SNP (Single Nucleotide Polymorphism) molecular marker, primer group and kit associated with closed-flower low-fertility character of mung bean and application of SNP molecular marker, primer group and kit

By developing SNP molecular markers and primer sets associated with the closed-flowering and low-fertility trait in mung beans, and using KASP02-1 and KASP02-4 molecular markers for genotyping, the problem of rapidly and accurately identifying the closed-flowering and low-fertility trait in mung bean breeding was solved, thus improving breeding efficiency.

CN121428151APending Publication Date: 2026-01-30JIANGSU ACAD OF AGRI SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511616223.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-06
Publication Date
2026-01-30

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately identify the closed-flowering and low-fertility traits in mung beans, which affects breeding efficiency.

Method used

We developed SNP molecular markers and primer sets associated with the closed-flowering and low-fertility trait in mung beans. We used KASP02-1 and KASP02-4 molecular markers for genotyping, and combined PCR amplification and quantitative real-time PCR detection to achieve specific and accurate identification.

Benefits of technology

This technology enables rapid and accurate identification of mung bean cleistomorphic low-fertility mutants, shortening the breeding cycle and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121428151A_ABST
    Figure CN121428151A_ABST
Patent Text Reader

Abstract

The invention relates to the field of plant molecular marker screening and molecular genetic breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker, a primer group and a kit associated with a closed-flower low-fertility character of mung beans and application of the SNP molecular marker, the primer group and the kit. The SNP molecular marker comprises a KASP02-1 molecular marker and a KASP02-4 molecular marker; the SNP site of the KASP02-1 molecular marker is located at the 48671357-site basic group of the second chromosome of the mung bean, the polymorphism is T / A, the SNP site of the KASP02-4 molecular marker is located at the 48979098-site basic group of the second chromosome of the mung bean, and the polymorphism is C / T; the screened SNP molecular marker and the primer thereof are high in specificity and accurate and reliable in detection result, and can be used for rapid screening of the mung bean cleistocalyx low-fertility mutants, molecular marker-assisted selective breeding and shortening of the breeding period.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular marker screening and molecular genetic breeding, specifically to an SNP molecular marker, primer set, kit, and application associated with the closed-flowering and low-fertility trait in mung beans. Background Technology

[0002] The formation of floral organs is a crucial process determining the reproductive success of angiosperms and has always been a key trait of interest to breeders. Mung bean is a typical self-pollinating plant with closed flowers; pollination is completed by the time the flower opens, with a natural cross-pollination rate of 1.6%. Previously, we conducted EMS mutagenesis on mung bean 'Weilv 11' (WL11) and discovered a mutant with an abnormal flower shape in the mutagenesis population. Its standard petal is closed and cannot open, while the anthers can dehisce and release pollen normally, producing short pods. However, under high field conditions (≥35°C), it does not produce pods or set fruit, hence it was named the mung bean closed-flower stunted mutant. cleistogamous flower and low fertility, cflf Its high-temperature sterility trait can be stably inherited, thus it holds promise for application in mung bean hybrid seed production systems. Furthermore, in recent years, global warming, accompanied by frequent extreme heat events, has severely impacted crop growth, development, yield, and grain quality. Therefore, this material can also be used to explore the mechanisms by which high temperatures affect floral organ development and flower and pod drop.

[0003] Phenotypic identification of mung bean cleistophyte mutants requires waiting until the flowering stage, and field identification under high temperatures is more conducive to accurate phenotypic identification. Therefore, compared with phenotypic identification, developing molecular markers associated with cleistophyte traits has the advantages of accuracy, economy, and speed. Functional molecular markers are molecular markers developed based on polymorphic sequences within functional genes closely related to phenotypic traits. Their advantages lie in their ability to accurately and reliably pinpoint target genes, accurately reflect the genetic variation of functional alleles, and provide more reliable genetic effect values. SNPs are polymorphisms arising from single nucleotide variants, which are difficult to distinguish using conventional PCR and gel electrophoresis techniques based on differences in length. Summary of the Invention

[0004] To address the shortcomings of the existing technologies, this invention aims to provide an SNP molecular marker, primer set, kit, and application for the association of closed-flowering and low fertility traits in mung beans, thereby meeting the needs of assisting mung bean molecular breeding and shortening the breeding cycle.

[0005] To solve the above problems, the present invention adopts the following technical solution: In a first aspect, the present invention provides a SNP molecular marker associated with the trait of closed flowering and low fertility in mung beans, the SNP molecular marker including the KASP02-1 molecular marker and the KASP02-4 molecular marker; the sequence of the first and last 240 bp of the KASP02-1 molecular marker is shown in SEQ ID NO.1, its SNP site is located at base 48671357 on chromosome 2 of mung beans, and the polymorphism is T / A; the sequence of the first and last 240 bp of the KASP02-4 molecular marker is shown in SEQ ID NO.2, its SNP site is located at base 48979098 on chromosome 2 of mung beans, and the polymorphism is C / T.

[0006] Secondly, the present invention provides a primer set for detecting SNP molecular markers associated with the closed-flowering and low-fertility trait in mung beans, comprising the KASP02-1 primer set and the KASP02-4 primer set; the KASP02-1 primer set includes primers KASP1-F-FAM, KASP1-F-HEX, and KASP1-R, the nucleotide sequences of which are shown in SEQ ID NO.3-SEQ ID NO.5, respectively; the KASP02-4 primer set includes primers KASP4-F-FAM, KASP4-F-HEX, and KASP4-R, the nucleotide sequences of which are shown in SEQ ID NO.6-8, respectively.

[0007] Thirdly, the present invention provides a kit for detecting SNP molecular markers associated with the closed-flowering and low-fertility trait in mung beans, comprising the primer set described above.

[0008] Furthermore, the concentration of each primer in the primer set is 10 μM, and the volume fraction is 0.14; the KASP02-1 primer set and the KASP02-4 primer set are respectively paired with 5 volumes of Hi Geno 2x Probe Mix and 3.58 µL ddH2O.

[0009] Fourthly, this invention provides a method for identifying the closed-flower fertility trait in mung beans, comprising: performing PCR amplification of mung bean genomic DNA using the primer set or the kit described above; reading the fluorescence signal after PCR amplification; identifying the genotype; and identifying mung bean plants with the TT genotype at chromosome 2 locus 48671357 and / or the CC genotype at chromosome 2 locus 48979098, or with the heterozygous TA genotype at chromosome 2 locus 48671357 or the heterozygous CT genotype at chromosome 2 locus 48979098 as having the normal phenotype; and identifying plants with the AA genotype at chromosome 2 locus 48671357 and / or the homozygous TT genotype as having the closed-flower fertility mutant phenotype.

[0010] Furthermore, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 20 s, annealing and extension at 61-56℃ with a decrease of 0.6℃ per cycle for 40 s, for 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, for 28-34 cycles.

[0011] Fifthly, the present invention provides the application of the SNP molecular markers associated with the closed-flowering and low-fertility traits of mung beans in assisted mung bean breeding or in the identification of closed-flowering and low-fertility traits in mung beans.

[0012] Sixthly, the present invention provides the application of the primer set or the kit in assisted mung bean breeding or in the preparation of reagents for identifying the closing-flower fertility trait in mung beans.

[0013] The beneficial effects of this invention are as follows: the SNP molecular markers and primer sets provided by this invention have the characteristics of being specific, accurate, reliable and easy to operate, which can quickly identify mung bean cleistomorph mutants and meet the needs of assisting mung bean molecular breeding and shortening the breeding cycle. Attached Figure Description

[0014] Figure 1 Fine mapping of genes in mung bean closed-flowering low-fertility mutants.

[0015] Figure 2 The images show the KASP02-1 and KASP02-4 genotypes in 139 cflf×Sulv1 F2 populations; where A is the KASP02-1 genotype of 97 F2 populations and B is the KASP02-4 genotype of 97 F2 populations. Detailed Implementation

[0016] The present invention will be further described in detail below with reference to specific embodiments.

[0017] It should be noted that these embodiments are only used to illustrate the present invention and are not intended to limit the present invention. Simple improvements to the method under the premise of the present invention are all within the scope of protection claimed by the present invention.

[0018] Example 1: Design of SNP molecular markers associated with the trait of closed flower and low fertility in mung beans use cflf × Sulv1 F2 population against mung bean closing-flowering fertility mutant cflf Initial localization: From the F2 population of cflf × Sulv1, plants with extreme phenotypes were screened, including 25 F2 plants with closed-flowering, low-fertility phenotypes and 25 F2 plants with normal phenotypes. Close-pool and open-pool structures were constructed, and Sulv1 and... cflfTwo parental pools were used. BSA pooled sequencing was then employed for analysis. After filtering the raw sequencing data to obtain high-quality clean data, association analysis was performed. For reliable SNP sites, two calculation methods were used to analyze the SNP sites and indel sites obtained from the sequencing. The intersection of the ED value calculation method and the SNP-index analysis results yielded the associated SNP region, located at the end of chromosome 2, with a size of 7.52 Mb. The significantly associated interval was distributed between 44,410,000 bp and 5,192,999 bp.

[0019] Initially, based on mutants cflf Six KASP markers were developed based on six significant SNP sites of Sulv1: KASP02-1 (SNP-48671357), KASP02-2 (SNP-48756067), KASP02-3 (SNP-48770744), KASP02-4 (SNP-48979098), KASP02-5 (SNP-49168405), and KASP02-6 (SNP-49315980). Based on single nucleotide differences, KASP primer sets containing the differences of the six SNPs were designed using Primer 5.0 software. Each primer set contained two specific primers and one universal primer. This invention utilizes AQP TM Genotyping systems, also known as allele-specific quantitative PCR genotyping systems, and fluorescence quantitative PCR instruments are used to acquire fluorescence signals. According to the typing results, KASP02-1 and KASP02-4 molecular markers showed high screening rates. KASP02-1 is based on the nucleotide difference at position 48671357 on chromosome 2 of mung bean. The 240 bp sequence before and after KASP02-1 is shown in SEQ ID NO.1, with position 120 being KASP02-1, exhibiting a T / A polymorphism. KASP02-4 is based on the nucleotide difference at position 48979098 on chromosome 2 of mung bean. The 240 bp sequence before and after KASP02-4 is shown in SEQ ID NO.2, with position 120 being KASP02-4, exhibiting a C / T polymorphism. Figure 1 As shown, it can be used to identify the closing flower and low fertility trait in mung beans.

[0020] KASP02-1: SEQ ID NO.1: TAGATGCGGGCCATTTGGCAAACCAAAACTTTGTTACCAGAAAATAGGAGTTGCTGGAAAAGATGAATATATAATAGCTAGAGCAGATAAGGAATTGGTATCATGTTGGAGGTGGTATCT[A]TGTTAACTGTAGAACAGCGCTTAAAAATGGACTGTATTTTGATACCATTGTAACTAAAACAAATTTGTAGAACAGTACTTTGTTTGTGACTAATAAGGTTAAGGTAATAAAGGAAAGAGG.

[0021] KASP02-4: SEQ ID NO.2: AAAGTGTTTTGAACTTCTTTAAATACGTTTTGTTTTCACTTCCAGAATTTAAGAACAGCAGACTCCTCGTTCTGCCATTACTCTTGGAAATTCAAATTCGAAACGGAAGCAAATCGAATC[T]GATTTTGTAGGAAGATGGAGCAGATGCAATCGCAAGTTATGGAACACTTCGTGACTAAAATCATTTCTTCCTTCAGCGCTAACGTCCTAGCTTCCGTCCTTGTAGAAGCCACTGCTCACC.

[0022] The primer sequence for the KASP02-1 molecular marker is as follows: Primer 1: KASP1-F-FAM (SEQ ID NO.3): 5' GAAGGTGACCAAGTTCATGCT TGGTATCATGTTGGAGGTGGTATCT 3'.

[0023] Primer 2: KASP1-F-HEX (SEQ ID NO.4): 5' GAAGGTCGGAGTCAACGGATT TGGTATCATGTTGGAGGTGGTATCA 3'.

[0024] Primer 3: KASP1-R (SEQ ID NO.5): 5'CAGTCCATTTTTAAGCGCTGTTC 3'.

[0025] The primer sequences for the KASP02-4 molecular marker are as follows: Primer 1: KASP4-F-FAM (SEQ ID NO.6): 5'GAAGGTGACCAAGTTCATGCT CTGCTCCATCTTCCTACAAAATCG 3'.

[0026] Primer 2 KASP4-F-HEX (SEQ ID NO.7): 5' GAAGGTCGGAGTCAACGGATT TCTGCTCCATCTTCCTACAAAATCA 3'.

[0027] Primer 3 KASP4-R (SEQ ID NO.8): 5'TCGTTCTGCCATTACTCTTGGAA 3'.

[0028] Example 2: Application of SNP markers associated with the closed-flower fertility trait in mung bean in screening for closed-flower fertility mutants. Genomic DNA was extracted from 97 mung bean varieties to be tested (see Table 1), and the concentration of each DNA sample was determined using a spectrophotometer. Using the DNA from the mung bean varieties to be tested as templates, PCR amplification was performed using the primer set described above, i.e., AQP. TM Reaction detection.

[0029] PCR reaction system (10µl): 1 µL template DNA (50 ng / µL), 5 µL Hi Geno 2x Probe Mix, 0.14µl each of primer 1 (10 μM), primer 2 (10 μM) and primer 3 (10 µM), and 3.58 µL ddH2O.

[0030] PCR reaction program: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 20 s, 61-56℃ (drop 0.6℃ per cycle) annealing and extension for 40 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, 28-34 cycles.

[0031] After PCR is completed, the real-time PCR instrument (such as QuantStudio™ 5 System) reads the fluorescence pattern, and the corresponding analysis software (such as QuantStudio™ Design & Analysis Software) performs data analysis and processing.

[0032] If only the base T is detected at the SNP locus KAPS02-1 (SNP-48671357), the mung bean sample to be tested is determined to be a homozygous genotype with normal floral organ phenotype; if only the base A is detected, the mung bean sample to be tested is determined to be a homozygous genotype with closed flower fertility; if both the bases T and A are detected, the mung bean sample to be tested is determined to be a heterozygous genotype with normal floral organ phenotype.

[0033] If only base C is detected at the SNP locus KASP02-4 (SNP-48979098), the mung bean sample to be tested is determined to be a homozygous genotype with normal floral organ phenotype; if only base T is detected, the mung bean sample to be tested is determined to be a homozygous genotype with closed flower fertility; if both bases C and T are detected, the mung bean sample to be tested is determined to be a heterozygous genotype with normal floral organ phenotype.

[0034] A field survey of the flowering organ characteristics of various mung bean lines was conducted. The specific steps are as follows: Sowing was carried out in mid-June at the plant experimental field located at the Jiangsu Academy of Agricultural Sciences (Nanjing, Jiangsu, 118.88°E, 32.038°N). cflf × Sulv1 hybrid F2 population, after entering the reproductive growth period, the flower organ traits of each plant were investigated in the field. If the flower organs remained closed throughout and exhibited sterility under the high temperature environment of July and August, it was determined to be the mung bean closed-flower low-fertility trait; otherwise, it was considered a normal flower phenotype. The phenotypes of each line were collected and recorded, and compared with the corresponding genotypes for analysis.

[0035] The correspondence between T / A genotypes and floral organ phenotypes is shown in Table 1. Genotyping results are as follows: Figure 2 As shown in Figure A. A total of 23 AA genotypes were detected, of which 21 (91.30%) exhibited the closed-flower stunting trait. A total of 73 TT and TA genotypes were detected, of which 68 (93.15%) showed normal floral organ phenotypes; one sample showed no detectable genotype. The overall accuracy rate of the molecular marker KAPS02-1 was 92.71%.

[0036] The correspondence between C / T genotypes and floral organ phenotypes is shown in Table 1. Genotyping results are as follows: Figure 2 As shown in Figure B. A total of 23 TT genotypes were detected, of which 21 (91.44%) exhibited the closed-flower stunting trait. A total of 72 CC and CT genotypes were detected, of which 68 (94.44%) exhibited the normal floral organ phenotype. Two samples showed no detectable phenotypes. The overall accuracy rate of the molecular marker KAPS02-4 was 93.68%.

[0037] Table 1. Correspondence between genotypes and floral organ phenotypes in the F2 population of the cflf × Sulv1 hybridization.

[0038] As shown in Table 1, the two SNP markers disclosed in this invention for detecting the association between closed-flowering and low fertility traits in mung beans are specific, accurate, reliable, and easy to operate. They can quickly identify closed-flowering and low fertility mutants, assist in molecular breeding, and shorten the breeding cycle.

[0039] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described with reference to preferred embodiments, those skilled in the art should understand that various changes in form and detail can be made without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. A SNP molecular marker associated with the low seed set trait of mungbean, characterized in that, The SNP molecular marker comprises a KASP02-1 molecular marker and a KASP02-4 molecular marker; the sequence of 240 bp before and after the KASP02-1 molecular marker is shown as SEQ ID NO. 1, the SNP site of which is located at base 48671357 of chromosome 2 of mung bean, and the polymorphism is T / A; the sequence of 240 bp before and after the KASP02-4 molecular marker is shown as SEQ ID NO. 2, the SNP site of which is located at base 48979098 of chromosome 2 of mung bean, and the polymorphism is C / T.

2. A primer set for detecting the SNP molecular marker associated with the green bean cleistogamy low fertility trait of claim 1, characterized in that, The primer set comprises a KASP02-1 primer set and a KASP02-4 primer set; the KASP02-1 primer set comprises primers KASP1-F-FAM, KASP1-F-HEX and KASP1-R, and the nucleotide sequences of the primers are shown as SEQ ID NO. 3-SEQ ID NO. 5; the KASP02-4 primer set comprises primers KASP4-F-FAM, KASP4-F-HEX and KASP4-R, and the nucleotide sequences of the primers are shown as SEQ ID NO. 6-8.

3. A kit for detecting the SNP molecular marker associated with the low seed set trait of Vigna radiata as claimed in claim 1, wherein, The primer set comprises the primer set of claim 2.

4. The kit of claim 3, wherein The concentration of each primer in the primer set is 10 μM, and the volume fraction is 0.14; the KASP02-1 primer set and the KASP02-4 primer set are respectively matched with 5 volume fractions of Hi Geno2x Probe Mix and 3.58 μL of ddH2O.

5. A method for identifying a low petaloid character in mung bean, characterized by, The primer set comprises the primer set of claim 2. The primer set of claim 2 or the kit of claim 3 or 4 is used for PCR amplification of mung bean genomic DNA, and after the PCR amplification is completed, the fluorescence signal is read, the genotype is identified, and if the 48671357 site of chromosome 2 is identified as a TT type genotype and / or the 48979098 site is identified as a CC, or, a mung bean plant with a heterozygous TA at the 48671357 site of chromosome 2 or a heterozygous CT at the 48979098 site is identified as a normal phenotype; if the 48671357 site of chromosome 2 is identified as an AA homozygous genotype and / or the 48979098 site is identified as a TT homozygous genotype, it is a closed flower low growth mutant phenotype.

6. The method for identifying the character of green bean cleistogamy sterility according to claim 5, characterized in that, The reaction program of the PCR amplification is: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 20 s, 61-56℃ annealing and extension for 40 s, and each cycle decreases by 0.6℃, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, 28-34 cycles.

7. The SNP molecular marker related to the closed flower low growth trait of mung bean of claim 1 is applied in assisting mung bean breeding or in identifying the closed flower low growth trait of mung bean.

8. The primer set of claim 2 or the kit of claim 3 or 4 is applied in assisting mung bean breeding or in preparing a reagent for identifying the closed flower low growth trait of mung bean.

Citation Information

Patent Citations

  • Molecular marker linked with bruchid resistance gene in mung bean

    CN101358232A

  • Main effect QTL related to mung bean early flowering stage, molecular marker and application thereof

    CN112080579A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to bruchid resistance of mung beans and application of SNP molecular marker in genetic breeding

    CN114959096A