Application of UFL1 gene in preparation of product for regulating and controlling tumor immune escape

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of UFL1 gene in preparation of a product for regulating and controlling tumor immune escape. The invention provides an application of a UFL1 gene in preparation of a product for regulating and controlling tumor immune escape. A nucleotide sequence of the UFL1 gene is shown as SEQ ID NO. 1; the tumors include pancreatic cancer. By taking UFL1 as a target spot and knocking out the UFL1 gene, the quality and volume of pancreatic cancer can be inhibited, and the proportion of CD8 + T cells and the level of immune cell factors can be improved; the proportion of immunosuppression Treg, MDSCs and M2 type macrophages is reduced, and the tumor immune microenvironment is regulated and controlled, so that the immune escape of the tumor is inhibited.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of the UFL1 gene in the preparation of products that regulate tumor immune escape. Background Technology

[0002] Immune checkpoint blockade (ICB) therapy has pioneered a new paradigm in anti-tumor treatment. This therapy specifically activates anti-tumor immunity and inhibits the immune escape function of cancer cells, demonstrating significant efficacy against various malignancies such as melanoma, non-small cell lung cancer, and renal cell carcinoma. However, most patients do not respond to ICB therapy. Increasing evidence suggests that the tumor immune microenvironment (TIME) plays a more significant role than immune checkpoints in tumor immune surveillance and immune escape. Many factors contribute to the anti-cancer immune response, and immune checkpoints are merely one means by which tumors defend themselves against immune system attacks. Therefore, understanding the basis of the immune response microenvironment and exploring new targets to enhance tumor sensitivity to immunotherapy is crucial.

[0003] UFL1 is an E3 ligase that recognizes substrates and catalyzes ubiquitin-like modifications of those substrates. Studies have shown that ubiquitination is closely related to the development and progression of various tumors. Currently, the role of UFL1 in immune escape from pancreatic cancer has not been reported. Summary of the Invention

[0004] The purpose of this invention is to provide the application of the UFL1 gene in the preparation of products that regulate tumor immune escape. Knocking out the UFL1 gene can inhibit pancreatic cancer tumor immunity and can be used to prepare anti-tumor drugs.

[0005] This invention provides the application of the UFL1 gene in the preparation of products that regulate tumor immune escape, wherein the nucleotide sequence of the UFL1 gene is shown in SEQ ID NO.1; and the tumor includes pancreatic cancer.

[0006] As a preferred embodiment, the regulation includes: knocking out the UFL1 gene to suppress tumor immune escape.

[0007] This invention also provides the application of UFL1 as a target in the preparation of antitumor drugs, wherein the nucleotide sequence of the UFL1 gene is shown in SEQ ID NO.1; the tumor includes pancreatic cancer.

[0008] As a preferred embodiment, the antitumor drug has at least one of the following effects: 1) reducing tumor mass; 2) reducing tumor volume; 3) increasing CD8+. +4) Increase the level of immune cytokines; 5) Reduce the proportion of immunosuppressive Tregs, MDSCs and M2 macrophages.

[0009] As a preferred embodiment, the immune cytokines include IFN-γ.

[0010] The present invention also provides an antitumor drug, the drug comprising reagents for inhibiting UFL1 gene expression and / or reagents for inhibiting UFL1 protein expression levels.

[0011] As a preferred embodiment, the reagent for inhibiting UFL1 gene expression includes sgRNA that targets and knocks out the UFL1 gene.

[0012] As a preferred embodiment, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.6.

[0013] As a preferred embodiment, the tumor includes pancreatic cancer.

[0014] As a preferred embodiment, the drug also includes pharmaceutically acceptable excipients.

[0015] This invention provides the application of the UFL1 gene in the preparation of products that regulate tumor immune escape. The nucleotide sequence of the UFL1 gene is shown in SEQ ID NO.1; the tumor includes pancreatic cancer. Previous studies have found that overexpression of the UFL1 gene can promote pancreatic cancer growth and its immune escape. This invention targets UFL1; knocking out the UFL1 gene can inhibit the mass and volume of pancreatic cancer and increase CD8... + The proportion of T cells and the level of immune cytokines regulate the tumor immune microenvironment, thereby inhibiting its immune escape. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0017] Figure 1 Figure 1 shows the results of Western blot analysis of UFL1 overexpression protein; where A represents the detection of UFL1 expression level in Panc-02 cells by Western blot; and B represents the quantitative analysis results. Figure 2 The graph shows the results of UFL1 promoting tumor growth in mice; where A is a schematic diagram of the experimental procedure; B is the tumor tissue of mice; C is the tumor weight of mice; D is the tumor volume of mice; and E is the survival curve of tumor-bearing mice. Figure 3 To detect the proportion of major immune cell subsets in mouse tumor tissue by flow cytometry; where A represents tumor-infiltrating CD45. + Cell percentage; B represents tumor-infiltrating CD45.+ CD4 in cells + and CD8 + Ratio; C represents tumor-infiltrating Treg cells (CD4+). + CD25 + The proportion of MDSCs (CD11b) cells infiltrating CD45+ cells; D represents the proportion of MDSCs (CD11b) cells in infiltrating CD45+ cells. + Gr1 + )Proportion; Figure 4 To detect the proportions of major immune cell subsets in mouse tumor tissue by flow cytometry; where A represents macrophages (CD11b) in tumor-infiltrating CD45+ cells. + F4 / 80 + The proportion of M2 type macrophages (CD11b) in tumor-infiltrating macrophages; B represents the proportion of M2 type macrophages (CD11b) in tumor-infiltrating macrophages. + F4 / 80 + CD206 + The proportion of M1 macrophages (CD11b) in tumor-infiltrating macrophages; C represents the proportion of M1 macrophages (CD11b) in tumor-infiltrating macrophages. + F4 / 80 + CD86 + )Proportion; Figure 5 For tumor infiltration of CD8 + Figure 1 shows the results of T cell cytotoxicity; where A represents the CD8+ tumor infiltration detected by flow cytometry. + B shows the ratio of TNF-α and IFN-γ in T cells; C shows the killing effect on tumor cells detected by the T cell-mediated tumor cell killing assay; D shows the immunofluorescence staining of tumor cells (CK19) and CD8 in tumor tissue. + T cells (CD8α); D represents the quantitative analysis result; Figure 6 Figure 1 shows the results of Western blot analysis of UFL1 knockout protein; where A represents the expression level of UFL1 in Panc-02 cells as detected by Western blot; and B represents the quantitative analysis results. Figure 7 The graph shows the effect of sgUFL1 on mouse tumor growth; where A represents mouse tumor tissue; B represents mouse tumor weight; and C represents mouse tumor volume. Figure 8 Figure 1 shows the effect of sgUFL1 on the tumor microenvironment in mice; where A represents the tumor infiltration CD45 detected by flow cytometry. + CD4 in cells + and CD8 + Proportion; B represents flow cytometry detection of tumor-infiltrating Treg cells (CD4+). + CD25 + The proportion of MDSCs (CD11b) cells infiltrating CD45+ cells; C represents the proportion of MDSCs (CD11b) cells in infiltrating CD45+ cells. + Gr1+ The proportion of CD45+ cells infiltrating the tumor is represented by D, which represents the proportion of macrophages (CD11b) in infiltrating CD45+ cells. + F4 / 80 + )Proportion; Figure 9 Figure 1 shows the effect of sgUFL1 on the tumor microenvironment in mice; where A represents M2 type macrophages (CD11b) in tumor-infiltrating macrophages. + F4 / 80 + CD206 + The proportion of M1 type macrophages (CD11b) in tumor-infiltrating macrophages; B represents the proportion of M1 type macrophages (CD11b) in tumor-infiltrating macrophages. + F4 / 80 + CD86 + The ratio is 1 / 2; C is the ratio of IFN-γ infiltrating CD8+ T cells. Detailed Implementation

[0018]

[0019] As one implementation method, the regulation includes: knocking out the UFL1 gene to suppress tumor immune escape. Knocking out the UFL1 gene can increase CD8... + It modulates the immune microenvironment by reducing the proportion of T cells and the level of immune factors, and by decreasing the proportion of immunosuppressive Tregs, MDSCs and M2 macrophages, thereby inhibiting immune escape from pancreatic cancer.

[0020] This invention also provides the application of UFL1 as a target in the preparation of antitumor drugs, wherein the nucleotide sequence of the UFL1 gene is shown in SEQ ID NO.1; the tumor includes pancreatic cancer. As one embodiment, the antitumor drug has the following effects: 1) reducing tumor mass; 2) reducing tumor volume; 3) increasing CD8... + 4) Increase the level of immune cytokines; 5) Reduce the proportion of immunosuppressive Tregs, MDSCs and M2 macrophages.

[0021] In one embodiment, the immune cytokines include IFN-γ. In another embodiment, the Tregs include CD4+. + and CD25 + cell.

[0022] The present invention also provides an antitumor drug, the drug comprising reagents for inhibiting UFL1 gene expression and / or reagents for inhibiting UFL1 protein expression levels. In one embodiment, the reagent for inhibiting UFL1 gene expression includes sgRNA that targets and knocks out the UFL1 gene. In another embodiment, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 6.

[0023] In one implementation, the tumor includes pancreatic cancer.

[0024] As one implementation, the drug also includes pharmaceutically acceptable excipients.

[0025] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0026] Example 1 (1) Cell culture and transfection Changsha Youbao Biotechnology Co., Ltd. was commissioned to construct the pcDNA3.1-UFL1 cDNA plasmid and provide an empty vector control EV plasmid.

[0027] Mouse pancreatic cancer cells (Panc-02) were cultured in DMEM medium containing 10% fetal bovine serum at 37°C with 5% CO2. When the cell density reached 80%, Panc-02 cells were randomly divided into a UFL1 group and a control group. The pcDNA3.1-UFL1 cDNA plasmid and the empty vector control EV were transfected using Lipofectamine 3000. Transfection efficiency was determined by Western blotting analysis of protein expression levels. The results are shown below. Figure 1 As shown. According to Figure 1 It can be seen that the expression level of UFL1 protein in Panc-02 was significantly increased after transfection, which was about 3.73 times higher than that of the empty vector control.

[0028] (2) Construction of Panc02 cells stably transfected with UFL1 The UFL1 cDNA sequence (SEQ ID NO.1) was subcloned into the pLVX-puro lentiviral vector, and the lentivirus was packaged in HEK-293T cells (vector construction and virus packaging were outsourced to Anhui General Biotechnology Co., Ltd.). After collecting the viral supernatant, the virus was used to infect Panc-02 cells. Stable cell lines were screened using puromycin. For specific operational steps, refer to the reference [Wu Zhaochun et al. Construction of PRDM5 overexpression lentiviral vector and establishment of stable transfection of Neuro-2a cells [J]. Journal of Jilin University (Medical Edition); 2025, 51(1):1-8.]. The Panc-02 cell line was prepared into 5×10⁶ cells. 6 Panc-02 cell suspension, for later use.

[0029] (3) Establishment of tumor-bearing mouse model Six- to eight-week-old female C57 / B6 mice were randomly divided into an experimental group (UFL1) and a control group (EV). After anesthesia, the hair in the right axilla of each mouse was removed, and 100 μL of the Panc-02 cell suspension from step (2) was subcutaneously injected into the right axilla of the mouse. One week after tumor implantation, when the tumor volume of the mouse reached 100 mm, the tumor was implanted. 3 Initially, the tumor was recorded as tumorous. The tumor volume was then measured every 3 days using calipers, for a total of 5 measurements over 15 days. Tumor volume calculation formula: V (mm²) 3 = [Longest diameter of tumor (mm) × Shortest diameter of tumor (mm)] 2 After measuring the volume five times, the mice were euthanized, the tumor was dissected, weighed, and the weight recorded. The experimental procedure and results are as follows: Figure 2 As shown in Tables 1 and 2.

[0030] Table 1 Tumor weight in mice of different groups

[0031] Table 2 Tumor volume in mice of different groups

[0032] according to Figure 2 It can be seen that the tumor size and volume of mice in the UFL1 group were significantly higher than those in the control EV group. Figure 2 The survival curve results for mice showed that the survival time of mice in the UFL1 group was shorter than that in the EV group (B~D). Figure 2 (E).

[0033] (4) Preparation of single-cell suspension of tumor tissue and flow cytometry Cut the mouse tumor tissue detached in step (3) into small particles using sterile ophthalmic scissors and transfer them to a 200-mesh cell sieve. Using a 5 mL syringe plunger, grind the tissue in a circular motion with a soft tip until no obvious tissue blocks remain on the sieve. Rinse the sieve 2-3 times with PBS, collect the cells, and resuspend them in PBS. Add 3 times the volume of red blood cell lysis buffer (Beyotime) to resuspend the cells, centrifuge at 300 g for 5 min, discard the red supernatant, wash 1-2 times with PBS, resuspend the cells in 1640 medium, and count them. Add 1.5 μL of Cell Activation Cocktail (with Brefeldin A) (Biolegend) to 500 μL of cell suspension (2 million cells), and incubate at 37°C for 6 h to activate lymphocytes. Centrifuge, resuspend the cells in 100 μL of PBS, add 1 μg of anti-mouse CD16 / 32 monoclonal antibody, and incubate at room temperature for 10 min to block the Fc receptor. Add various fluorescently labeled antibodies (Biolegend), including CD45, CD3, CD4, CD8, CD11b, F4 / 80, Gr-1, CD25, CD86, and CD206. Incubate at 4°C in the dark for 30 min before flow cytometry analysis. Cytokine detection: After staining, add 1 mL of 1× cell fixation medium and incubate at room temperature in the dark for 30 min. After centrifugation, add 1 mL of 1× cell permeabilization buffer to resuspend the fixed cells. Centrifuge again and discard the supernatant. Resuspend the cells in 100 μL of 1× cell permeabilization buffer, add TNF-α and IFN-γ fluorescent antibodies (Biolegend), mix well, and incubate overnight at 4°C in the dark. After centrifugation, resuspend the cells in PBS and analyze by flow cytometry. The results are shown below. Figures 3-4 As shown in Table 3.

[0034] Table 3. Proportions of major immune cell subsets in mice of different groups

[0035] according to Figures 3-4 As shown in Table 3, compared with the EV group, the UFL1 group had significantly higher levels of CD45 in tumor tissue. + The cell ratio has decreased slightly. Figure 3(A), CD4 + The cell ratio did not change significantly, CD8 + The proportion of T cells decreased significantly. Figure 3 (B) Treg cells (CD4) + CD25 + , Figure 3 C), MDSCs cells (CD11b) + Gr1 + , Figure 3 The proportion of CD11b macrophages was significantly increased; + F4 / 80 + , Figure 4 (CD11b) and M1 macrophages + F4 / 80 + CD86 + , Figure 4 The proportion of CD11b macrophages decreased, while the proportion of M2 macrophages (CD11b) decreased. + F4 / 80 + CD206 + , Figure 4 The level of UFL (in the middle B group) was significantly elevated, suggesting that UFL can promote the transformation of pro-inflammatory M1 macrophages into anti-inflammatory M2 macrophages.

[0036] (5) T cell-mediated tumor cell killing assay Due to CD8 + T cells are key immune cells in tumor immune escape, exerting anti-tumor effects through their cytotoxic activity. Immunosuppressive cells such as Tregs and MDSCs can also exert anti-tumor effects by inhibiting CD8. + T cell activity exerts an immunosuppressive effect, and further analysis of CD8 was performed using flow cytometry. + Changes in cytokines within T cells.

[0037] Spleen cells from the spleen tissue of C57 / B6 mice in step (3) were isolated. T-activator CD3 / CD28 (GIbco) magnetic beads were mixed by shaking and added to the cells. rIL-2 (30 U / mL, Sigma) was added, and the cells were cultured for 48 h to obtain activated spleen cells. The activated spleen cells were then seeded with mouse pancreatic cancer Panc-02 cells at a 1:1 ratio in 24-well plates and co-cultured for 48 h. After removing debris cells, mouse pancreatic cancer cells were collected, and cell death was detected by flow cytometry using 7-AAD (Biolegend) staining. The results are as follows: Figure 5 As shown in A~B and Tables 4~5.

[0038] Table 4. Proportions of TNF-α and IFN-γ cytokines in different groups of mice

[0039] Table 5. Relative cell viability of mice in different groups

[0040] according to Figure 5 As shown in Figure A, elevated UFL1 levels significantly reduced TNF-α and IFN-γ. Tumor killing assays also revealed that after co-culturing tumor cells with CD8+ T cells, elevated UFL1 levels resulted in a significantly higher survival rate for tumor cells compared to the control group, suggesting that UFL1 reduces CD8+ T cell activity. + T cell cytotoxicity ( Figure 5 (B)

[0041] (6) Immunofluorescence staining Mouse tumor tissues were fixed overnight at 4°C with 10% formalin buffer, embedded in paraffin, sectioned, deaffinity-free with xylene, rehydrated, and washed with PBS. EDTA retrieval buffer (Zsbio, ZLI-9067) was added, and the tissues were boiled for 15 min, then allowed to cool to room temperature. The tissues were blocked with PBS containing 10% rabbit serum for 30 min. Tumor cells were labeled with primary antibody CK19 (Proteintech, 14985-1-AP) and CD8α (abcam, ab217344) labeled with CD8α, respectively. + T cells. The staining procedure was as follows: First, the first primary antibody was added and incubated overnight at 4°C. After washing with PBS, the corresponding HRP-labeled secondary antibody was added and incubated at room temperature for 50 min. After washing with PBS, the corresponding TSA was added and incubated at room temperature in the dark for 10 min. The second primary antibody, secondary antibody, and TSA staining were then performed following the same steps. Finally, the cell nuclei were counterstained with DAPI. Fluorescence signals were read using a digital pathology slide scanner (3DHISTECH). DAPI channels appeared blue in the cell nuclei, 488-labeled CK19 channels appeared green, and CY3-labeled CD8 channels appeared red. The detection results are shown below. Figure 5 As shown in C~D and Table 6.

[0042] Table 6. Relative fluorescence intensity of mice in different groups

[0043] according to Figure 5 As shown in C-D, although the fluorescence intensity of tumor cells in the UFL1 group was slightly higher than that in the control group, it was not statistically significant. Meanwhile, CD8... + The fluorescence intensity of T cells was significantly lower than that of the control group, consistent with the results of flow cytometry. Therefore, the above results suggest that the promoting effect of elevated UFL1 on the growth of pancreatic cancer in mice may be due to the induction of an inhibitory immune microenvironment, and that elevated UFL1 promotes immune escape from pancreatic cancer in mice.

[0044] Example 2: UFL1 reduction inhibits tumor growth in mice and reshapes the tumor-suppressive immune microenvironment in mice. To further observe whether UFL1 knockout affects the growth and immune escape of pancreatic cancer in mice, a UFL1 knockout mouse model was constructed, and the steps are as follows: (1) Cell culture and transfection Five UFL1 sgRNA sequences were designed targeting the UFL1 gene and named sgUFL1-1, sgUFL1-2, sgUFL1-3, sgUFL1-4, and sgUFL1-5, respectively. The sequence information is shown in Table 7.

[0045] Table 7 UFL1 sgRNA sequence information

[0046] Anhui General Biotechnology Co., Ltd. was commissioned to subclone the five sequences into the lentiCRISPRV2-puro lentiviral vector.

[0047] Mouse pancreatic cancer cells (Panc-02) were cultured in DMEM medium containing 10% fetal bovine serum at 37°C with 5% CO2. When the cell density reached 80%, the lentiCRISPRV2-sgUFL1 plasmid and the empty vector control were transfected using Lipofectamine 3000. Transfection efficiency was determined by Western blotting analysis of protein expression levels. The results are shown in Table 7. Figure 6 As shown in Table 7, the knockout efficiency of sgUFL1-5 is the highest.

[0048] (2) Construction of mouse pancreatic cancer cells with UFL1 knockout The lenti CRISPRV2-sgUFL1-5 with the highest knockout efficiency (sgUFL1-5 sequence: CCAGGTGGAAGCATCCGTAG) was packaged into lentivirus using HEK-293T cells (vector construction and virus packaging were entrusted to Anhui General Biotechnology Co., Ltd.). After collecting the viral supernatant, it was used to infect Panc-02 cells. Stable cell lines were screened using puromycin. For specific operation steps, please refer to the reference [Wu Zhaochun, et al. Construction of PRDM5 overexpression lentiviral vector and establishment of stable transfection of Neuro-2a cells [J]. Journal of Jilin University (Medical Edition); 2025, 51(1): 1-8.].

[0049] (3) Establishment of tumor-bearing mouse model: The operation is the same as step (3) in Example 1. The tumor mass and volume of each group of mice are counted, and the results are as follows. Figure 7 As shown in Table 8.

[0050] Table 8 Tumor volume in mice of different groups

[0051] according to Figure 7 The tumor mass in the CTRL group was 686.80±67.74 mg, while that in the sgUFL1 group was 476.60±75.32 mg. These results indicate that the tumor mass and volume in the sgUFL1 group were significantly lower than those in the control CTRL group.

[0052] (4) Preparation of single-cell suspension of tumor tissue and flow cytometry: The operation was the same as step (4) in Example 1. The proportion of immune cells in the tumor tissue of mice in the sgUFL1 group and CTRL group was analyzed, and the results were as follows: Figures 8-9 As shown in Table 9.

[0053] Table 9. Proportions of major immune cell subsets in mice from different groups.

[0054] The results showed that, compared with the CTRL group, the sgUFL1 group had CD4 in tumor tissue. + The proportion of cells was significantly reduced, CD8 + The proportion of T cells increased significantly ( Figure 8 (A); Treg cells (CD4) + CD25 + , Figure 8 (CD11b) MDSCs cells + Gr1 + , Figure 8 The levels of CD11b in macrophages were significantly reduced; + F4 / 80 + , Figure 8 The proportion of CD11b macrophages did not change significantly, but the proportion of M2 macrophages (CD11b) increased. + F4 / 80 + CD206 + , Figure 9 The proportion of CD11b macrophages was significantly reduced, while the proportion of M1 macrophages (CD11b) was significantly reduced. + F4 / 80 + CD86 + , Figure 9 The significant increase in UFL1 (B) suggests that decreased UFL1 inhibits the transformation of M1 macrophages into M2 macrophages. Furthermore, decreased UFL1 levels also affect CD8... + Intracellular cytokine IFN-γ ( Figure 9 C levels were significantly elevated.

[0055] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of the UFL1 gene in the preparation of products that regulate tumor immune escape, characterized in that, The nucleotide sequence of the UFL1 gene is shown in SEQ ID NO.1; the tumor includes pancreatic cancer.

2. The application according to claim 1, characterized in that, The regulation includes: knocking out the UFL1 gene to suppress tumor immune escape.

3. The application of UFL1 as a target in the preparation of antitumor drugs, characterized in that, The nucleotide sequence of the UFL1 gene is shown in SEQ ID NO.1; the tumor includes pancreatic cancer.

4. The application according to claim 3, characterized in that, The antitumor drug's effects include at least one of the following: 1) reducing tumor mass; 2) reducing tumor volume; 3) increasing CD8+. + 4) Increase the level of immune cytokines; 5) Reduce the proportion of immunosuppressive Tregs, MDSCs and M2 macrophages.

5. The application according to claim 4, characterized in that, The immune cytokines include IFN-γ.

6. An antitumor drug, characterized in that, The drug includes reagents that inhibit UFL1 gene expression and / or reagents that inhibit UFL1 protein expression levels.

7. The drug according to claim 6, characterized in that, The reagents used to inhibit UFL1 gene expression include sgRNAs that target and knock out the UFL1 gene.

8. The medicament according to claim 7, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO.

6.

9. The drug according to any one of claims 6 to 8, characterized in that, The tumors include pancreatic cancer.

10. The medicament according to claim 10, characterized in that, The drug also includes pharmaceutically acceptable excipients.

Images