recombinant Lactobacillus plantarum with high nicotinamide mononucleotide production according to claim 3, characterized in that: The primers used to amplify the endogenous pncB1 and pncB2 genes are: pncB1-F: GCCAAACCATGGGTACTGCAGATGACGCAATCTATCCG; pncB1-R: ATATATCATAGTATGTCCATTCTGTCAACAACTATAGCGCTTTAGTAAGCTTCCTCCTC; pncB2-F:ATGGACATACTATGATATATATGCGCAATTTATCTTTATTAACC; pncB2-R:ATTTTGGTTCAAAGAAAGCTTTTAATCTGCTAGTATCGTCATTT.

5. The application of the recombinant Lactobacillus plantarum with high nicotinamide mononucleotide production according to claim 1, characterized in that: Application of the recombinant Lactobacillus plantarum that produces high levels of nicotinamide mononucleotide in the production of nicotinamide mononucleotide using nicotinamide as a substrate.