Heterobifunctional compounds and methods of use thereof

Abstract

Disclosed herein are heterobifunctional compounds comprising a BCL6 binding moiety and a moiety that binds to a bromodomain of a histone acetyltransferase (HAT) wherein the two moieties are linked by a linker. Also disclosed herein are pharmaceutical compositions comprising the compounds, and methods of using the compounds, for example, to treat proliferative diseases, such as cancer.

Description

Cross-reference to related applications

[0001] This application claims priority and benefit to U.S. Provisional Patent Application No. 63 / 511,374, filed June 30, 2023, which is incorporated herein by reference in its entirety.

[0002] Statement Regarding Federal Government-Sponsored Research This invention was completed with government support under contracts CA163915, CA276167, and MH126720 awarded by the National Institutes of Health (NIH). The government holds certain rights to this invention.

[0003] Sequence list declaration The contents of the electronic sequence list titled STDU2_42137_601_SequenceListing.xml (size: 2,854 bytes; and creation date: June 28, 2024) are incorporated herein by reference in their entirety. Technical Field

[0004] This document discloses heterobifunctional compounds comprising a BCL6-binding moiety and a moiety binding to the bromine domain of histone acetyltransferase (HAT), wherein the two moieties are linked by a linker. This document also discloses pharmaceutical compositions comprising said compounds, and methods of using said compounds, for example, to treat proliferative diseases such as cancer. Background Technology

[0005] One of the major achievements in cancer biology over the past 40 years has been the identification of cancer-driving factors that, when mutated or otherwise dysregulated, drive the proliferation, spread, or survival of cancer cells (Weinberg, Science 230(4727), 770-776(1985); Davoli Cell, etc. 155, 948-962 (2013); Sanchez-Vega Cell, etc. 173, 321-337e310 (2018); Denny Cell, etc. 166, 328-342 (2016)). Cancer drivers have been widely recognized through human genetic studies of specific tumors and can be divided into tumor suppressor factors that prevent cancer development, or oncogenes that directly promote cancer proliferation or spread at the expense of the organism.

[0006] Over the past four decades, parallel studies, primarily in the laboratories of developmental biologists, have identified pathways of programmed cell death that kill specific populations of cells that malfunction in the developmental process or make mistakes in DNA replication or repair (Hengartner). Cell, etc. 76, 665-676 (1994); Strasser Annu. Rev. et al. Biochem. 69, 217-245 (2000)). These cell death pathways have evolved and are highly efficient over a hundred million years. In fact, approximately 60 billion of our own cells are killed by these mechanisms every day (Alberts). et al. in Molecular Biology of the Cell (2002)). The genes, proteins, and biochemical pathways that induce (pro-apoptosis) and prevent (anti-apoptosis) programmed cell death are well known and have been quite well understood. Summary of the Invention

[0007] This article discloses the compound of formula (I): ALB (I) Or its pharmaceutically acceptable salt, wherein: A is the BCL6 binding part; L is the connector; and B is the portion that binds to the bromine domain of histone acetyltransferase.

[0008] In some implementations, A is a part of the following formula: , , , , , , or .

[0009] In some implementations, A is a part of the following formula: .

[0010] In some embodiments, B is the portion that binds to the bromine domain of p300 or CBP. In some embodiments, B is a portion of the following formula: , , , , or .

[0011] In some implementations, B is a part of the following formula: .

[0012] In some embodiments, the compound is a compound of formula (Ia): (Ia).

[0013] In some embodiments, L is a direct bond, or any combination comprising -CH2-, -CH=CH-, -C≡C-, -O-, -NR'-, -BR'-, -S-, -C(O)-, -C(NR')-, -S(O)-, -S(O)2-, arylene, heteroarylene, cycloalkyl, and heterocyclic moieties, wherein the arylene, heteroarylene, cycloalkyl, and heterocyclic moieties are independently unsubstituted or substituted by 1, 2, or 3 substituents. In some embodiments, L is a direct bond, or any combination comprising -CH2-, -O-, -C(O)-, -NH-, -N(CH3)-, cycloalkyl, and heterocyclic moieties. In some embodiments, L comprises any combination of the following moieties: -(CH2) q -、-C(O)-、-NH-、 , , , , , , Where p is 1, 2, 3, 4, 5, or 6; and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some embodiments, L has a formula selected from the following: , and ; Where p is 1, 2, 3, 4, 5 or 6; and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16.

[0014] In some implementations, L has a form selected from the following: and .

[0015] In some implementation schemes, the compound is selected from: And its pharmaceutically acceptable salts.

[0016] This article also discloses a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

[0017] This document also discloses a method for treating a proliferative disease in a subject of need, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof. In some embodiments, the proliferative disease is a cancer selected from carcinomas, sarcomas, and hematologic malignancies. In some embodiments, the cancer is lymphoma. In some embodiments, diffuse large B-cell lymphoma.

[0018] This article also discloses a compound of formula (I) or a pharmaceutically acceptable salt thereof, for use as a medicine.

[0019] This document also discloses a compound of formula (I) or a pharmaceutically acceptable salt thereof for the treatment of proliferative disorders. In some embodiments, the proliferative disorder is a cancer selected from carcinomas, sarcomas, and hematologic malignancies. In some embodiments, the cancer is lymphoma. In some embodiments, the cancer is diffuse large B-cell lymphoma.

[0020] This article also discloses a medicine box comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof. Attached Figure Description

[0021] Figure 1 This illustrates a general strategy for activating cell death pathways using cancer-driving factors. The left side shows the major cancer-driving factor pathways. The right side shows pathways that promote apoptosis or cell death. TCIP combines a cancer-driving factor pathway with one chemical entity and a cell death pathway with a second chemical entity. In this application, histone acetyltransferases provide the driving mechanism for certain cancers, such as diffuse large B-cell lymphoma (DLBCL), and BCL6 is a potent regulator of programmed cell death or apoptosis.

[0022] Figure 2 This is a schematic diagram of the transcription / epigenetic chemistry proximity inducer (TCIP), which binds histone acetyltransferase on one side and BCL6 on the other. The combination of these two proteins with TCIP is called a ternary complex.

[0023] Figure 3 This diagram illustrates how TCIP borrows only a small portion of the total target and reconnects it to create new connections. This capability-gaining strategy is the basis for their significant effectiveness and non-toxicity.

[0024] Figure 4 This study demonstrates the activation of the green fluorescent protein (GFP) reporter gene, which is transcribed and controlled by endogenous BCL6, in the diffuse large B-cell lymphoma (DLBCL) cell line KARPAS422. Cells were treated with HAT-BCL6 TCIP for 24 hours. Mean ± standard error, n = 1–3 independent parallel assays.

[0025] Figures 5A to 5B This demonstrates the HAT-BCL6 TCIP for the DLBCL system SUDHL5 ( Figure 5A ) and KARPAS422 ( Figure 5B The effect of the compound on cell viability. Cells were treated with the compound for 72 hours. Mean ± standard deviation, 1–3 biological parallel assays.

[0026] Figures 6A to 6B It is shown in SUDHL5 ( Figure 6A ) or KARPAS422 ( Figure 6B In cell lines, cell viability was determined after competitive titration with 1 nM of the most potent HAT-BCL6 TCIP MNN-03-038 against either a monovalent inhibitor of BCL6 or p300 / CBP. Cells were treated with the compound for 72 hours.

[0027] Figures 7A to 7G The results of the inhibition of the oncoprotein c-MYC are shown below: Figure 7A Proteoblotting was performed to measure the protein levels of c-MYC, BCL6, CBP, and p300 in SUDHL5 cells after 4 hours of MNN-03-038 (TCIP3) treatment. Each assay represents three biological parallel determinations. Figure 7B ) Figure 7A Quantitative analysis of Western blots of proteins, mean ± standard deviation, n=3 biological parallel assays. Figure 7C Western blot of time-dependent changes in c-MYC protein in SUDHL5 cells after 1 nM MNN-03-038 (TCIP3); representing 3 biological parallel assays. Figure 7D ) Figure 7C Quantification of proteins by Western blot was superimposed with RT-qPCR measurements of time-dependent changes in c-MYC mRNA in SUDHL5 cells after 1 nM MNN-03-038 (TCIP3); the inhibition half-life was calculated by fitting a single-phase exponential decay; mean ± standard deviation, n=3 biological parallel assays. Figure 7E All differentially expressed transcripts were quantified by RNA-seq in SUDHL5 cells after treatment with 1 nM TCIP3; three biological parallel assays were performed; p-values ​​were calculated using a two-tailed Wald test and multiple comparisons were adjusted for Benjamini-Hochberg. Figure 7F RT-qPCR quantification of c-MYC mRNA in SUDHL5 cells was compared between treatments with 1 nM MNN-03-038 (TCIP3) and those treated with 1 nM GNE-781 and 1 nM BI-3812. Mean ± standard deviation, n = 3 biological parallel assays. Figure 7G RT-qPCR quantification of c-MYC mRNA in lymphoma cell lines was compared with that of 1 nM MNN-03-038 (TCIP3) treatment and increased levels of BCL6. Mean ± standard deviation, n = 3 biological parallel assays.

[0028] Figures 8A to 8F The following illustrates cytotoxic and ternary complex formation activities: Figure 8AViability curves of MNN-03-038 (TCIP3) and its inhibitor in SUDHL5 cells at 72 hours; mean ± standard deviation; n = 3 biological parallel assays. Figure 8B IC50 assay of the 72-hour viability of all synthesized TCIPs in SUDHL5 cells 50 value.( Figure 8C Activation of the BCL6 reporter gene after treatment with MNN-03-038 (TCIP3) and an inhibitor; mean ± standard deviation; n = 3 biological parallel assays. Figure 8D TR-FRET assays showed a ternary complex between the recombinant p300-bromodomain-His and BCL6-BTB domain proteins after 1 hour of co-incubation with TCIP molecules. Figure 8E Competitive titration of p300 / CBP inhibitors (GNE-781 or SGC-CBP-30) or BCL6 inhibitors (BI-3812, GSK 137 or CCT373566) against MNN-03-038 (TCIP3) (1 nM) over 72 hours in SUDHL5 cells; mean ± standard deviation; n = 2-3 biological parallel assays. Figure 8F Viability curves of four DLBCL cell lines treated with MNN-03-038 (TCIP3) or GNE-781 + BI-3812 for 72 hours to reduce BCL6 levels. Detailed Implementation

[0029] The fact that biochemical pathways driving cancer coexist with programmed cell death pathways that effectively kill cells within the same cell raises the possibility that cellular biochemical circuits can be reconnected, allowing cancer cells to kill themselves using biochemical pathways initiated by cancer-driving factors. This paper discloses a class of small molecules (transcriptional / epigenetic chemical proximity inducers, or TCIPs) that reconnect cellular biochemical circuits to activate pathways normally not controlled by the first pathway, which in this case are cancer-driving factors. Figure 1 The medium gray arrows illustrate the operation of these molecules, connecting cancer-driving factors and their dependent biochemical pathways to cell death pathways initiated in this case by DNA replication damage or developmental errors. Figure 2 The general structure of TCIP is shown, which recruits the transcription activator histone acetyltransferase to the promoter of a BCL6-binding cell death gene.

[0030] TCIP borrows only a portion of the target protein and uses it to activate transcription. For example, as... Figure 3As shown, only a portion of the total HAT is used. By borrowing only a small amount of the target protein instead of inhibiting it entirely, TCIP avoids the mechanism-based toxicity associated with complete inhibition or removal of the target. This is generally as follows: Figure 3 As shown.

[0031] This article discloses a highly potent TCIP for the treatment of cancers such as human diffuse large B-cell lymphoma (DLCBL). BCL6 inhibits pro-apoptotic genes by binding to histone deacetylases. Therefore, recruitment of histone acetyltransferases may activate these inhibited genes. Compounds such as B-I3812 bind to the BTB domain of BCL6 and prevent the binding of histone deacetylases. Therefore, the compounds disclosed herein are designed to bind to the BTB domain of BCL6 and are chemically linked to the entities that bind histone acetyltransferase (HAT) Ep300 and CBP.

[0032] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of any conflict, this document (including the definitions) shall prevail.

[0033] The definitions of specific functional groups and chemical terms are described in more detail below. For the purposes of this disclosure, chemical elements are identified according to the periodic table, CAS version, Handbook of Chemistry and Physics, 75th edition, inner cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional groups and reactivity, are described in Sorrell, Organic Chemistry, 2nd edition, University Science Books, Sausalito, 2006; Smith, March's Advanced Organic Chemistry: Reactions, Mechanism, and Structure, 7th edition, John Wiley & Sons, Inc., New York, 2013; Larock, Comprehensive Organic Transformations, 3rd edition, John Wiley & Sons, Inc., New York, 2018; and Carruthers, Some Modern Methods of Organic Synthesis, 3rd edition, Cambridge University Press, Cambridge, 1987.

[0034] As used herein, the modifier “about” used with a quantity includes the stated value and has a context-indicative meaning (e.g., it includes at least the degree of error associated with the measurement of the particular quantity). The modifier “about” should also be considered as disclosing a range defined by the absolute values ​​of its two endpoints. For example, the expression “about 2 to about 4” also discloses the range “2 to 4”. The term “about” can refer to ±10% of a specified number. For example, “about 10%” can indicate a range of 9% to 11%, and “about 1” can mean 0.9 to 1.1. Other meanings of “about” can be readily apparent from the context, such as rounding; for example, “about 1” can also mean 0.5 to 1.4.

[0035] As used herein, the term "alkyl" refers to a straight-chain or branched saturated hydrocarbon chain group. Alkyl chains can contain, for example, 1 to 24 carbon atoms (C1-C2). 24 Alkyl groups, 1 to 16 carbon atoms (C1-C5) 16 Alkyl groups, 1 to 14 carbon atoms (C1-C4) 14 Alkyl groups, 1 to 12 carbon atoms (C1-C2) 12 Alkyl groups, 1 to 10 carbon atoms (C1-C1) 10 Alkyl groups are alkyl groups with 1 to 8 carbon atoms (C1-C8 alkyl), 1 to 6 carbon atoms (C1-C6 alkyl), 1 to 4 carbon atoms (C1-C4 alkyl), 1 to 3 carbon atoms (C1-C3 alkyl), or 1 to 2 carbon atoms (C1-C2 alkyl). Representative examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, 3-methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl, and dodecyl.

[0036] As used herein, the term "alkenyl" refers to a straight-chain or branched hydrocarbon chain group containing at least one carbon-carbon double bond and no triple bonds. One or more double bonds can be located at any or more positions on the hydrocarbon chain. An alkenyl chain can contain, for example, 2 to 24 carbon atoms (C2-C4). 24 alkenyl), 2 to 16 carbon atoms (C2-C) 16 alkenyl), 2 to 14 carbon atoms (C2-C) 14 alkenyl), 2 to 12 carbon atoms (C2-C) 12 alkenyl), 2 to 10 carbon atoms (C2-C) 10Alkenes can be categorized into several groups, including alkenyl, 2-8 carbon atoms (C2-C8 alkenyl), 2-6 carbon atoms (C2-C6 alkenyl), 2-4 carbon atoms (C2-C4 alkenyl), 2-3 carbon atoms (C2-C3 alkenyl), or 2 carbon atoms (C2 alkenyl). Representative examples of alkenyl groups include, but are not limited to, vinyl, 1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl, butadienyl, 2-methyl-2-propenyl, 3-butenyl, pentenyl, pentadienyl, hexenyl, heptenyl, octenyl, and octtrienyl.

[0037] As used herein, the term "alkynyl" refers to a straight-chain or branched hydrocarbon chain group containing at least one carbon-carbon triple bond. An alkynyl chain can contain, for example, 2 to 24 carbon atoms (C2-C4). 24 alkynyl group), 2 to 16 carbon atoms (C2-C) 16 alkynyl group), 2 to 14 carbon atoms (C2-C) 14 alkynyl group), 2 to 12 carbon atoms (C2-C) 12 alkynyl group), 2 to 10 carbon atoms (C2-C) 10 The alkynyl group consists of 2 to 8 carbon atoms (C2-C8 alkynyl), 2 to 6 carbon atoms (C2-C6 alkynyl), 2 to 4 carbon atoms (C2-C4 alkynyl), 2 to 3 carbon atoms (C2-C3 alkynyl), or 2 carbon atoms (C2 alkynyl). One or more triple bonds can be located at any or more positions in the hydrocarbon chain. Representative examples of alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, and 2-butynyl.

[0038] As used herein, the term "alkoxy" refers to an alkyl group as defined herein, which is attached to a portion of a parent molecule by an oxygen atom. Representative examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, 2-propoxy, butoxy, and tert-butoxy.

[0039] As used herein, the term "amino" refers to the -NR group. x R y , where R x and R y Selected from hydrogen and alkyl (e.g., C1-C4 alkyl). The group -NH (alkyl) may be referred to herein as "alkylamino", and the group -N (alkyl)2 may be referred to herein as "dialkylamino".

[0040] As used herein, the term "aryl" refers to a monocyclic, bicyclic, or tricyclic 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic array) group having 6–14 ring carbon atoms and zero heteroatoms ("..."). C6 - C14 Aryl group ("aryl"). In some embodiments, the aryl group has six ring carbon atoms ("aryl"). C6"Aryl", i.e., phenyl). In some embodiments, the aryl group has ten ring carbon atoms (" C10 "Aryl", such as naphthyl such as 1-naphthyl and 2-naphthyl). In some embodiments, the aryl group has fourteen ring carbon atoms (" C14 "Aryl", namely anthracene and phenanthrene.

[0041] As used in this article, the term "triaryl" refers to a divalent aryl group.

[0042] As used herein, the term "cycloalkyl" refers to a saturated carbocyclic ring system group containing three to ten carbon atoms and zero heteroatoms. Cycloalkyl groups can be monocyclic, bicyclic, bridged, fused, or spirocyclic. Representative examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, adamantyl, bicyclic [2.2.1]heptyl, bicyclic [3.2.1]octyl, and bicyclic [5.2.0]nonyl.

[0043] As used herein, the term "cycloalkylene" refers to a divalent cycloalkyl group.

[0044] As used in this article, the term "cyano" refers to the -CN group.

[0045] As used in this article, the term "halogen" or "halogenated" refers to F, Cl, Br, or I.

[0046] As used herein, the term "haloalkyl" refers to an alkyl group as defined herein, wherein at least one hydrogen atom (e.g., one, two, three, four, five, six, seven, or eight hydrogen atoms) is replaced by a halogen. In some embodiments, each hydrogen atom of the alkyl group is replaced by a halogen ("per-haloalkyl"). Representative examples of haloalkyl groups include, but are not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2-fluoroethyl, 2,2,2-trifluoroethyl, and 3,3,3-trifluoropropyl.

[0047] As used herein, the term "haloalkoxy" refers to a haloalkyl group as defined herein, which is attached to a parent molecule via an oxygen atom. Representative examples of haloalkoxy groups include, but are not limited to, difluoromethoxy, trifluoromethoxy, and 2,2,2-trifluoroethoxy.

[0048] As used herein, the term "heteroalkyl" means an alkyl group as defined herein, wherein one or more carbon atoms (and any associated hydrogen atoms) are each independently surrounded by heteroatom groups such as -NH-, -O-, -S-, -S(O)-, -S(O)2-, -OP(O)(O -O- and other substitutions. For example, 1, 2, 3, 4, 5, 6 or more carbon atoms can be independently replaced by the same or different heteroatom groups. Heteroalkyl groups may also contain one or more carbonyl moieties (i.e., wherein the carbon atoms of the alkyl group are oxidized to -C(O)- groups).

[0049] As used herein, the term "heteroaryl" refers to a 5-10 membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6 or 10 π electrons shared in a cyclic array) having a ring carbon atom and 1-4 ring heteroatoms, each heteroatom being independently selected from nitrogen, oxygen, and sulfur ("5-10 membered heteroaryl"). In heteroaryls containing one or more nitrogen atoms, the linkage can be a carbon atom or a nitrogen atom, provided the valence allows. Heteroaryl bicyclic systems may contain one or more heteroatoms in one or both rings. "Heteroaryl" also includes ring systems in which a heteroaryl ring as defined above is fused with one or more aryl groups, wherein the linkage is on the aryl or heteroaryl ring, and in such cases, the number of ring members indicates the number of ring members in the fused (aryl / heteroaryl) ring system. Bicyclic heteroaryl groups have one ring that does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazoleyl, etc.), and the linkage can be on either ring, i.e., a ring with a heteroatom (e.g., 2-indolyl) or a ring without a heteroatom (e.g., 5-indolyl). Exemplary 5-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyrroleyl, furanyl, and thiophenyl. Exemplary 5-membered heteroaryl groups containing two heteroatoms include, but are not limited to, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5-membered heteroaryl groups containing three heteroatoms include, but are not limited to, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 5-membered heteroaryl groups containing four heteroatoms include, but are not limited to, tetrazolyl. Exemplary 6-membered heteroaryl groups containing one heteroatom include, but are not limited to, pyridinyl. Exemplary 6-membered heteroaryl groups containing two heteroatoms include, but are not limited to, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6-membered heteroaryl groups containing three or four heteroatoms include, but are not limited to, triazinyl and tetraazinyl, respectively. Exemplary 7-membered heteroaryl groups containing one heteroatom include, but are not limited to, aziridinyl, oxapridinyl, and thiapyridinyl. Exemplary 5,6-bicyclic heteroaryl groups include, but are not limited to, indolyl, isoyindolyl, indazole, benzotriazolyl, benzothiophene, isobenzothiophene, benzofuranyl, benzoisofuranyl, benzoimidazolyl, benzoxazolyl, benzoisoxazolyl, benzoxadiazolyl, benzothiazolyl, benzoisothiazolyl, benzothiadiazolyl, indolazinyl, and purinel. Exemplary 6,6-bicyclic heteroaryl groups include, but are not limited to, naphridinyl, pteridinyl, quinolinyl, isoquinolinyl, cenolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl.

[0050] As used in this article, the term "hybrid aryl" refers to a divalent heteroaryl.

[0051] As used herein, the term "heterocyclic group" refers to a 3- to 10-membered non-aromatic ring system group having a ring carbon atom and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon ("3- to 10-membered heterocyclic groups"). In heterocyclic groups containing one or more nitrogen atoms, the linkage can be a carbon atom or a nitrogen atom, as long as the valence allows. Heterocyclic groups can be monocyclic ("monocyclic heterocyclic groups") or fused, bridged, or spirocyclic systems, such as bicyclic systems ("bicyclic heterocyclic groups"), and can be saturated or partially unsaturated. A heterocyclic bicyclic system can contain one or more heteroatoms in one or both rings. "Heterocyclic group" also includes ring systems in which the heterocyclic ring as defined above is fused with one or more cycloalkyl groups, wherein the connection point is on the cycloalkyl or heterocyclic ring; or ring systems in which the heterocyclic ring as defined above is fused with one or more aryl or heteroaryl groups, wherein the connection point is on the heterocyclic ring, and in this case, the number of ring members continues to indicate the number of ring members in the heterocyclic ring system. Heterocyclic groups can be described, for example, as 3- to 7-membered heterocyclic groups, wherein the term "member" refers to a non-hydrogen ring atom within the portion, i.e., carbon, nitrogen, oxygen, sulfur, boron, phosphorus, and silicon. Exemplary 3-membered heterocyclic groups containing one heteroatom include, but are not limited to, azirropropyl, oxacyclopropyl, and thiorenyl. Exemplary 4-membered heterocyclic groups containing one heteroatom include, but are not limited to, azirrobutyl, oxacyclobutyl, and thiorenyl. Exemplary 5-membered heterocyclic groups containing one heteroatom include, but are not limited to, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolyl, dihydropyrrolyl, and pyrrolyl-2,5-dione. Exemplary 5-membered heterocyclic groups containing two heteroatoms include, but are not limited to, dioxasulfuranyl, disulfuranyl, and oxazolidin-2-one. Exemplary 5-membered heterocyclic groups containing three heteroatoms include, but are not limited to, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary 6-membered heterocyclic groups containing one heteroatom include, but are not limited to, piperidinyl (e.g., 2,2,6,6-tetramethylpiperidinyl), tetrahydropyranyl, dihydropyridinyl, pyridinoneyl (e.g., 1-methylpyridin-2-oneyl), and thiaalkyl. Exemplary 6-membered heterocyclic groups containing two heteroatoms include, but are not limited to, piperazinyl, morpholinyl, pyridazinone (2-methylpyridazin-3-one), pyrimidinone (e.g., 1-methylpyrimidin-2-one, 3-methylpyrimidin-4-one), dithiaalkyl, and dioxane. Exemplary 6-membered heterocyclic groups containing two heteroatoms include, but are not limited to, triazinyl. Exemplary 7-membered heterocyclic groups containing one heteroatom include, but are not limited to, azirheptanyl, oxetaneheptyl, and thioheptanyl. Exemplary 8-membered heterocyclic groups containing one heteroatom include, but are not limited to, azirheptanyl, oxetaneheptyl, and thioheptanyl.Exemplary 5-membered heterocyclic groups fused to a C6 aromatic ring (also referred to herein as 5,6-bicyclic heterocyclic rings) include, but are not limited to, indololinyl, isoindololinyl, dihydrobenzofuranyl, dihydrobenzothiophenyl, benzoxazolinone, etc. Exemplary 5-membered heterocyclic groups fused to a heterocyclic ring (also referred to herein as 5,5-bicyclic heterocyclic rings) include, but are not limited to, octahydropyrrolopyrrolithyl (e.g., octahydropyrrolo[3,4-c]pyrrolithyl), etc. Exemplary 6-membered heterocyclic groups fused to a heterocyclic ring (also referred to herein as 4,6-membered heterocyclic rings) include, but are not limited to, diazaspirononyl (e.g., 2,7-diaazaspiron[3.5]nonyl). Exemplary 6-membered heterocyclic groups fused to an aromatic ring (also referred herein as 6,6-bicyclic heterocyclic rings) include, but are not limited to, tetrahydroquinolinyl, tetrahydroisoquinolinyl, etc. Exemplary 6-membered heterocyclic groups fused with cycloalkyl rings (also referred to herein as 6,7-bicyclic heterocyclic rings) include, but are not limited to, azibicyclic octyl (e.g., (1,5)-8-azibicyclic [3.2.1]octyl). Exemplary 6-membered heterocyclic groups fused with cycloalkyl rings (also referred herein as 6,8-bicyclic heterocyclic rings) include, but are not limited to, azibicyclic nonyl (e.g., 9-azibicyclic [3.3.1]nonyl).

[0052] As used in this article, the term "subheterocyclic group" refers to a divalent heterocyclic group.

[0053] As used in this article, the term "hydroxyl (hydroxy or hydroxyl)" refers to the -OH group.

[0054] As used in this article, the term "nitro" refers to the -NO2 group.

[0055] When a group or portion can be substituted, the term "substituted" indicates that one or more (e.g., 1, 2, 3, 4, 5, or 6; in some embodiments, 1, 2, or 3; and in other embodiments, 1 or 2) hydrogen atoms on the group indicated in the use of "substituted" can be replaced by a list of indicated groups or by suitable substituents known to those skilled in the art (e.g., one or more groups listed below), provided that the normal valence of the specified atom is not exceeded. Substituents include, but are not limited to, alkyl, alkenyl, alkoxy, acyl, amino, amide, amidyl, aryl, azide, carbamoyl, carboxyl, carboxyl ester, cyano, cycloalkyl, cycloalkenyl, guanidinyl, haloyl, haloalkyl, haloalkoxy, heteroalkyl, heteroaryl, heterocyclic, hydroxyl, hydrazyl, imino, oxo, nitro, phosphate ester, phosphonate, sulfonic acid, thiol, thion, or combinations thereof.

[0056] As used in this article, in chemical structures, it indicates: It indicates the connection point between one part and another part (e.g., a substituent and the rest of the compound).

[0057] For the compounds described herein, their groups and substituents can be selected based on the permissible valences of the atoms and substituents, such that selection and substitution produce stable compounds, for example, which do not spontaneously transform through rearrangement, cyclization, elimination, etc.

[0058] When substituents are specified by their conventional chemical formula written from left to right, such indications also cover substituents derived from structures written from right to left. For example, if a divalent group is shown as -CH2O-, then such indications also cover -OCH2-; similarly, -OC(O)NH- also covers -NHC(O)O-. When a linker portion is shown, the linker can be attached to other parts of the compound in either direction.

[0059] As used herein, the terms “administer,” “administering,” or “administration” refer to the implantation, absorption, ingestion, injection, inhalation, or other introduction of a compound or pharmaceutical composition.

[0060] As used in this article, the terms “disease,” “illness,” and “symptom” are used interchangeably.

[0061] An "effective amount" of a compound or composition refers to an amount sufficient to elicit a desired biological response (e.g., to treat a disease). Those skilled in the art will understand that the effective amount of a compound can vary depending on factors such as the desired biological endpoint, the pharmacokinetics of the compound, the disease being treated, the route of administration, and the age and health status of the subject. Effective amounts encompass both therapeutic and preventative treatment. For example, in treating cancer, an effective amount of a compound or composition can reduce the tumor burden or inhibit tumor growth or spread.

[0062] A "therapeuticly effective amount" of a compound or composition refers to an amount sufficient to provide therapeutic benefit in treating a disorder or to delay or maximally reduce one or more symptoms associated with that disorder. In some embodiments, a therapeutically effective amount is an amount sufficient to provide therapeutic benefit in treating a disorder or to maximally reduce one or more symptoms associated with that disorder. A therapeutically effective amount of a compound means the amount of a therapeutic agent that provides therapeutic benefit in treating a disorder when used alone or in combination with other therapies. The term "therapeuticly effective amount" may encompass an amount that improves overall therapy, reduces symptoms of a disorder or prevents the cause of a disorder, or enhances the therapeutic efficacy of another therapeutic agent.

[0063] The “subjects” to be considered for administration include, but are not limited to, humans (i.e., men or women of any age group, such as pediatric subjects (e.g., infants, children, adolescents) or adult subjects (e.g., young adults, middle-aged adults, or older adults)) and / or other non-human animals, such as mammals (e.g., primates (e.g., cynomolgus monkeys, rhesus monkeys); commercially relevant mammals such as cattle, pigs, horses, sheep, goats, cats, and / or dogs) and birds (e.g., commercially relevant birds such as chickens, ducks, geese, and / or turkeys).

[0064] As used herein, the terms “treatment,” “treat,” and “treating” refer to reversing or alleviating a disease or ailment or one or more of its signs or symptoms, delaying the onset of a disease or one or more of its signs or symptoms, or inhibiting the progression of a disease or one or more of its signs or symptoms. In some embodiments, “treatment,” “treat,” and “treating” require that signs or symptoms of a disease, ailment, or ailment have developed or been observed. In other embodiments, treatment may be administered in the absence of signs or symptoms of a disease or ailment. For example, treatment may be administered to susceptible individuals before the onset of symptoms (e.g., based on a history of symptoms and / or based on genetic or other susceptibility factors). Treatment may also continue after symptoms subside, for example, to delay or prevent recurrence.

[0065] compound This article discloses the compound of formula (I): ALB (I) Or its pharmaceutically acceptable salt, wherein: A is the BCL6 binding part; L is the connector; and B is the portion that binds to the bromine domain of histone acetyltransferase.

[0066] Part A is the BCL6 junction portion. In some implementations, A is a portion of the following formula: , , , , , , or .

[0067] In some implementations, A is a part of the following formula: .

[0068] Part B is the portion that binds to the bromine domain of histone acetyltransferase. In some embodiments, B is the portion that binds to the bromine domain of p300 or CBP. In some embodiments, B is a portion of the following formula: , , , , or .

[0069] In some implementations, B is a part of the following formula: .

[0070] In some embodiments, the compound of formula (I) is the compound of formula (Ia): (Ia), Or its pharmaceutically acceptable salt.

[0071] L is a linker that provides a covalent connection between part A and part B. In some embodiments, the exact structure of the linker may not be important, as long as it does not substantially interfere with the activity of the BCL6-binding portion or the portion bound to the bromine domain of HAT. In some embodiments, L is a direct bond. In other embodiments, L comprises any combination of -CH2-, -CH=CH-, -C≡C-, -O-, -NR'-, -BR'-, -S-, -C(O)-, -C(NR')-, -S(O)-, -S(O)2-, arylene, heteroarylene, cycloalkyl, and heterocyclic moieties, wherein R' is selected from hydrogen and C1-C6 alkyl, and wherein the arylene, heteroarylene, cycloalkyl, and heterocyclic moieties are independently unsubstituted or substituted with 1, 2, or 3 substituents.

[0072] In some embodiments, the linker comprises an alkylene chain (e.g., having 2-20 -CH2- units). In other embodiments, the linker comprises an alkylene chain that is interrupted and / or terminated (at either or both ends) by at least one group selected from the following: -O-, -S-, -N(R')-, -CH=CH-, -C≡C-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -C(NOR')-, -C(O)N(R')C(O)-, -C(O)N(R')C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)N(R')-, -OC (O)N(R')-, -C(NR')-, -N(R')C(NR')-, -C(NR')N(R')-, -N(R')C(NR')N(R')-, -OB(CH3)O-, -S(O)2-, -OS(O)-, -S(O)O-, -S(O)- , -OS(O)2-, -S(O)2O-, -N(R')S(O)2-, -S(O)2N(R')-, -N(R')S(O)-, -S(O)N(R')-, -N(R')S(O)2N(R')-, -N(R')S(O)N(R')-, C3-C 12 Cycloalkyl, 3- to 12-membered heterocyclic, 5- to 10-membered aryl, 5- to 12-membered heteroaryl, or any combination thereof, wherein each R' is independently selected from hydrogen and C1-C6 alkyl, and wherein the interrupting and terminating groups may be the same or different.

[0073] In some implementations, L comprises an alkylene chain: Where q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some embodiments, q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12. For example, in some embodiments, q is 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-16, 2-15, 2-14, 2-13, 2-12, 2-11, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-16. 3-15, 3-14, 3-13, 3-12, 3-11, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-16, 4-15, 4-14, 4-13, 4-12, 4-11, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-16, 5-15, 5-14, 5-13, 5-12, 5-11, 5-10, 5-9, 5- 8, 5-7, 5-6, 6-16, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-16, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 7-9, 7-8, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 8-9 or 9-16, 9-15, 9 -14, 9-13, 9-12, 9-11, 9-10, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11, 11-16, 11-15, 11-14, 11-13, 11-12, 12-16, 12-15, 12-14, 12-13, 13-16, 13-15, 13-14, 14-16, 14-15, and 15-16. In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3. In some embodiments, q is 4. In some embodiments, q is 5. In some embodiments, q is 6. In some embodiments, q is 7. In some embodiments, q is 8. In some embodiments, q is 9. In some embodiments, q is 10. In some embodiments, q is 11. In some embodiments, q is 12. In some embodiments, q is 13. In some embodiments, q is 14. In some embodiments, q is 15. In some embodiments, q is 16. Specific examples of alkylene chains include: , , , , , , , , , , , , , , and .

[0074] In some embodiments, L comprises functional groups (such as -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -C(NOR')-, -C(O)N(R')-, -C(O)N(R')C(O)-, -C(O)N(R')C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)O-, -OC(O)N(R')-, -C(NR')C(NR') -、-C(NR')N(R')-、-N(R')C(NR')N(R')-、-OB(CH3)O-、-S(O)2-、-OS(O)-、-S(O)O-、-S(O)-、-OS(O)2-、-S(O)2O-、-N(R')S(O)2-、-S(O)2N(R')-、-N(R')S(O)-、-S(O)N(R')-、-N(R')S(O)2N(R')- or -N(R')S(O)N(R')-) interrupted alkylene chains.

[0075] In some embodiments, L comprises one or more repeating alkylene glycol units, such as ethylene glycol or propylene glycol repeating units. For example, in some embodiments, L comprises polyethylene glycol or oligomeric glycol chains. Where p is 1, 2, 3, 4, 5, or 6. In some implementations, L comprises a set of formulas: Where p is 1, 2, 3, 4, 5, or 6. In some embodiments, p is 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, 2-5, 2-4, 2-3, 3-6, 3-5, 3-4, 4-6, 4-6, or 5-6. In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 4. In some embodiments, p is 5. In some embodiments, p is 6.

[0076] In some embodiments, L comprises one or more cycloalkyl or heterocyclic groups, non-limiting examples of which include: , , , , , , , , , , , , , , , , , , , , , , , , , and .

[0077] In some embodiments, L comprises a cycloalkyl or heterocyclic group, such as one of the aforementioned cycloalkyl and heterocyclic groups, having one or more additional groups at one or both ends, wherein said additional groups are independently selected from -CH2-, -O-, -S-, -N(R')-, -CH=CH-, -C≡C-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -C(NOR')-, -C(O)N(R')-, -C(O)N(R')C(O)-, -C(O)N(R')C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)O -, -OC(O)N(R')-, -C(NR')-, -N(R')C(NR')-, -C(NR')N(R')-, -N(R')C(NR')N(R')-, -OB(CH3)O-, -S(O)2-, -OS(O)-, -S(O)O-, -S(O)-, -OS(O)2-, -S(O)2O-, -N(R')S(O)2-, -S(O)2N(R')-, -N(R')S(O)-, -S(O)N(R')-, -N(R')S(O)2N(R')- and -N(R')S(O)N(R')- or any combination thereof, wherein each R' is independently selected from hydrogen and C1-C6 alkyl groups. In some embodiments, L comprises a cycloalkyl or heterocyclic group, such as one of the cycloalkyl and heterocyclic groups described above, having one or more additional groups at one or both ends, wherein said additional groups are independently selected from -CH2-, -C(O)-, -NH-, and -O-.

[0078] In some embodiments, L comprises two or more cycloalkyl or heterocyclic groups, such as two or three independently selected from those described above, interconnected by covalent bonds or one or more linking groups, optionally having one or more additional linking groups at one or both ends, wherein the linking groups are independently selected from -O-, -S-, -N(R')-, -CH2-, -CH=CH-, -C≡C-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -C(NOR')-, -C(O)N(R')C(O)-, -C(O)N(R')C(O)-, -C(O)N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C( -O)N(R')-, -N(R')C(O)O-, -OC(O)N(R')-, -C(NR')-, -N(R')C(NR')-, -C(NR')N(R')-, -N(R')C(NR')N(R')-, -OB(CH3)O-, -S(O)2-, -OS(O)-, -S(O)O-, -S(O)-, -OS(O)2-, -S(O)2O-, -N(R')S(O)2-, -S(O)2N(R')-, -N(R')S(O)-, -S(O)N(R')-, -N(R')S(O)2N(R')- and -N(R')S(O)N(R')- or any combination thereof, wherein each R' is independently selected from hydrogen and C1-C6 alkyl groups. In some embodiments, L comprises two or more cycloalkyl or heterocyclic groups, such as two or three cycloalkyl or heterocyclic groups independently selected from those mentioned above, which are interconnected by covalent bonds or one or more linking groups, optionally having one or more additional linking groups at one or both ends, wherein the linking groups are independently selected from -O- and -CH2-.

[0079] In some embodiments, L comprises one or more cycloalkyl or heterocyclic groups substituted with one, two, or three substituents, for example, substituents independently selected from C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, halogenated, hydroxyl, etc. In some embodiments, L comprises one or more cycloalkyl or heterocyclic groups substituted with one, two, or three substituents independently selected from C1-C4 alkyl and halogenated groups. In some embodiments, L comprises one or more cycloalkyl or heterocyclic groups substituted with one, two, or three substituents independently selected from methyl and fluorine.

[0080] In some embodiments, L is a direct bond, or any combination comprising -CH2-, -CH=CH-, -C≡C-, -O-, -NR'-, -BR'-, -S-, -C(O)-, -C(NR')-, -S(O)-, -S(O)2-, arylene, heteroarylene, cycloalkyl, and heterocyclic moieties, wherein the arylene, heteroarylene, cycloalkyl, and heterocyclic moieties are independently unsubstituted or substituted by one, two, or three substituents. In some embodiments, L is a direct bond, or any combination comprising -CH2-, -O-, -C(O)-, -NH-, -N(CH3)-, cycloalkyl, and heterocyclic moieties.

[0081] In some implementations, L includes any combination of the following: -(CH2) q -、-C(O)-、-NH-、 , , , , and , Where p is 1, 2, 3, 4, 5 or 6; and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16.

[0082] In some implementations, L has a form selected from the following: , and ; Where p is 1, 2, 3, 4, 5 or 6; and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16.

[0083] In some implementations, L has a form selected from the following: and .

[0084] In some embodiments, the compound of formula (I) is selected from: And its pharmaceutically acceptable salts.

[0085] When discussing certain features or properties of compounds of formula (I) or compositions, methods or kits containing compounds of formula (I) herein, it should be understood that such references also include compounds of formula (Ia), as well as the specific exemplary compounds disclosed herein.

[0086] Compounds can exist as stereoisomers, containing either asymmetric or chiral centers. Stereoisomers are designated "R" or "S," depending on the configuration of the substituents surrounding the chiral carbon atom. The terms "R" and "S" as used herein are as in IIUPAC 1974 Recommendations for Section E, Fundamental Stereochemistry. Pure Appl. Chem.Configurations as defined in 1976, 45: 13-30. Various stereoisomers and mixtures thereof are specifically included within the scope of this disclosure. Stereoisomers include enantiomers and diastereomers, as well as mixtures of enantiomers or diastereomers. Individual stereoisomers of a compound may be prepared by synthesis from commercially available starting materials containing asymmetric or chiral centers, or by preparing a racemic mixture followed by resolution methods well known to those skilled in the art. Examples of these separation methods are as follows: (1) linking a mixture of enantiomers to a chiral auxiliary, separating the resulting diastereomer mixture by recrystallization or chromatography, and optionally releasing the optically pure product from the auxiliary, as described in Furniss, Hannaford, Smith, and Tatchell, “Vogel's Textbook of Practical Organic Chemistry,” 5th edition (1989), Longman Scientific & Technical, Essex CM202JE, England; (2) directly separating a mixture of optically enantiomers on a chiral chromatographic column; or (3) fractionation-recrystallization methods.

[0087] It should be understood that the compound may exist in different tautomer forms, and all such forms are included within the scope of this disclosure.

[0088] This disclosure also includes isotopically labeled compounds, which are the same as those described in formula (I), but in the fact that one or more atoms are replaced by atoms having atomic masses or mass numbers different from those normally found in nature. Examples of isotopes suitable for inclusion in the compounds of this invention are hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, and chlorine, respectively such as, but not limited to, those listed below. 2 H, 3 H, 13 C 14 C 15 N、 18 O、 17 O、 31 P, 32 P, 35 S, 18 F and 36 Cl. Using heavier isotopes such as deuterium ( 2 H) substitution can provide certain therapeutic advantages resulting from greater metabolic stability, such as increased in vivo half-life or reduced dose requirements, and is therefore preferred in some cases. The compound can be combined with a positron emission isotope for medical imaging and positron emission tomography (PET) studies to determine receptor distribution. Suitable positron emission isotopes that can be incorporated into compounds of formula (I) are:11 C 13 N、 15 O and 18 F. Isotope-labeled compounds of formula (I) can generally be prepared by conventional techniques known to those skilled in the art, or by a process similar to that described in the appended examples, using an appropriate isotope-labeled reagent instead of a non-isotope-labeled reagent.

[0089] The compounds disclosed herein can exist in both solvated and non-solvated forms with pharmaceutically acceptable solvents such as water and ethanol, and this disclosure is intended to cover both solvated and non-solvated forms. In one embodiment, the compound is amorphous. In one embodiment, the compound is a single polymorph. In another embodiment, the compound is a mixture of polymorphs. In yet another embodiment, the compound is crystalline.

[0090] a. Pharmaceutically acceptable salt The disclosed compounds can exist as pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt" refers to a salt or zwitterion of a compound that is water-soluble, oil-soluble, or dispersible, suitable for treating a condition without excessive toxicity, irritation, or allergic reactions, commensurate with a reasonable benefit / risk ratio, and effective for its intended use. The salt can be prepared during the final separation and purification of the compound, or separately by reacting the amino group of the compound with a suitable acid. For example, the compound can be dissolved in a suitable solvent, such as, but not limited to, methanol and water, and treated with at least one equivalent of an acid (such as hydrochloric acid). The resulting salt can be precipitated, separated by filtration, and dried under reduced pressure. Alternatively, the solvent and excess acid can be removed under reduced pressure to provide the salt. Representative salts include acetates, adipates, alginates, citrates, aspartates, benzoates, benzenesulfonates, hydrogen sulfates, butates, camphorates, camphorsulfonates, diglucose, glyceryl phosphates, hemisulfates, heptahydrates, hexanoates, formates, hydroxyethanesulfonates, fumarates, lactates, maleates, methanesulfonates, naphthalenesulfonates, nicotinates, oxalates, dihydroxynaphthalate, pectates, persulfates, 3-phenylpropionates, picrates, oxalates, maleates, pivalates, propionates, succinates, tartrates, trichloroacetates, trifluoroacetates, glutamates, p-toluenesulfonates, undecanoates, hydrochlorides, hydrobromates, sulfates, and phosphates. The amino groups of these compounds can also undergo quaternization with alkyl chlorides, bromides, and iodides such as methyl, ethyl, propyl, isopropyl, butyl, lauryl, myristyl, and stearyl groups.

[0091] Basic addition salts can be prepared during the final separation and purification of the disclosed compounds by reacting the carboxyl group with a suitable base, such as a hydroxide, carbonate, or bicarbonate of a metal cation (e.g., lithium, sodium, potassium, calcium, magnesium, or aluminum), or an organic primary, secondary, or tertiary amine. Quaternary ammonium salts, such as those derived from methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine, tributylamine, pyridine, N,N-dimethylaniline, N-methylpiperidine, N-methylmorpholine, dicyclohexylamine, procaine, dibenzylamine, N,N-dibenzylphenethylamine, 1-diphenylhydroxymethylamine, and N,N'-dibenzylethylenediamine, ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine, etc.

[0092] b. Synthesis method On the other hand, this document discloses methods for preparing compounds of formula (I) or pharmaceutically acceptable salts thereof. In summary, compounds of formula (I) and pharmaceutically acceptable salts thereof can be prepared by any method known to be suitable for the preparation of chemically related compounds. Exemplary suitable synthetic schemes are provided in the Examples section.

[0093] Compounds and intermediates can be separated and purified using methods well known to those skilled in the art of organic synthesis. Examples of conventional methods for separating and purifying compounds include, but are not limited to, chromatography on a solid support (such as silica gel, alumina, or silica derived from alkylsilyl groups), recrystallization at high or low temperatures with optional pretreatment with activated carbon, thin-layer chromatography, distillation under various pressures, sublimation under vacuum, and wet milling, as described, for example, in “Vogel’s Textbook of Practical Organic Chemistry,” 5th edition (1989), Furniss, Hannaford, Smith, and Tatchell, pub. Longman Scientific & Technical, Essex CM20 2JE, England.

[0094] The reaction conditions and time for each individual step can vary depending on the specific reactants used and the substituents present in them. The reaction can be carried out in a conventional manner, for example by removing the solvent from the residue, and further purified according to methods generally known in the art, such as, but not limited to, crystallization, distillation, extraction, wet milling, and chromatography. Unless otherwise described, the starting materials and reagents are commercially available or can be prepared from commercially available materials by those skilled in the art using methods described in the chemical literature.

[0095] Routine experiments, including appropriate manipulation of reaction conditions, reagents, and the sequence of synthetic routes, protection of any chemical functionalities incompatible with the reaction conditions, and deprotection at appropriate points in the reaction sequence of the method, are all within the scope of this disclosure. Suitable protecting groups and methods for protecting and deprotecting different substituents using such suitable protecting groups are well known to those skilled in the art; examples can be found in PGM Wuts and TW Greene, in Greene’s book entitled Protective Groups in Organic Synthesis (4th Edition), John Wiley & Sons, NY (2006).

[0096] When the optically active form of the disclosed compound is required, it can be obtained by using one of the procedures described herein with an optically active starting material (e.g., asymmetric induction via appropriate reaction steps) or by resolving a mixture of stereoisomers of the compound or intermediate using standard procedures (such as chromatographic separation, recrystallization, or enzymatic resolution).

[0097] Similarly, when pure geometric isomers of a compound are required, they can be obtained by using pure geometric isomers as starting materials through one of the procedures described herein, or by using standard procedures (such as chromatographic separation) to resolve mixtures of geometric isomers of the compound or intermediate.

[0098] The described synthesis schemes and specific embodiments are illustrative and should not be construed as limiting the scope of this disclosure or the claims. Alternatives, modifications, and equivalents to the synthesis methods and specific examples are considered.

[0099] Pharmaceutical Composition The disclosed compounds may be incorporated into pharmaceutical compositions suitable for administration to subjects (such as patients, who may be human or non-human). The pharmaceutical composition may contain a "therapeutic effective amount" or a "preventive effective amount." A "therapeutic effective amount" refers to an effective amount that achieves the desired therapeutic outcome at the necessary dose and time period. The therapeutic effective amount of a composition can be determined by those skilled in the art and can vary based on factors such as an individual's disease state, age, sex, and weight, as well as the composition's ability to elicit the desired response in the individual. A therapeutic effective amount is also an amount in which any toxic or adverse effects of the disclosed compounds outweigh the therapeutically beneficial effects. A "preventive effective amount" refers to an effective amount that achieves the desired preventive effect at the necessary dose and time period. Typically, because a preventive dose is administered to a subject before or at an early stage of the disease or illness, the preventive effective amount will be less than the therapeutic effective amount.

[0100] Pharmaceutical compositions may contain pharmaceutically acceptable carriers. As used herein, the term "pharmaceutically acceptable carrier" means a non-toxic, inert solid, semi-solid, or liquid filler, diluent, encapsulating material, or any type of formulation adjuvant. Some examples of materials that can serve as pharmaceutically acceptable carriers are sugars, such as, but not limited to, lactose, glucose, and sucrose; starches, such as, but not limited to, corn starch and potato starch; cellulose and its derivatives, such as, but not limited to, sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; tragali powder; malt; gelatin; talc; excipients, such as, but not limited to, cocoa butter and suppository waxes; oils, such as, but not limited to, peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols; such as propylene glycol; esters, such as, but not limited to, ethyl oleate and ethyl laurate; agar; buffers, such as, but not limited to, magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol and phosphate buffer solutions; and other non-toxic and compatible lubricants, such as, but not limited to, sodium dodecyl sulfate and magnesium stearate. Colorants, release agents, coating agents, sweeteners, flavoring agents and aroma enhancers, preservatives, and antioxidants may also be present in the composition, at the formulator's discretion.

[0101] Therefore, compounds and their pharmaceutically acceptable salts can be formulated for administration by means of, for example, solid dosage forms, eye drops, topical oil-based formulations, injection, inhalation (by mouth or nose), implantation, or oral, buccal, parenteral, or rectal administration. Techniques and formulations are generally available at Remington's Pharmaceutical Sciences (Meade Publishing Co., Easton, Pennsylvania). Therapeutic compositions must generally be sterile and stable under the conditions of manufacture and storage.

[0102] The route of administration of the disclosed compound and the form of the composition will determine the type of carrier to be used. The composition can be in various forms, such as those suitable for systemic administration (e.g., oral, rectal, nasal, sublingual, buccal, implant, or parenteral) or topical administration (e.g., dermal, lung, nasal, ear, eye, liposome delivery system, or iontophoresis).

[0103] Carriers for systemic application typically include at least one of the following: diluents, lubricants, binders, disintegrants, colorants, flavorings, sweeteners, antioxidants, preservatives, flow aids, solvents, suspending agents, wetting agents, surfactants, or combinations thereof. All carriers are optional in the composition.

[0104] Suitable diluents include sugars such as glucose, lactose, dextrose, and sucrose; glycols such as propylene glycol; calcium carbonate; sodium carbonate; sugar alcohols such as glycerol; mannitol; and sorbitol. The amount of one or more diluents in a systemic or topical composition is typically from about 50% to about 90% by weight of the composition.

[0105] Suitable lubricants include silica, talc, stearic acid and its magnesium and calcium salts, calcium sulfate; and liquid lubricants such as polyethylene glycol and vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter. The amount of one or more lubricants in a whole-body or topical composition is typically from about 5% to about 10% by weight of the composition.

[0106] Suitable binders include polyvinylpyrrolidone; magnesium aluminum silicate; starches, such as corn starch and potato starch; gelatin; tragali gum; and cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, methyl cellulose, microcrystalline cellulose, and sodium carboxymethyl cellulose. The amount of one or more binders in the whole-body composition is typically from about 5% to about 50% by weight of the composition.

[0107] Suitable disintegrants include agar, alginate and its sodium salt, effervescent mixtures, croscarmellose, crospovidone, sodium carboxymethyl starch, sodium glycolate starch, clay, and ion exchange resins. The amount of one or more disintegrants in a systemic or topical composition is typically from about 0.1% to about 10% by weight of the composition.

[0108] Suitable colorants include those such as FD&C dyes. When used, the amount of colorant in a whole-body or topical composition is typically from about 0.005% to about 0.1% by weight of the composition.

[0109] Suitable flavorings include menthol, peppermint, and fruit flavorings. When used, the amount of one or more flavorings in a whole-body or topical composition is typically from about 0.1% to about 1.0%.

[0110] Suitable sweeteners include aspartame and saccharin. When used, the amount of one or more sweeteners in a whole-body or topical composition is typically from about 0.001% to about 1% by weight of the composition.

[0111] Suitable antioxidants include butylated hydroxyanisole (“BHA”), butylated hydroxytoluene (“BHT”), and vitamin E. The amount of one or more antioxidants in a systemic or topical composition is typically from about 0.1% to about 5% by weight of the composition.

[0112] Suitable preservatives include benzalkonium chloride, methylparaben, and sodium benzoate. The amount of one or more preservatives in a systemic or topical composition is typically from about 0.01% to about 5% by weight of the composition.

[0113] Suitable flow aids include silica. The amount of one or more flow aids in a systemic or topical composition is typically from about 1% to about 5% by weight of the composition.

[0114] Suitable solvents include water, isotonic saline, ethyl oleate, glycerol, hydroxylated castor oil, alcohols (such as ethanol), and phosphate buffer solutions. The amount of one or more solvents in a systemic or topical composition is typically from about 0 to about 100% by weight of the composition.

[0115] Suitable suspending agents include AVICEL RC-591 (from FMC Corporation in Philadelphia, Pennsylvania) and sodium alginate. The amount of one or more suspending agents in a systemic or topical composition is typically from about 1% to about 8% by weight of the composition.

[0116] Suitable surfactants include lecithin, polysorbate 80, and sodium lauryl sulfate, as well as TWEENS from Atlas Powder Company, Wilmington, Delaware. Suitable surfactants include those disclosed in CTFA Cosmetic Ingredient Handbook, 1992, pp. 587-592; Remington's Pharmaceutical Sciences, 15th Edition, 1975, pp. 335-337; and McCutcheon, Vol. 1, Emulsifiers & Detergents, 1994, North American Edition, pp. 236-239. The amount of one or more surfactants in a systemic or topical composition is typically from about 0.1% to about 5% by weight of the composition.

[0117] Although the amounts of components in a systemic composition may vary depending on the type of systemic composition being prepared, generally a systemic composition contains 0.01% to 50% by weight of the active compound and 50% to 99.99% by weight of one or more carriers. Compositions for parenteral administration typically contain 0.1% to 10% by weight of the active substance and 90% to 99.9% by weight of a carrier, including diluents and solvents.

[0118] Compositions for oral administration can be in various dosage forms. For example, solid forms include tablets, capsules, granules, and bulk powders. These oral dosage forms contain a safe and effective amount, typically at least about 5% by weight, and more particularly about 25% to about 50% by weight of the active substance. Oral dosage form compositions include about 50% to about 95% by weight of a carrier, and more particularly, about 50% to about 75% by weight.

[0119] Tablets can be compressed, ground, enteric-coated, sugar-coated, film-coated, or multiple-compressed. Tablets typically contain an active ingredient and a carrier containing an ingredient selected from diluents, lubricants, binders, disintegrants, colorants, flavorings, sweeteners, gliding agents, and combinations thereof. Specific diluents include calcium carbonate, sodium carbonate, mannitol, lactose, and cellulose. Specific binders include starch, gelatin, and sucrose. Specific disintegrants include alginate and croscarmellose. Specific lubricants include magnesium stearate, stearic acid, and talc. Specific colorants are FD&C dyes, which may be added for appearance. Chewable tablets preferably contain sweeteners such as aspartame and saccharin, or flavorings such as menthol, peppermint, fruit flavorings, or combinations thereof.

[0120] Capsules (including implants, timed-release and sustained-release formulations) typically comprise an active compound (e.g., a compound of formula (I)) and a carrier comprising one or more of the disclosed diluents contained in a gelatin-containing capsule. Particles typically comprise the disclosed compounds and preferably include flow aids such as silica to improve flow properties. Implants may be of biodegradable or non-biodegradable type.

[0121] The selection of the components in the carrier of the oral composition depends on secondary considerations such as taste, cost and shelf stability, which are not important to the purposes of this disclosure.

[0122] Solid compositions can be coated using conventional methods, typically with pH or time-dependent coatings, to release the disclosed compound in the gastrointestinal tract near the desired application site, or at different points and times, to prolong the desired action. Coatings typically comprise one or more components selected from the group consisting of: cellulose acetate phthalate, polyvinyl acetate phthalate, hydroxypropyl methylcellulose phthalate, ethyl cellulose, EUDRAGIT® coating (available from Evonik Industries of Essen, Germany), waxes, and shellac.

[0123] Compositions for oral administration can be in liquid form. Suitable liquid forms include, for example, aqueous solutions, emulsions, suspensions, solutions reconstituted from non-effervescent particles, suspensions reconstituted from non-effervescent particles, effervescent formulations reconstituted from effervescent particles, elixirs, tinctures, syrups, etc. Liquid oral administration compositions typically include a disclosed compound and a carrier selected from diluents, colorants, flavorings, sweeteners, preservatives, solvents, suspending agents, and surfactants. Oral liquid compositions preferably include one or more ingredients selected from colorants, flavorings, and sweeteners.

[0124] Other compositions that can be used to achieve systemic delivery of the subject compound include sublingual, buccal, and nasal dosage forms. Such compositions typically contain one or more soluble fillers, such as diluents including sucrose, sorbitol, and mannitol; and binders such as gum arabic, microcrystalline cellulose, carboxymethyl cellulose, and hydroxypropyl methyl cellulose. Such compositions may also contain lubricants, colorants, flavorings, sweeteners, antioxidants, and flow aids.

[0125] The disclosed compounds can be applied topically. Topical compositions that can be applied topically to the skin can be in any form, including solids, solutions, oils, creams, ointments, gels, lotions, shampoos, leave-in and rinse-out conditioners, emulsions, cleansers, moisturizers, sprays, skin patches, etc. Topical compositions comprise: the disclosed compound (e.g., the compound of formula (I)) or a pharmaceutically acceptable salt thereof, and a carrier. The carrier of the topical composition preferably facilitates the penetration of the compound into the skin. The carrier may also include one or more optional components.

[0126] The amount of carrier used in conjunction with the disclosed compound is sufficient to provide the actual amount of the composition for administration per unit dose of the compound. Techniques and compositions for making the dosage form useful in the methods of this disclosure are described in the following references: Modern Pharmaceutics, Chapters 9 and 10, edited by Banker & Rhodes (1979); Lieberman et al., Pharmaceutical Dosage Forms: Tablets (1981); and Ansel, Introduction to Pharmaceutical Dosage Forms, 2nd ed. (1976).

[0127] A carrier may comprise a single component or a combination of two or more components. In a topical composition, the carrier includes a topical carrier. Suitable topical carriers include one or more components selected from phosphate-buffered saline, isotonic water, deionized water, monofunctional alcohols, symmetrical alcohols, aloe vera gel, allantoin, glycerin, vitamin A and E oils, mineral oil, propylene glycol, PPG-2 myristyl propionate, dimethyl isosorbide, castor oil, and combinations thereof. More particularly, carriers for dermal applications include propylene glycol, dimethyl isosorbide, and water, and even more particularly, phosphate-buffered saline, isotonic water, deionized water, monofunctional alcohols, and symmetrical alcohols.

[0128] The carrier of the topical composition may also include one or more components selected from emollients, propellants, solvents, humectants, thickeners, powders, fragrances, pigments, and preservatives, all of which are optional.

[0129] Suitable emollients include stearyl alcohol, glyceryl monoricinoleate, glyceryl monostearate, propylene-1,2-diol, butyl-1,3-diol, mink oil, cetyl alcohol, isopropyl isostearate, stearic acid, isobutyl palmitate, isohexadecanyl stearate, oleyl alcohol, isopropyl lauryl acid, hexyl lauryl acid, decyl oleate, octadecane-2-ol, isohexadecanol, hexadecyl palmitate, di-n-butyl sebacate, isopropyl myristate, isopropyl palmitate, isopropyl stearate, butyl stearate, polyethylene glycol, triethylene glycol, lanolin, sesame oil, coconut oil, peanut oil, castor oil, acetylated lanolin alcohol, petroleum, mineral oil, butyl myristate, isostearic acid, palmitic acid, isopropyl linoleate, lauryl lactate, myristyl lactate, decyl oleate, myristyl myristate, and combinations thereof. Specific emollients used on the skin include stearyl alcohol and polydimethylsiloxane. The amount of one or more emollients in a skin-based topical composition is typically from about 5% to about 95% by weight of the composition.

[0130] Suitable propellants include propane, butane, isobutane, dimethyl ether, carbon dioxide, nitrous oxide, and combinations thereof. The amount of one or more propellants in a local composition is typically from about 0% to about 95% by weight of the composition.

[0131] Suitable solvents include water, ethanol, dichloromethane, isopropanol, castor oil, ethylene glycol monoethyl ether, diethylene glycol monobutyl ether, diethylene glycol monoethyl ether, dimethyl sulfoxide, dimethylformamide, tetrahydrofuran, and combinations thereof. Specific solvents include ethanol and isotopic alcohols. The amount of one or more solvents in a topical composition is typically from about 0% to about 95% by weight of the composition.

[0132] Suitable moisturizers include glycerin, sorbitol, sodium 2-pyrrolidone-5-carboxylate, soluble collagen, dibutyl phthalate, gelatin, and combinations thereof. Specific moisturizers include glycerin. The amount of one or more moisturizers in a topical composition is typically from 0% to 95% by weight of the composition.

[0133] The amount of one or more thickeners in a local composition is typically from about 0% to about 95% by weight of the composition.

[0134] Suitable powders include β-cyclodextrin, hydroxypropyl cyclodextrin, chalk, talc, fullerene, kaolin, starch, gum, colloidal silica, sodium polyacrylate, tetraalkylmontmorillonite ammonium, trialkylarylmontmorillonite ammonium, chemically modified magnesium aluminum silicate, organically modified montmorillonite clay, hydrated aluminum silicate, fumed silica, carboxyvinyl polymers, sodium carboxymethyl cellulose, ethylene glycol monostearate, and combinations thereof. The amount of one or more powders in the topical composition is typically from 0% to 95% by weight of the composition.

[0135] The amount of fragrance in a local composition is typically from about 0% to about 0.5% by weight of the composition, particularly from about 0.001% to about 0.1%.

[0136] Suitable pH-adjusting additives include HCl or NaOH, in amounts sufficient to adjust the pH of the topical drug composition.

[0137] How to use The disclosed compounds and pharmaceutical compositions can be used in methods for treating conditions including proliferative conditions such as cancer. In some embodiments, the cancer is characterized by or mediated by BCL6 activity. In some embodiments, the cancer is a cancer in which BCL6 and p300 / CBP are expressed.

[0138] Therefore, in some embodiments, this document discloses a method for treating a condition in a subject of need, wherein the condition is characterized by or mediated by BCL6 activity, or cancer in which BCL6 and p300 / CBP are expressed, the method comprising: administering to the subject a therapeutically effective amount of a compound disclosed herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition comprising a compound disclosed herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof). In some embodiments, the condition is a proliferative disease, i.e., a disease resulting from abnormal growth or expansion due to cell proliferation. In some embodiments, a proliferative disease is cancer. The term "cancer" refers to a class of diseases characterized by the uncontrolled proliferation of abnormal cells and their ability to infiltrate and destroy normal body tissues. See example like Stedman's Medical Dictionary, 25th edition; edited by Hensyl; Williams & Wilkins: Philadelphia, 1990.

[0139] In some embodiments, the compounds and pharmaceutical compositions disclosed herein are used to treat cancer in patients of need. In some embodiments, the cancer is a cancer in which BCL6 is mutated. In some embodiments, the cancer is a cancer in which BCL6 is highly expressed, or overexpressed relative to non-cancerous cells.

[0140] In some implementations, cancer is a solid tumor, such as a sarcoma or carcinoma. In some implementations, cancer is a hematologic malignancy.

[0141] Exemplary sarcomas include, but are not limited to, alveolar rhabdomyosarcoma, alveolar soft tissue sarcoma, ameloblastoma, angiosarcoma, chondrosarcoma, chordoma, clear cell sarcoma of soft tissue, dedifferentiated liposarcoma, desmoid fibroma, connective tissue proliferative small round cell tumor, embryonal rhabdomyosarcoma, epithelioid fibrosarcoma, epithelioid hemangioendothelioma, epithelioid sarcoma, olfactory neuroblastoma, Ewing's sarcoma, extrarenal rhabdomyosarcoma, extraosseous myxoid chondrosarcoma, extraosseous osteosarcoma, fibrosarcoma, giant cell tumor, hemangiopericytoma, infantile fibrosarcoma, inflammatory myofibroblastoma, Kaposi's sarcoma, bone leiomyosarcoma, liposarcoma, and bone Liposarcoma, Malignant fibrous histiocytoma (MFH), Malignant fibrous histiocytoma of bone (MFH), Malignant mesenchymal tumor, Malignant peripheral nerve sheath tumor, Mesenchymal chondrosarcoma, Myxofibrosarcoma, Myxoid liposarcoma, Myxoid inflammatory fibroblastic sarcoma, Tumors with perivascular epithelioid cell differentiation, Osteosarcoma, Periosteal osteosarcoma, Vesicles with perivascular epithelioid cell differentiation, Periosteal osteosarcoma, Pleomorphic liposarcoma, Pleomorphic rhabdomyosarcoma, PNET / extraosseous Ewing's tumor, Rhabdomyosarcoma, Round cell liposarcoma, Small cell osteosarcoma, Solitary fibrous tumor, Synovial sarcoma, and Capillary hemangiosarcoma.

[0142] Exemplary cancers include, but are not limited to, adenocarcinoma, squamous cell carcinoma, adenosquamous carcinoma, undifferentiated carcinoma, large cell carcinoma, small cell carcinoma, anal cancer, appendix cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain tumor, breast cancer, cervical cancer, colon cancer, carcinoma of unknown primary origin (CUP), esophageal cancer (e.g., esophageal squamous cell carcinoma), eye cancer, fallopian tube cancer, gastrointestinal cancer, kidney cancer, liver cancer (e.g., hepatocellular carcinoma), lung cancer, myeloid tumor, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary adenoma, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer, pharyngeal cancer, thyroid cancer, uterine cancer, vaginal cancer, and vulvar cancer.

[0143] Exemplary hematologic malignancies include, but are not limited to, leukemia, lymphoma, myeloma, non-Hodgkin lymphoma, Hodgkin lymphoma, T-cell malignancies, and B-cell malignancies. Exemplary T-cell malignancies include anaplastic large cell lymphoma, angioimmunoblastic lymphoma, adult T-cell leukemia / lymphoma (ATLL), blastic NK-cell lymphoma, cutaneous T-cell lymphoma, enteropathy-type T-cell lymphoma, blood-splenic γδ T-cell lymphoma, lymphoblastic lymphoma, nasal NK / T-cell lymphoma, peripheral T-cell lymphoma (PTCL-NOS) not otherwise specified, and treatment-related T-cell lymphoma. Exemplary B-cell malignancies include chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high-risk CLL, and non-CLL / SLL lymphoma. In some implementations, the cancer is selected from B-cell pre-lymphocytic leukemia, Burkitt lymphoma, diffuse large B-cell lymphoma (DLBCL), extranodal marginal zone B-cell lymphoma, follicular lymphoma (FL), immunoblastic large cell lymphoma, intravascular large B-cell lymphoma, lymphomatoid granuloma, lymphoplasmacytic lymphoma, mantle cell lymphoma (MCL), mediastinal (thymic) large B-cell lymphoma, multiple myeloma, extranodal marginal zone B-cell lymphoma, non-Burkkitt high-grade B-cell lymphoma, plasmacytoma, plasmacytoma, precursor B-lymphoblastic lymphoma, primary exudative lymphoma, primary mediastinal B-cell lymphoma (PMBL), splenic marginal zone lymphoma, or Waldenström macroglobulinemia. In some implementations, the cancer is diffuse large B-cell lymphoma (DLBCL).

[0144] In some implementations, the cancer is a recurrent or refractory cancer, such as the cancer described herein. In some implementations, the cancer is a metastatic cancer, such as the cancer described herein.

[0145] In the treatment methods disclosed herein, the compound or pharmaceutical composition may be administered to the subject via any convenient route of administration, whether systemic / peripheral or at the desired site of action, including but not limited to oral (e.g., by ingestion); local (e.g., percutaneous, intranasal, ocular, buccal, and sublingual); pulmonary (e.g., by using an aerosol, such as an inhalation or blowing therapy through the mouth or nose); rectal; vaginal; parenteral (e.g., by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarticular, intracardiac, intrasheath, intraspinal, intracapsular, intraorbital, intraperitoneal, intratracheal, subepidermal, intra-articular, subarachnoid, and intrasternal); or by implantation of a reservoir, such as subcutaneous or intramuscular. In some embodiments, administration includes oral administration. In some embodiments, administration includes parenteral administration. Additional modes of administration may include adding the compound and / or a composition containing the compound to food or beverages, including drinking water for animals, to provide the compound as part of the animal's diet.

[0146] It should be recognized that the appropriate dosage of the compound and compositions containing the compound may vary from patient to patient. Determining the optimal dosage will generally involve balancing the level of therapeutic benefit with any risks or adverse side effects of the treatment disclosed herein. The selected dosage level will depend on a variety of factors, including, but not limited to, the activity of the specific compound, route of administration, time of administration, rate of excretion of the compound, duration of treatment, other drugs, compounds and / or materials used in combination, and the patient's age, sex, weight, condition, general health status and prior medical history. The amount of the compound and the route of administration will ultimately be determined by the physician, but the overall dosage will achieve a local concentration at the site of action that achieves the desired effect without causing generally harmful or toxic side effects.

[0147] Internal administration can be achieved throughout the treatment process as a single dose, continuously or intermittently (e.g., in fractions at appropriate intervals). Methods for determining the most effective mode of administration and dosage are well known to those skilled in the art and will vary depending on the formulation used for treatment, the therapeutic purpose, the target cells being treated, and the subject being treated. Single or multiple administrations can be performed based on the dose level and pattern selected by the treating physician. Typically, appropriate doses of the compound are in the range of approximately 100 μg / kg of subject body weight per day to approximately 250 mg / kg of subject body weight per day.

[0148] The compound or composition may be administered once, continuously (e.g., by intravenous infusion), or periodically / intermittently, including approximately once an hour, approximately once every two hours, approximately once every four hours, approximately once every eight hours, approximately once every twelve hours, approximately once daily, approximately once every two days, approximately once every three days, approximately twice a week, approximately once a week, and approximately once a month. The composition may be administered until the desired symptom relief is achieved.

[0149] The compounds described herein can be used in combination with other known therapies. As used herein, “combination” administration means delivering two (or more) different treatments to a subject during the course of suffering from a condition, for example, after the subject has been diagnosed with the condition and before the condition is cured or eliminated or treatment is discontinued for other reasons. In some embodiments, the delivery of one treatment is still in progress when the delivery of the second treatment begins, thus there is an overlap in administration. This is sometimes referred to herein as “simultaneous delivery” or “parallel delivery.” In other embodiments, the delivery of one treatment ends before the delivery of the other treatment begins. In some embodiments of either case, the treatment is more effective due to combination administration. For example, the second treatment is more effective than observed when the second treatment is administered without the first treatment; for example, the same effect is observed with less of the second treatment, or the second treatment alleviates symptoms to a greater extent, or a similar situation is observed with the first treatment. In some embodiments, the delivery results in a greater reduction in symptoms or other condition-related parameters than observed when the first treatment is administered without the other treatment. The effects of the two treatments can be partially additive, fully additive, or more additive. Delivery can be made in such a way that the effect of the first treatment can still be detected when the second treatment is delivered.

[0150] The compounds or compositions described herein may be administered simultaneously, in the same or separate compositions, or sequentially with at least one other therapeutic agent. For sequential administration, the compounds described herein may be administered first, and the other agent may be administered subsequently, or the order of administration may be reversed.

[0151] In some embodiments, the compounds described herein are administered in combination with other therapeutic modalities, including surgery, radiation, transplantation (e.g., stem cell transplantation, bone marrow transplantation), cryotherapy, and / or thermotherapy. Such combination therapies may allow for lower doses of the administered agents and / or other chemotherapeutic agents, thereby avoiding the toxicities or complications associated with various therapies.

[0152] In some embodiments, the compounds described herein are administered together with at least one additional therapeutic agent, such as a chemotherapeutic agent. In some embodiments, the compounds described herein are administered in combination with one or more additional chemotherapeutic agents. The chemotherapeutic agents may be those identified in the National Cancer Institute's "List of Cancer Drugs A through Z".

[0153] This document also discloses a method for reducing the proliferation of cancer cells in a sample, the method comprising contacting the sample with a compound described herein (e.g., a compound of formula (I) or a pharmaceutically acceptable salt thereof) or a pharmaceutical composition described herein.

[0154] medicine box The compounds and / or compositions disclosed herein can be assembled into a kit or pharmaceutical system. The kit or pharmaceutical system may include a carrier or packaging such as a box, carton, tube, etc., having one or more tightly sealed containers, such as vials, tubes, ampoules, or bottles, containing a compound of formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition containing a compound of formula (I) or a pharmaceutically acceptable salt thereof. The kit or pharmaceutical system may also include printed instructions for use of the compound and / or composition.

[0155] The following examples further illustrate aspects of this disclosure, but should not be construed as limiting its scope in any way.

[0156] Example The following abbreviations are used in the embodiments: DIPEA is N , N -Diisopropylethylamine; DMF is N , N -Dimethylformamide; DMSO is dimethyl sulfoxide; HATU is 1-[bis(dimethylamino)methylene]-1 H -1,2,3-triazolo[4,5- b Pyridinium 3-oxide hexafluorophosphate; HPLC is high performance liquid chromatography; TFA is trifluoroacetic acid; and UP-LC is ultra-high performance liquid chromatography.

[0157] Example 1: Compound Synthesis Procedure A (MNN-02-155): Add HATU (7.61 mg, mmol, 1.50 equivalent) to a solution of 5-((tert-butoxycarbonyl)amino)valerate (4.35 mg, 0.0200 mmol, 1.50 equivalent) in anhydrous DMF (300 uL, 0.05 M) and DIPEA (6.97 uL, 0.0400 mmol, 3.00 equivalent) at 0 °C under nitrogen. The reaction was stirred at 0 °C for 15 minutes, and then 3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1-(piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide (7.00 mg, 0.0133 mmol, 1.00 equivalent) (1 mg / 10 μL) dissolved in DMSO was added dropwise. The reaction was stirred for 3 hours, at which point the product mass of acceptable purity was observed by UP-LC (MS m / z 724.62 [M+H)). +The reactants were diluted in water, and the product was extracted three times with ethyl acetate, dried over Na2SO4, and concentrated under vacuum. The crude product was then dissolved in 500 μL of dichloromethane and 100 μL of TFA and stirred at room temperature for 1 hour. The solution was then concentrated under vacuum, azeotropically mixed with dichloromethane three times, and left to stand under vacuum for 12 hours.

[0158] Procedure B (MNN-02-155): Add DIPEA (11.7 μL, 0.0673 mmol, 7.00 equivalent) and HATU (5.49 mg, 0.0144 mmol, 1.50 equivalent) to a solution of 1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinolin-6-yl)amino)pyrimidin-2-yl)piperidin-4-carboxylic acid (7.66 mg, 0.0144 mmol, 1.50 equivalent) in DMF (200 μL, 0.05 M) and stir the mixture at 0 °C under nitrogen for 15 minutes. Then, the product of procedure A (6.00 mg, 0.00962 mmol, 1.00 equivalent) dissolved in 200 μL DMF was added dropwise, and the mixture was stirred for 12 hours. The reaction mixture was directly purified by preparative HPLC (85%–20% water (0.05% TFA) / methanol). The product 1-(1-(5-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidin-4-carboxamido)pentanoyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide (4.28 mg, 40%, MS m / z 1136.52 [M+H]) was obtained as a white solid. + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 9.03 (s, 1H), 8.10 (d, J = 6.0 Hz, 1H), 7.95 (q, J = 4.5 Hz, 1H), 7.79 (t, J= 5.6 Hz, 1H),7.73 (s, 1H), 7.51 (s, 2H), 7.48 (s, 1H), 7.08 (s, 1H), 7.01 (s, 1H), 6.78(s, 1H), 6.77 (t, J = 55.3 Hz, 1H), 6.54 (s, 1H), 4.55 (s, 2H), 4.49 – 4.43(m, 3H), 4.31 (td, J = 10.6, 5.4 Hz, 1H), 4.01 (s, 2H), 3.95 (d, J = 13.7 Hz,1H), 3.87 (d, J = 3.4 Hz, 3H), 3.85 (s, 3H), 3.85 (s, 3H), 3.60 (q, J = 6.1Hz, 2H), 3.56 (t, J = 5.6 Hz, 2H), 3.21 – 3.09 (m, 1H), 3.03 (q, J = 7.0 Hz,2H), 2.95 – 2.87 (m, 2H), 2.82 (t, J = 6.3 Hz, 2H), 2.76 – 2.71 (m, 2H), 2.68(d, J = 12.5 Hz, 1H), 2.64 (d, J = 4.7 Hz, 3H), 2.54 (s, 3H), 2.42 – 2.35 (m,1H), 2.33 (t, J = 7.3 Hz, 2H), 1.96 (q, J = 5.9 Hz, 2H), 1.91 – 1.82 (m, 3H),1.70 (d, J = 13.1 Hz, 3H), 1.58-1.43 (m, 4H), 1.40 (t, J = 7.4 Hz, 2H)。

[0159] MNN-03-037: (1-(1-(4-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidin-4-carboxamido)butyryl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide). Compound MNN-03-037 was synthesized using the linker 4-((tert-butoxycarbonyl)amino)butyric acid according to procedure A, and subsequently by procedure B to obtain the title compound (1.95 mg, 18%, MS m / z 1122.51 [M+H)). + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 9.03 (s, 1H), 8.09(s, 1H), 7.97 – 7.91 (m, 1H), 7.81 (t, J = 5.7 Hz, 1H), 7.74 (d, J = 2.6 Hz, 1H), 7.51 (d, J = 2.7 Hz, 2H), 7.49 (s, 1H), 7.08 (s, 1H), 7.00 (s, 1H), 6.78(s, 1H), 6.77 (t, J = 55.3 Hz, 1H), 6.54 (s, 1H), 4.55 (s, 2H), 4.46 (d, J =12.9 Hz, 3H), 4.35 – 4.26 (m, 1H), 4.01 (s, 2H), 3.93 (d, J = 13.4 Hz, 1H),3.86 (s, 3H), 3.85 (s, 3H), 3.85 (s, 3H), 3.66-3.58 (m, 2H), 3.56 (t, J = 5.7Hz, 2H), 3.14 (d, J = 12.3 Hz, 1H), 3.05 (q, J = 6.6 Hz, 2H), 2.96 – 2.87 (m,2H), 2.81 (d, J = 6.5 Hz, 2H), 2.73 (d,J = 5.5 Hz, 2H), 2.69 (d, J = 12.7Hz, 1H), 2.64 (d, J = 4.7 Hz, 3H), 2.54 (s, 3H), 2.42 – 2.36 (m, 1H), 2.33(t, J = 7.5 Hz, 2H), 1.95 (p, J = 6.3 Hz, 2H), 1.87 (d, J = 17.1 Hz, 3H),1.75 – 1.68 (m, 3H), 1.62 (p, J = 7.2 Hz, 2H), 1.50 (td, J = 12.2, 8.6 Hz, 2H).

[0160] MNN-02-195: 1-(1-(6-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidin-4-carboxamido)hexanoyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-195 was synthesized using the linker 6-((tert-butoxycarbonyl)amino)hexanoic acid according to procedure A, and subsequently by procedure B to obtain the title compound (3.52 mg, 20%, MS m / z 1150.53 [M+H)). + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 9.12 (s, 1H), 8.12 (d, J = 5.5 Hz, 1H), 7.95 (q, J = 4.5 Hz, 1H), 7.77 (t, J = 5.6 Hz, 1H), 7.73(s, 1H), 7.51 (s, 2H), 7.48 (s, 1H), 7.08 (s, 1H), 7.01 (s, 1H), 6.78 (s,1H), 6.77 (t, J= 55.2 Hz, 1H), 6.54 (s, 1H), 4.55 (s, 2H), 4.44 (d, J = 13.2Hz, 3H), 4.36 – 4.26 (m, 1H), 4.01 (s, 2H), 3.95 (d, J = 13.2 Hz, 1H), 3.86(s, 3H), 3.85 (s, 3H), 3.85 (s, 3H), 3.60 (q, J = 5.8 Hz, 2H), 3.56 (t, J =5.6 Hz, 2H), 3.15 (t, J = 12.0 Hz, 1H), 3.01 (q, J = 6.8 Hz, 2H), 2.93 (t, J = 12.5 Hz, 2H), 2.82 (t, J = 6.5 Hz, 2H), 2.73 (t, J = 5.9 Hz, 2H), 2.71 –2.66 (m, 1H), 2.64 (d, J = 4.6 Hz, 3H), 2.54 (s, 3H), 2.41 – 2.34 (m, 1H),2.31 (t, J = 7.5 Hz, 2H), 1.95 (t, J = 5.8 Hz, 2H), 1.91 – 1.83 (m, 3H), 1.71(dd, J = 13.2, 3.7 Hz, 3H), 1.49 (dt, J = 14.5, 5.6 Hz, 4H), 1.39 (p, J = 7.1Hz, 2H), 1.25 (qd, J = 8.5, 5.8 Hz, 2H)。

[0161] RCS-SBM-IJD-001: 1-(1-(7-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidin-4-carboxyamido)heptanoyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound RCS-SBM-IJD-001 was synthesized using the linker 8-((tert-butoxycarbonyl)amino)octanoic acid according to procedure A, and subsequently by procedure B to obtain the title compound (3.92 mg, 18%, MS m / z 1165.48 [M+H]). + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 9.16 (s, 1H),8.12 (s, 1H), 7.95 (q, J = 4.6 Hz, 1H), 7.76 (t, J = 5.6 Hz, 1H), 7.73 (s,1H), 7.50 (s, 2H), 7.48 (d, J = 0.8 Hz, 1H), 7.08 (s, 1H), 7.01 (s, 1H), 6.79(s, 1H), 6.77 (t, J = 55.2 Hz, 1H), 6.53 (s, 1H), 4.55 (s, 2H, assigned by HSQC), 4.46 – 4.40 (3H, assigned by HSQC), 4.35 – 4.27 (m, 1H, assigned by HSQC), 4.01 (s, 2H), 3.95 (d, J = 13.6 Hz, 1H), 3.86 (s, 3H), 3.86 (s, 3H), 3.85 (s, 3H), 3.60 (q, J = 5.8 Hz, 2H), 3.56 (t, J = 5.7 Hz, 2H), 3.15 (t, J = 12.5 Hz, 1H), 3.00(q, J = 6.6 Hz, 2H), 2.97 – 2.89 (m, 2H), 2.82 (t, J= 6.3 Hz, 2H), 2.73 (t, J = 6.0 Hz, 2H), 2.68 (d, J = 12.1 Hz, 1H), 2.64 (d, J = 4.6 Hz, 3H), 2.54(s, 3H), 2.42 – 2.34 (m, 1H), 2.31 (t, J = 7.5 Hz, 2H), 1.96 (p, J = 6.3 Hz, 2H), 1.88 (dd, J = 18.7, 8.7 Hz, 3H), 1.74 – 1.68 (m, 3H), 1.56 – 1.42 (m,4H), 1.36 (q, J = 7.0 Hz, 2H), 1.25 (d, J = 5.4 Hz, 4H).

[0162] MNN-02-196: 1-(1-(8-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidin-4-carboxamido)octanoyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-196 was synthesized using the linker 8-((tert-Butoxycarbonyl)amino)octanoic acid according to procedure A, and subsequently by procedure B to obtain the title compound (1.43 mg, 8%, MS m / z 1180.09 [M+H]). + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 8.86 (d, J = 8.5 Hz, 1H), 8.06 (d, J = 8.2 Hz, 1H), 8.02 – 7.97 (m, 1H), 7.74 (q, J = 7.3 Hz, 2H), 7.52(d, J = 8.9 Hz, 2H), 7.47 (d, J = 8.9 Hz, 1H), 7.08 (d,J = 8.8 Hz, 1H), 7.00 (d, J = 8.6 Hz, 1H), 6.79 (s, 1H), 6.76 (t, 1H), 6.53 (s, 1H), 4.54 (s, 2H), 4.50 (d, J = 21.7 Hz, 3H), 4.35 – 4.26 (m, 1H), 4.00 (d, J = 8.7 Hz, 2H), 3.94 (d, J = 13.2 Hz, 1H), 3.87 (d, J = 2.2 Hz, 3H), 3.86 – 3.82 (m, 6H), 3.68 - 3.34 (4H, assigned by HSQC), 3.14 (q, J = 10.1 Hz, 1H), 3.00 (q, J = 6.7 Hz, 2H), 2.88 (t, J = 12.1 Hz, 2H), 2.82 (t, J = 6.5 Hz, 2H), 2.73 (t, J = 6.1 Hz, 2H), 2.68 (d, J = 12.1 Hz, 1H), 2.64 (dd, J = 9.2, 4.6 Hz, 3H), 2.54 (s, 3H), 2.36 (q, J = 5.2 Hz, 1H), 2.30 (t, J = 7.5 Hz, 2H), 1.95 (q, J = 6.2 Hz, 2H), 1.86 (d, J = 10.5 Hz, 3H), 1.69 (d, J = 12.3 Hz, 3H), 1.47 (t, J = 11.0 Hz, 4H), 1.35 (d, J = 8.0 Hz, 2H), 1.29 – 1.14 (m, 6H).

[0163] MNN-02-187: 1-(1-(9-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidine-4-carboxamido)nonanoyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-187 was synthesized using the linker 9-((tert-Butoxycarbonyl)amino)nonanoic acid according to procedure A, and subsequently by procedure B to obtain the title compound (1.41 mg, 8%, MS m / z 1193.80 [M+H]). + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 8.10 (d, J = 3.5 Hz, 1H), 7.95 (q, J = 4.6 Hz, 1H), 7.79 – 7.72 (m, 2H), 7.51 (s, 2H), 7.48 (s, 1H),7.08 (s, 1H), 7.01 (d, J = 2.6 Hz, 1H), 6.79 (s, 1H), 6.76 (t, J = 55.2 Hz,1H), 6.54 (s, 1H), 4.54 (s, 2H), 4.46 (d, J = 13.1 Hz, 3H), 4.31 (s, 1H), 4.01 (s, 2H), 3.95 (d, J = 13.7 Hz, 1H), 3.88 – 3.83 (m, 9H), 3.58 (dt, J =22.9, 5.6 Hz, 4H), 3.19 – 3.11 (m, 1H), 3.09 – 2.97 (m, 2H), 2.97 – 2.87 (m,2H), 2.82 (t, J = 6.4 Hz, 2H), 2.79 – 2.71 (m, 2H), 2.69 (s, 1H), 2.64 (d, J = 4.7 Hz, 3H), 2.53 (s, 3H), 2.38 (d, J= 11.7 Hz, 2H), 2.30 (t, J = 7.4 Hz, 2H), 1.95 (p, J = 6.0 Hz, 3H), 1.89 (s, 3H), 1.70 (d, J = 13.2 Hz, 3H), 1.56– 1.42 (m, 4H), 1.38 – 1.28 (m, 2H), 1.28 – 1.20 (m, 6H).

[0164] MNN-02-197: 1-(1-(10-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidin-4-carboxamido)decyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-197 was synthesized using the linker 10-((tert-butoxycarbonyl)amino)decanoic acid according to procedure A, and subsequently by procedure B to obtain the title compound (1.41 mg, 8%, MS m / z 1207.76 [M+H)). + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 9.10 (s, 1H), 8.11 (s,1H), 7.95 (q, J = 4.6 Hz, 1H), 7.75 (t, J = 5.6 Hz, 1H), 7.74 (s, 1H), 7.51(s, 2H), 7.48 (d, J = 0.9 Hz, 1H), 7.08 (s, 1H), 7.01 (d, J = 1.8 Hz, 1H),6.79 (s, 1H), 6.77 (t, J = 55.3 Hz, 1H), 6.54 (s, 1H), 4.55 (s, 2H), 4.45 (d, J = 12.9 Hz, 3H), 4.30 (m, J = 10.4, 5.3 Hz, 1H), 4.01 (s, 2H), 3.95 (d,J =13.6 Hz, 1H), 3.87 (s, 3H), 3.86 (s, 3H), 3.85 (s, 3H), 3.65 – 3.53 (m, 4H), 3.18 – 3.09 (m, 1H), 2.99 (q, J = 6.6 Hz, 2H), 2.97 – 2.89 (m, 2H), 2.82 (t, J = 6.4 Hz, 2H), 2.73 (t, J = 5.9 Hz, 2H), 2.68 (d, J = 12.0 Hz, 1H), 2.64(d, J = 4.7 Hz, 3H), 2.54 (d, J = 1.2 Hz, 3H), 2.43 – 2.35 (m, 2H), 2.33 –2.27 (m, 2H), 1.96 (p, J = 6.3 Hz, 3H), 1.91 – 1.80 (m, 3H), 1.71 (d, J =13.3 Hz, 3H), 1.56 – 1.43 (m, 4H), 1.35 (t, J = 6.8 Hz, 2H), 1.29 – 1.20 (m,8H).

[0165] MNN-02-160: 1-(1-(11-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidine-4-carboxamido)undecyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-160 was synthesized using the linker 11-((tert-butoxycarbonyl)amino)undecanoic acid according to procedure A, and subsequently by procedure B to obtain the title compound (0.89 mg, 7%, MS m / z 1221.82 [M+H)). + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 9.07 (s, 1H), 8.10(s, 1H), 7.96 (q,J = 4.8 Hz, 1H), 7.77 (t, J = 5.6 Hz, 1H), 7.74 (d, J = 0.9Hz, 1H), 7.52 (s, 2H), 7.48 (d, J = 0.8 Hz, 1H), 7.08 (s, 1H), 7.01 (s, 1H),6.79 (s, 1H), 6.76 (t, J = 55.3 Hz, 1H), 6.55 (s, 1H), 4.55 (s, 2H), 4.47 (m, J = 13.0 Hz, 3H), 4.31 (tt, J = 10.6, 4.5 Hz, 1H), 4.01 (s, 2H), 3.98 – 3.91(m, 1H), 3.87 (s, 3H), 3.86 (s, 3H), 3.85 (s, 3H), 3.58 (m, J = 17.8, 5.3 Hz,4H), 3.15 (t, J = 12.4 Hz, 1H), 2.99 (q, J = 6.6 Hz, 2H), 2.97 – 2.88 (m,2H), 2.82 (t, J = 6.5 Hz, 2H), 2.73 (t, J = 6.0 Hz, 2H), 2.68 (d, J = 11.7Hz, 1H), 2.64 (d, J = 4.6 Hz, 3H), 2.54 (d, J = 1.7 Hz, 3H), 2.42 – 2.34 (m,1H), 2.33 – 2.27 (m, 2H), 1.96 (dt, J = 10.0, 6.3 Hz, 2H), 1.91 – 1.83 (m,3H), 1.71 (d, J = 13.2 Hz, 3H), 1.49 (dq, J = 22.0, 8.1 Hz, 4H), 1.38 – 1.32(m, 2H), 1.27 – 1.15 (m, 12H)。

[0166] MNN-02-161: 1-(1-(3-(2-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidin-4-carboxamido)ethoxy)propionyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-161 was synthesized using the linker 3-(2-((tert-butoxycarbonyl)amino)ethoxy)propionic acid according to procedure A, and subsequently by procedure B to obtain the title compound (2.52 mg, 20%, MS m / z 1152.48 [M+H)). + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 8.83(s, 1H), 8.05 (s, 1H), 7.96 (q, J = 4.6 Hz, 1H), 7.84 (t, J = 5.6 Hz, 1H),7.73 (s, 1H), 7.53 (q, J = 2.3 Hz, 2H), 7.48 (s, 1H), 7.08 (s, 1H), 6.99 (s,1H), 6.76 (t, 2H), 6.54 (d, J = 4.7 Hz, 1H), 4.54 (s, 2H), 4.47 (t, J = 18.1Hz, 3H), 4.31 (d, J = 10.2 Hz, 1H), 3.98 (d, J = 18.1 Hz, 2H), 3.96 (s, 1H), 3.91 – 3.81 (m, 9H), 3.64 – 3.52 (m, 4H), 3.38 (t, J = 5.9 Hz, 2H), 3.17 (dt, J = 5.9, 2.8 Hz, 1H), 2.87 (s, 1H), 2.81 (d, 2H), 2.73 (t, J = 5.8 Hz, 2H),2.72 – 2.68 (m, 1H), 2.64 (d, J= 4.7 Hz, 3H), 2.59 (dt, J = 12.3, 6.6 Hz,1H), 2.54 (s, 3H), 2.44 – 2.36 (m, 2H), 1.95 (p, J = 6.3 Hz, 2H), 1.87 (d, J = 22.9 Hz, 3H), 1.69 (d, J = 9.7 Hz, 4H), 1.53 – 1.43 (m, 2H), 1.29 – 1.21 (m, 2H).

[0167] MNN-02-162: 1-(1-(3-(2-(2-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidin-4-carboxamido)ethoxy)ethoxy)propionyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-162 was synthesized using a linker 2,2-dimethyl-4-oxo-3,8,11-trioxa-5-azatetradecane-14-acid according to procedure A, and subsequently by procedure B to obtain the title compound (2.91 mg, 20%, MS m / z 1196.40 [M+H]). + ). 1 HNMR (500 MHz, DMSO- d 6 ) δ = 8.85 (s, 1H), 8.06 (s, 1H), 7.95 (q, J = 4.6 Hz, 1H), 7.84 (t, J = 5.8 Hz, 1H), 7.73 (s, 1H), 7.53 (s, 2H), 7.48 (s, 1H), 7.08(s, 1H), 7.00 (s, 1H), 6.77 (t, 1H), 6.53 (d, J = 5.1 Hz, 1H), 4.54 (s, 2H), 4.47 (dd, J = 26.3, 12.9 Hz, 3H), 4.35 – 4.27 (m, 1H), 4.00 (d, J= 5.1 Hz, 2H), 3.96 (d, J = 5.9 Hz, 1H), 3.90 – 3.82 (m, 9H), 3.60–3.56 (4H, attributed by HSQC), 3.48 (s, 2H), 3.37 (t, J = 5.9 Hz, 2H), 3.16 (q, J = 6.0 Hz, 3H), 2.88(td, J = 13.0, 2.7 Hz, 2H), 2.82 (t, J = 6.4 Hz, 2H), 2.73 (q, J = 5.7 Hz,2H), 2.69 (s, 1H), 2.64 (d, J = 4.7 Hz, 3H), 2.59 (q, J = 6.5 Hz, 2H), 2.54(s, 3H), 2.40 (dh, J = 11.4, 3.7 Hz, 2H), 1.99 – 1.92 (m, 2H), 1.87 (d, J =18.6 Hz, 3H), 1.77 – 1.66 (m, 3H), 1.48 (qd, J = 12.5, 4.1 Hz, 2H), 1.29 –1.21 (m, 2H), 1.13 – 1.08 (m, 1H).

[0168] MNN-02-156: 1-(1-(1-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidin-4-yl)-1-oxo-5,8,11-trioxa-2-azatetradecano-14-acyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-02-156 was synthesized using a linker 2,2-dimethyl-4-oxo-3,8,11,14-tetraoxa-5-azaheptadecane-17-acid according to procedure A, and subsequently by procedure B to obtain the title compound. (2.00 mg, 20%, MS m / z 1241.04 [M+H]) + ). 1H NMR (500 MHz, DMSO- d 6 ) δ = 8.83 (s, 1H), 8.06 (d, J = 1.4 Hz, 1H),7.96 (d, J = 4.9 Hz, 1H), 7.85 (q, J = 6.2 Hz, 1H), 7.74 (d, J = 1.7 Hz, 1H),7.53 (s, 2H), 7.48 (s, 1H), 7.08 (s, 1H), 7.00 (s, 1H), 6.91 – 6.63 (m, 2H),6.53 (d, J = 4.7 Hz, 1H), 4.54 (s, 2H), 4.47 (dd, J = 27.5, 12.8 Hz, 3H),4.31 (s, 1H), 4.00 (s, 2H), 3.97 (s, 1H), 3.89 – 3.83 (m, 9H), 3.61 (dt, J =6.6, 3.4 Hz, 4H), 3.50 – 3.36 (m, 2H), 3.17 (p, J = 5.8 Hz, 3H), 2.88 (td, J = 12.8, 2.7 Hz, 1H), 2.82 (t, J = 6.1 Hz, 2H), 2.76 – 2.72 (m, 2H), 2.70 (d, J = 12.8 Hz, 1H), 2.65 (d, J = 4.7 Hz, 3H), 2.62 – 2.56 (m, 1H), 2.53 (d, J =3.3 Hz, 3H), 2.45 – 2.33 (m, 1H), 2.30 (dd, J = 7.8, 5.2 Hz, 1H), 1.99 – 1.92(m, 2H), 1.91 – 1.84 (m, 3H), 1.75 – 1.66 (m, 3H), 1.54 – 1.43 (m, 2H)。

[0169] MNN-03-039: 1-(1-(1'-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidine-4-carbonyl)-[1,4'-bipiperidine]-4-carbonyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-03-039 was synthesized using the linker 1'-(tert-butoxycarbonyl)-[1,4'-bipiperidine]-4-carboxylic acid according to procedure A, and subsequently by procedure B to obtain the title compound (0.88 mg, 10%, MS m / z 1232.68 [M+H)). + ).

[0170] MNN-03-049: 1-(1-(3-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidin-4-carbonyl)-3-azaspiro[5.5]undecane-9-carbonyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-03-049 was synthesized using the linker 3-(tert-butoxycarbonyl)-3-azaspiro[5.5]undecane-9-carboxylic acid according to procedure A, and subsequently by procedure B to obtain the title compound. (2.65 mg, 30%, MS m / z 1216.57 [M+H]) + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 9.11 (s, 1H), 8.11 (s, 1H), 7.94 (q, J = 4.6 Hz, 1H), 7.74 (s,1H), 7.52 (d, J = 2.3 Hz, 1H), 7.51 – 7.45 (m, 2H), 7.09 (s, 1H), 7.01 (s,1H), 6.81 (s, 1H), 6.77 (t, J= 55.2 Hz, 1H), 6.54 (s, 1H), 4.55 (s, 2H),4.45 (d, J = 12.7 Hz, 3H), 4.40 – 4.28 (m, 1H), 4.02 (s, 3H), 3.89 – 3.84 (m,9H), 3.71 – 3.58 (m, 4H), 3.56 (t, J = 5.6 Hz, 2H), 3.47 (s, 2H), 3.41 (s,2H), 3.18 (t, J = 12.7 Hz, 1H), 3.00 (s, 2H), 2.93 (d, J = 10.5 Hz, 1H), 2.83(t, J = 6.4 Hz, 2H), 2.74 (t, J = 5.7 Hz, 2H), 2.69 (s, 1H), 2.64 (d, J = 4.7Hz, 3H), 2.60 (s, 1H), 2.54 (s, 3H), 1.96 (h, J = 6.8 Hz, 2H), 1.85 (d, J =16.9 Hz, 2H), 1.73 – 1.63 (m, 4H), 1.50 (d, J = 16.4 Hz, 6H), 1.38 (s, 1H),1.30 (s, 1H), 1.16 (dd, J = 24.9, 9.9 Hz, 3H)。

[0171] MNN-03-050: 1-(1-(2-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidin-4-carbonyl)-2-azaspiro[3.3]heptane-6-carbonyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-03-050 was synthesized using the linker 2-(tert-butoxycarbonyl)-2-azaspiro[3.3]heptane-6-carboxylic acid according to procedure 1, and subsequently by procedure 2 to obtain the title compound (4.72 mg, 40%, MS m / z 1160.73 [M+H]). + ). 1 H NMR (500 MHz, DMSO- d 6 )δ = 9.17 (s, 1H), 8.12 (s, 1H), 7.94 (q, J = 4.7 Hz, 1H), 7.74 (s, 1H), 7.52(dd, J = 7.1, 2.3 Hz, 1H), 7.48 (d, J = 2.6 Hz, 2H), 7.09 (s, 1H), 7.00 (s,1H), 6.81 (d, J = 2.2 Hz, 1H), 6.77 (t, 1H), 6.54 (s, 1H), 4.55 (s, 2H), 4.42(d, J = 12.8 Hz, 3H), 4.32 (dq, J = 11.2, 5.3 Hz, 1H), 4.24 (s, 1H), 4.22 (s,1H), 4.08 (s, 1H), 4.06 (s, 2H), 4.02 (s, 2H), 3.86 (dd, J = 4.5, 1.7 Hz, 9H), 3.80 (d, J = 13.9 Hz, 1H), 3.70 (s, 1H), 3.58 (dt, J = 18.3, 6.3 Hz, 4H), 3.26 (td, J= 8.4, 2.7 Hz, 1H), 3.11 (s, 1H), 2.97 (s, 2H), 2.83 (t, J =6.4 Hz, 2H), 2.73 (h, J = 6.2 Hz, 3H), 2.64 (d, J = 4.7 Hz, 3H), 2.54 (s,3H), 2.34 (td, J = 8.1, 4.0 Hz, 2H), 2.25 (d, J = 8.2 Hz, 1H), 1.97 (p, J =6.1 Hz, 2H), 1.87 (d, J = 13.2 Hz, 2H), 1.81 (s, 1H), 1.69 (d, J = 31.1 Hz, 3H), 1.44 (t, J = 12.0 Hz, 2H).

[0172] MNN-03-038: 1-(1-(3-(4-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidine-4-carbonyl)piperazin-1-yl)propionyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-03-038 was synthesized using the linker 3-(4-(tert-butyloxycarbonyl)piperazin-1-yl)propionic acid according to procedure 1, and subsequently by procedure 2 to give the title compound (3.33 mg, 30% yield, MS m / z 1177.74 [M+H)). + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 9.57(s, 1H), 8.94 (s, 1H), 8.09 (s, 1H), 7.98 (d, J = 4.7 Hz, 1H), 7.74 (s, 1H), 7.58 (d, J = 2.2 Hz, 1H), 7.50 (d, J = 2.3 Hz, 1H), 7.49 (d,J = 0.8 Hz, 1H),7.09 (s, 1H), 6.99 (s, 1H), 6.77 (t, J = 55.2 Hz, 1H), 6.76 (s, 1H), 6.55 (s,1H), 4.55 (s, 2H), 4.48 (m, J = 15.8 Hz, 4H), 4.41 – 4.32 (m, 1H), 4.23 (s,1H), 4.02 (s, 2H), 3.95 (d, J = 13.1 Hz, 1H), 3.87 (s, 3H), 3.86 (s, 6H), 3.80-3.50 (7H, if attributed to HSQC), 3.36 (s, 2H), 3.26 – 3.17 (m, 1H), 3.10 (s, 1H), 3.04 – 2.94 (m, 5H), 2.91 (q, J = 6.8 Hz, 2H), 2.83 (q, J = 8.5 Hz, 3H), 2.76 (q, J = 8.1 Hz, 2H), 2.64 (d, J = 4.7 Hz, 3H), 2.54 (s, 3H), 1.94 (m, J = 13.2, 4.8 Hz, 5H), 1.84 – 1.63 (m, 3H), 1.50 (s, 2H).

[0173] MNN-03-041: 1-(1-(4-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidine-4-carboxyamido)cyclohexane-1-carbonyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-03-041 was synthesized using the linker 4-((tert-butoxycarbonyl)amino)cyclohexane-1-carboxylic acid according to procedure 1, and subsequently by procedure 2 to obtain the title compound (4.73 mg, 40%, MS m / z 1162.38 [M+H]). + ). 1 H NMR (500 MHz, DMSO-d 6 ) δ = 8.96 (s,1H), 8.09 (s, 1H), 7.94 (q, J = 4.8 Hz, 1H), 7.77 – 7.71 (m, 1H), 7.55 – 7.49(m, 2H), 7.48 (t, J = 1.4 Hz, 1H), 7.08 (s, 1H), 7.04 – 6.98 (m, 1H), 6.81(s, 1H), 6.76 (t, J = 55.3 Hz, 1H), 6.54 (s, 1H), 4.55 (d, J = 2.3 Hz, 2H),4.50 (d, J = 13.2 Hz, 3H), 4.32 (dq, J = 10.8, 5.4 Hz, 1H), 4.02 (s, 3H),3.90 – 3.80 (m, 9H), 3.77 (s, 1H), 3.60 (t, J = 5.7 Hz, 2H), 3.56 (t, J = 5.6Hz, 2H), 3.43 (s, 1H), 3.18 (t, J = 12.7 Hz, 1H), 3.07 (t, J = 11.4 Hz, 1H),2.98 (t, J = 12.4 Hz, 1H), 2.92 – 2.85 (m, 2H), 2.85 – 2.79 (m, 2H), 2.74 (t, J = 6.0 Hz, 2H), 2.69 (d, J = 3.3 Hz, 1H), 2.67 – 2.59 (m, 3H), 2.54 (s, 3H),1.96 (q, J = 5.9 Hz, 2H), 1.88 (s, 3H), 1.68 (d, J = 12.7 Hz, 6H), 1.48 (d, J = 29.4 Hz, 4H)。

[0174] MNN-03-040: 1-(1-(1-(1-(5-chloro-4-((8-methoxy-1-methyl-3-(2-(methylamino)-2-oxoethoxy)-2-oxo-1,2-dihydroquinoline-6-yl)amino)pyrimidin-2-yl)piperidine-4-carbonyl)azacyclobutane-3-carbonyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. Compound MNN-03-040 was synthesized using linker 1-(tert-butoxycarbonyl)azacyclobutane-3-carboxylic acid according to procedure 1, and subsequently obtained by procedure 2 to yield the title compound (0.82 mg, 6%, MS m / z 1120.61 [M+H)). + ). 1 H NMR (500 MHz, DMSO- d 6 ) δ = 8.89 (s, 1H), 8.07 (d, J = 2.2 Hz, 1H), 7.97 – 7.92 (m, 1H), 7.74 (d, J = 8.5 Hz, 1H), 7.54 (t, J = 2.8 Hz, 1H), 7.51 (d, J = 2.2 Hz, 1H), 7.48 (d, J = 4.7 Hz, 1H),7.08 (s, 1H), 6.98 (d, J = 5.2 Hz, 1H), 6.79 (d, J = 3.1 Hz, 1H), 6.78 (td, J = 55.2, 3.1 Hz, 1H), 6.54 (s, 1H), 4.55 (d, J = 3.4 Hz, 2H), 4.48 (d, J =13.8 Hz, 3H), 4.31 (dt, J = 14.3, 6.9 Hz, 1H), 4.01 (d, J = 5.2 Hz, 2H), 3.99(s, 1H), 3.94 – 3.88 (m, 1H), 3.88 – 3.81 (m, 9H), 3.74 (ddd, J= 15.0, 8.5,6.0 Hz, 1H), 3.67 (d, J = 13.5 Hz, 1H), 3.60 (s, 2H), 3.56 (t, J = 5.7 Hz,2H), 3.21 – 3.12 (m, 2H), 3.09 (td, J = 7.3, 4.8 Hz, 2H), 2.94 (t, J = 13.0Hz, 2H), 2.83 (t, J = 6.5 Hz, 2H), 2.79 (s, 1H), 2.74 (t, J = 5.9 Hz, 2H), 2.64 (dd, J = 4.7, 2.2 Hz, 3H), 2.58 – 2.52 (m, 3H), 1.96 (t, J = 5.8 Hz, 2H), 1.90 (s, 3H), 1.76 (d, J = 7.3 Hz, 1H), 1.66 (t, J = 14.3 Hz, 2H), 1.43(d, J = 13.7 Hz, 2H).

[0175] MNN-04-022: (S)-1-(1-(3-(4-(1-(5-chloro-4-((2-cyclopropyl-3,3-difluoro-7-methyl-6-oxo-1,2,3,4,6,7-hexahydro-[1,4]oxazolo[2,3-c]quinoline-10-yl)amino)pyrimidin-2-yl)piperidine-4-carbonyl)piperazin-1-yl)propionyl)piperidine-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide. According to procedure 1, compound MNN-04-022 was synthesized using the linker 3-(4-(tert-butoxycarbonyl)piperazin-1-yl)propionic acid to obtain 3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1-(1-(3-(piperazin-1-yl)propionyl)piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide (9.90 mg, 97%) as a white solid.

[0176] Add DIPEA (20.2 μL, 0.0116 mmol, 7.00 equivalents) and HATU (8.18 mg, 0.0215 mmol, 1.30 equivalents) to a solution of (S)-1-(5-chloro-4-((2-cyclopropyl-3,3-difluoro-7-methyl-6-oxo-1,2,3,4,6,7-hexahydro-[1,4]oxazadiazo[2,3-c]quinolin-10-yl)amino)pyrimidin-2-yl)piperidin-4-carboxylic acid (11.1 mg, 0.0199 mmol, 1.20 equivalents) in DMF (330 μL, 0.05 M) and stir the mixture at 0 °C under nitrogen for 15 min. After stirring for 15 minutes, a crude mixture of 3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1-(1-(3-(piperazin-1-yl)propionyl)piperidin-4-yl)-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide dissolved in DMF was added dropwise, and the reaction was stirred for 1 hour to obtain (S)-1-(1-(3-(4-(1-(5-chloro-4-((2-cyclopropyl- 3,3-Difluoro-7-methyl-6-oxo-1,2,3,4,6,7-hexahydro-[1,4]oxazaporphyro[2,3-c]quinoline-10-yl)amino)pyrimidin-2-yl)piperidin-4-carbonyl)piperazin-1-yl)propionyl)piperidin-4-yl)-3-(7-(difluoromethyl)-6-(1-methyl-1H-pyrazol-4-yl)-3,4-dihydroquinoline-1(2H)-yl)-N-methyl-1,4,6,7-tetrahydro-5H-pyrazolo[4,3-c]pyridine-5-carboxamide (1.88 mg, 9%, MS m / z 1207.86 [M+H]) + ).

[0177] Example 2: Reporter gene activation The ability of the compounds described above to activate and integrate into the BCL6 reporter gene GFP in the KARPAS lymphoma cell line was tested. The reporter gene construct contains eight high-confidence BCL6 binding sites and flanking base pairs, which are found in Gourisankar... et al. Nature The validated cell death gene upstream of the minimal promoter driving green fluorescent protein (GFP), as described in 620, 417–425 (2023), was identified by chromatin immunoprecipitation sequencing (ChIP-seq) and functional genomic data. The reporter gene is integrated into the genome of other gene-unmodified KARPAS422 DLBCL cells, and GFP is typically not transcribed due to the repressive function of endogenous BCL6. Figure 4 and Figure 8CAs shown, even at the lowest concentrations, several compounds activated reporter genes.

[0178] Example 3: Cell viability assay The ability of HAT-BCL6 TCIP to kill lymphoma cells was tested 72 hours after treatment. 30,000 cells were seeded in 100 μL of culture medium per well of a 96-well plate and treated with the drug at the specified time and dose. The fluorescence ratio at 560 / 590 nm was recorded 1.5 hours after the addition of a resazurin-based cell indicator. The signal was normalized to DMSO-treated cells after subtracting background fluorescence. The DMSO concentration was normalized to 0.1%. EC50 values ​​were calculated using a standard 4-parameter logarithmic logic function. Data are shown in... Figure 5A and Figure 8A (SUDHL5 cells) and Figure 5B In (KARPAS422 cells), the EC50 value was at Figure 8A and Figure 8B And as shown in Table 1. dCBP-1 is a degrader of p300 / CBP (CAS No. 2484739-25-3), A485 is a p300 / CBP inhibitor at the catalytic site (CAS No. 1889279-16-6), and GNE-781 is a p300 / CBP bromine domain inhibitor (CAS No. 1936422-33-1). Negative 1 is a negative control of MNN-02-155, in which BCL6 binding is eliminated; the compound has the following structure: .

[0179] Table 1. EC in KARPAS422 cells 50 value

[0180] Example 4: Formation of ternary complexes To determine whether HAT-BCL6 TCIPs exert their effects by inducing the formation of a ternary complex between p300 / CBP and BCL6, the ability of each compound to rescue cell viability loss was determined using one of the most effective HAT-BCL6 TCIPs, MNN-03-038 (TCIP3), against an excess of p300 / CBP inhibitors (including SGC-CBP-30, GNE-781, or A-485) added at the start of the experiment and against an excess of BCL6 inhibitors (including BI-3812, GSK137 (CAS 2728727-91-9), or CCT373567 (CAS 2378853-67-7)). Data are shown in Figure 6A (KARPAS422 cells) and Figure 6B as well as Figure 8E In (SUDHL5 cells), the ternary complex formation response is crucial for the rescue of viability because excess monomeric drugs can compete with the bioactive ternary complex.

[0181] Example 5: Half-life and internal clearance rate Table 3 shows the performance of p300 / CBP TCIP relative to the reference kinase inhibitor sunitinib in mouse liver microsomal stability analysis. in vitro Half-life and internal clearance rate.

[0182] Table 3.

[0183] Example 6: Oncogene Suppression Research method Cell culture. Lymphoma and leukemia cells were cultured in RPMI-1640 (ATCC 30-2001) + 10% FBS with antibiotic (100X PenStrep GIBCO #15140122) and incubated at 37°C and 5% CO2. Cells were routinely checked for mycoplasma, and further testing was performed immediately if suspected. No culture test was positive.

[0184] Protein blotting. Cells were plated at 1 million / mL and treated with drugs at specified time points and doses. Cells were harvested on ice in RIPA buffer (50 mM Tris-HCl pH 8, 150 mM NaCl, 1% NP-40, 0.1% DOC, 1% SDS, a cocktail of protease inhibitors (approximately 20 mg / mL pepsin inhibitor, aprotinin, and leucopeptidase), 1 mM DTT), and incubated for 20 min with 1:200 benzonase (Sigma #E1014). After centrifugation at 14,000 g and 4 °C for 10 min, the supernatant was collected and protein concentration was measured by Bradford assay. The antibodies used for immunoblotting were: BCL6 (Cell Signaling D65C10), p300 (Santa Cruz F-4), CBP (Cell Signaling D6C5), c-MYC (Cell Signaling D84C12), and GAPDH (Santa Cruz 6C5). Except for GAPDH (1:2000), all antibodies were used at a 1:1000 v / v dilution. Imaging and quantification of the blots were performed using ImageStudio (Licor).

[0185] RNA extraction, qPCR, and sequencing library preparation. Cells were plated at 1 million / mL and harvested in TRIsure (Bioline #38033). RNA was extracted using a Direct-zol RNA MicroPrep column (Zymo #R2062) treated with DNase I. cDNA for RT-qPCR was prepared using the SensiFAST cDNA preparation kit according to the manufacturer's instructions (Bioline #65054). 1 μL of cDNA was used per RT-qPCR reaction, prepared using SYBR Lo-ROX (Bioline #94020). For sequencing library preparation, polyA-enriched transcripts (NEB #E7490S) were prepared into paired-end libraries (NEB #E7760S) and sequenced by Novogene using paired-end 150 bp reads on Illumina NovaSeq.

[0186] RNA-seq analysis was performed. The quality of the raw reads was checked using FastQC (www.bioinformatics.babraham.ac.uk / projects / fastqc / ) and CutAdapt (Martin, EMBnet.journal 17, 10(2011)) use the parameters cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA (SEQ ID NO: 1) -b AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (SEQ ID NO: 2) --nextseq-trimmed=20 --minimum-length 1 to trim from the adapter. Use kallisto (Bray et al., Nature Biotechnology Transcript quantification was performed on human Gencode v33 indexed transcriptomes and annotations using 34, 525-527 (2016). DESeq2 (Love...) was used. et al. Genome Biol 15, 550 (2014)) using apeglm (Zhu Bioinformatics, et al. 35, 2084-2092 (2019)) used log2 fold change to perform differential gene analysis.

[0187] result The results are shown in Figures 7A to 7G middle. Figures 7A to 7FThe data showed a reduction in c-MYC compared to controls (such as BCL6 inhibition by BI-3812 (a nanomolar inhibitor of BCL6) (or related compounds), or p300 / CBP bromine domain inhibition by GNE-781 (a nanomolar inhibitor of p300 / CBP) (or related compounds). Figure 7E The data in the study showed that, in an unbiased analysis of all transcripts altered by TCIP3, ¬c-MYC was the gene most significantly repressed when treated with 1 nM for 1 hour. Figure 7G The data show that this reduction depends on the BCL6 level in the cell line. Figure 7A The data show that the inhibition of MYC does not occur through the degradation or loss of target proteins (p300, CBP, BCL6), but rather through new signaling events. Figure 7D The data show that the suppression of c-MYC is primarily at the transcriptional level of the c-MYC gene, as expected for TCIP, which functions by regulating transcription.

[0188] Example 7: Ternary complex-dependent, BCL6-regulated intracellular gene expression and cytotoxicity assays method Cell viability measurement. 30,000 cells were seeded in 100 μL of medium in 96-well plates and treated with the specified dose of the drug for 72 hours. A resazurin-based cell health indicator (PrestoBlue, ThermoFisher#P50200) was added, and the plates were incubated at 37°C for 1.5 hours. The fluorescence ratio at 560 / 590 nm was then recorded. After subtracting background fluorescence, the signal was normalized to that of DMSO-treated cells. The dose-response curves were fitted and statistically analyzed using a four-parameter logarithmic logic function with the drc package in R.

[0189] Reporter gene assay. KARPAS422 cells (Gourisankar) were transduced with a lentivirus containing a previously reported GFP reporter gene construct. Nature et al. 620, 417–425 (2023)). After selection, cells were plated and treated with the specified amounts of each compound for 8 hours. Cells were washed in 2.5% FBS / PBS, administered 1:250 v / v of 7-AAD to distinguish live and dead cells, and harvested for flow cytometry on BD Accuri. Given the post-transduced polyclonal population, the area under the histogram representing the FITC signal of all live cells was calculated as a comprehensive measure of the total GFP signal. A GFP-positive gate was drawn from untransduced cells, and the area exceeding the threshold for each sample was calculated and normalized to cells treated with DMSO.

[0190] TR-FRET. A mixture of 10 nM p300-bromodomain (purified from Addgene construct #39018, courtesy of Nicola Burgess-Brown), 200 nM biotinylated BCL6-BTB, 20 nM streptavidin-FITC (Thermo #SA1001), and 1:400 anti-6xHis terbium antibody (PerkinElmer #61HI2TLF) in 10 μL buffer (20 mM HEPES, 150 mM NaCl, 0.1% BSA, 0.1% NP-40, and 1 mM TCIP) was added to a low-capacity 384-well plate. Each protein mixture was incubated with digitally dispensed drug (Tecan D300e) in the dark at room temperature for 1 hour, then excited at 337 nM, and the emission at 520 nM (FITC) and 490 nM (terbium) was measured using a Pherastar FS plate reader (BMG Labtech). The signal ratio at 520 nm to 490 nm was calculated, normalized to DMSO processing conditions, and plotted.

[0191] result The results are shown in Figures 8A to 8F Furthermore, it was shown that MNN-03-038 (TCIP3) exhibited greater cell killing than the inhibitor alone, and that cell killing depended on the formation of a ternary complex between p300 and BCL6. Figure 8A The study demonstrated enhanced TCIP3-induced cell killing compared to known p300 / CBP inhibitors (A-485), degraders (dCBP-1), or combinations of BCL6 and p300 / CBP inhibitors (BI-3812 and GNE-781, respectively). Figure 8B The IC50 values ​​of all p300 / CBP TCIP molecules synthesized in a 72-hour viability assay in SUDHL5 cells are shown. 50 Relationship between value and structure activity. Figure 8C The results show that treatment with TCIP3 induces transcriptional activation of the BCL6 promoter relative to BI-3812 or GNE-781. Figure 8D It is shown that, relative to BI-3812 and GNE-781, all TCIPs were able to biochemically induce the ternary complex between p300 and BCL6 in TR-FRET assays, for both linear and rigid junctions. Figure 8E This demonstrates that dose-dependent titration of BI-3812 or GNE-781 can rescue cellular damage caused by TCIP3 in a 72-hour viability assay. Figure 8F The study showed that TCIP3 killing was more effective in DLBCL cell lines with high levels of BCL6 protein.

[0192] All references cited in this article (including publications, patent applications and patents) are hereby incorporated by reference to the extent that each reference is individually and specifically indicated to be incorporated by reference and to be described in its entirety in this article.

Claims

1. A compound of formula (I) ALB (I) Or its pharmaceutically acceptable salt, wherein: A is the BCL6 binding part; L is the connector; and B is the portion that binds to the bromine domain of histone acetyltransferase.

2. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein A is a part of the following formula: 、 、 、 、 、 , or .

3. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein A is a part of the following formula: 。 4. The compound of any one of claims 1-3 or a pharmaceutically acceptable salt thereof, wherein B is the portion bound to the bromine domain of p300 or CBP.

5. The compound of any one of claims 1-4, or a pharmaceutically acceptable salt thereof, wherein B is a part of the following formula: 、 、 、 , or .

6. The compound of any one of claims 1-5, or a pharmaceutically acceptable salt thereof, wherein B is a part of the following formula: 。 7. The compound of claim 1 or a pharmaceutically acceptable salt thereof, wherein the compound is a compound of formula (Ia): (It)。 8. The compound of any one of claims 1-7 or a pharmaceutically acceptable salt thereof, wherein L is a direct bond, or comprises any combination of -CH2-, -CH=CH-, -C≡C-, -O-, -NR'-, -BR'-, -S-, -C(O)-, -C(NR')-, -S(O)-, -S(O)2-, arylene, heteroarylene, cycloalkyl, and heterocyclic moieties, wherein the arylene, heteroarylene, cycloalkyl, and heterocyclic moieties are independently unsubstituted or substituted by one, two, or three substituents.

9. The compound of any one of claims 1-8 or a pharmaceutically acceptable salt thereof, wherein L is a direct bond or any combination of -CH2-, -O-, -C(O)-, -NH-, -N(CH3)-, cycloalkylene and heterocyclic moieties.

10. The compound of any one of claims 1-9 or a pharmaceutically acceptable salt thereof, wherein L comprises any combination of the following portions: -(CH2) q -C(O)- -NH- 、 、 、 、 、 , Where p is 1, 2, 3, 4, 5 or 6; and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16.

11. The compound of any one of claims 1-10, or a pharmaceutically acceptable salt thereof, wherein L has a formula selected from: , and ; Where p is 1, 2, 3, 4, 5 or 6; and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16.

12. The compound of any one of claims 1-10, or a pharmaceutically acceptable salt thereof, wherein L has a formula selected from: and .

13. The compound of claim 1, wherein the compound is selected from: And its pharmaceutically acceptable salts.

14. A pharmaceutical composition comprising the compound of any one of claims 1-13 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

15. A method of treating a proliferative disease in a subject in need, the method comprising administering to the subject a therapeutically effective amount of any one of claims 1-13 or a pharmaceutically acceptable salt thereof.

16. The method of claim 14, wherein the proliferative disease is a cancer selected from carcinoma, sarcoma, and hematologic malignancies.

17. The method of claim 15, wherein the cancer is lymphoma.

18. The method of claim 16, wherein the cancer is diffuse large B-cell lymphoma.

19. The compound or a pharmaceutically acceptable salt thereof as described in any one of claims 1-13, used as a medicine.

20. The compound of any one of claims 1-13 or a pharmaceutically acceptable salt thereof, for the treatment of proliferative disorders.

21. The compound of claim 20, wherein the proliferative disease is a cancer selected from carcinoma, sarcoma, and hematologic malignancies.

22. The compound of claim 21, wherein the cancer is lymphoma.

23. The compound of claim 22, wherein the cancer is diffuse large B-cell lymphoma.

24. A pillbox comprising any one of claims 1-13 or a pharmaceutically acceptable salt thereof.

Images