Fusion nanovesicles, methods of making and using the same

Abstract

The application relates to the technical field of biological medicines, in particular to a fusion nanovesicle and a preparation method and application thereof. The fusion nanovesicle is fused by small extracellular vesicles and lipid nanoparticles, the small extracellular vesicles carry a targeting element, and the small extracellular vesicles and the lipid nanoparticles are fused through physical fusion or chemical coupling. The fusion nanovesicle obtained by fusing the small extracellular vesicles and the lipid nanoparticles has the natural biocompatibility of the small extracellular vesicles and the high nucleic acid loading capacity of the lipid nanoparticles, so that the safety, stability and delivery efficiency of a nucleic acid drug delivery system are significantly improved, and the clinical application of the nucleic acid drug is promoted.

Description

Technical Field

[0001] This application relates to the field of biomedical technology, and in particular to a fused nanovesicle, its preparation method, and its application. Background Technology

[0002] Nucleic acid drugs, as an emerging therapeutic approach, have enormous potential applications at the gene regulation level, offering new solutions for many diseases that are difficult to treat with traditional drugs. However, nucleic acid molecules themselves have inherent limitations in the physiological environment, including but not limited to: poor stability in vivo, susceptibility to degradation by nucleases, low transmembrane efficiency, and lack of tissue targeting. These defects result in extremely low bioavailability and short half-life, severely limiting their therapeutic effects, especially in the treatment of central nervous system diseases requiring precise delivery and efficient uptake, where their application faces significant challenges.

[0003] To overcome the aforementioned obstacles, developing safe and efficient delivery vectors is crucial for the clinical translation of nucleic acid drugs. Currently, lipid nanoparticles (LNPs) are one of the most mature and widely used nucleic acid drug delivery platforms. LNPs can efficiently encapsulate nucleic acid molecules through electrostatic interactions, forming a core-shell structure that effectively protects them from nuclease degradation. Their nanoscale size and cationic lipid composition also promote cellular uptake and endosome escape. Nevertheless, the LNP system still has significant limitations in in vivo applications, such as the potential to trigger innate immune responses, non-specific distribution and accumulation in organs like the liver, and potential toxicity. These issues limit the safety and efficacy of LNPs in delicate, fragile, and immunosensitive tissues.

[0004] In contrast, small extracellular vesicles (sEVs), as an endogenous nanoscale delivery system, exhibit unique advantages. sEVs are naturally secreted membrane vesicles with excellent biocompatibility, low immunogenicity, and natural immune evasion capabilities. Their surfaces are rich in various membrane proteins such as CD47 and integrins, which not only mediate specific recognition and fusion with target cells but also endow them with the ability to cross biological barriers such as the blood-brain barrier and a long circulating half-life. These characteristics make sEVs an ideal carrier for delivering nucleic acid drugs to the central nervous system. However, the clinical application of sEVs also faces bottlenecks; their active loading efficiency for exogenous nucleic acid drugs is generally low, making it difficult to achieve high-dose drug encapsulation and controlled release at the target site.

[0005] Overall, there is a lack of nucleic acid drug delivery systems in this field that combine good biocompatibility, high nucleic acid loading efficiency, and specific targeting capabilities to promote the clinical application of nucleic acid drugs. Summary of the Invention

[0006] In view of the shortcomings of the prior art described above, in order to solve the problem that existing nucleic acid drug delivery systems are difficult to achieve good biocompatibility, high nucleic acid loading efficiency and specific targeting ability, the purpose of this application is to provide a fusion nanovesicle and its preparation method to solve the problems in the prior art.

[0007] To achieve the above and other related objectives, this application first provides a fused nanovesicle, which is formed by fusing small extracellular vesicles and lipid nanoparticles. The small extracellular vesicles carry a targeting element, and the small extracellular vesicles and lipid nanoparticles are fused by physical fusion or chemical coupling.

[0008] This application further provides a pharmaceutical composition comprising the above-mentioned fused nanovesicles and pharmaceutical excipients.

[0009] In addition, this application provides the use of the above-mentioned fused nanovesicles or the above-mentioned pharmaceutical composition in the preparation of a drug for treating spinal cord injury.

[0010] Finally, this application provides a method for preparing the above-mentioned fused nanovesicles, including the following steps:

[0011] a) Preparation of lipid nanoparticles encapsulated with nucleic acid drugs;

[0012] b) Prepare small extracellular vesicles carrying targeting elements;

[0013] c) The small extracellular vesicles and lipid nanoparticles are fused by extrusion to obtain fused nanovesicles.

[0014] Compared with the prior art, the beneficial effects of this application are as follows:

[0015] 1) This invention fuses sEVs with LNPs to obtain fused nanovesicles that combine the natural biocompatibility of sEVs with the high nucleic acid loading capacity of LNPs, thereby significantly improving the safety, stability and delivery efficiency of nucleic acid drug delivery systems and promoting the clinical application of nucleic acid drugs.

[0016] 2) Furthermore, addressing the specific needs of spinal cord injury repair, this invention designed a chimeric antigen receptor that actively targets the VGlut2 gene on the surface of VSX2 subset neurons in the spinal cord, and constructed siRNAs that downregulate the expression of PTEN and SOCS3 genes. Based on this, this invention successfully constructed a novel nucleic acid drug delivery system. This system can effectively enhance the regenerative potential of neurons, promote axonal regeneration and neurological function recovery after spinal cord injury, and provide a promising new therapeutic strategy for spinal cord injury repair. Attached Figure Description

[0017] Figure 1 A graph assessing the ability of different siRNAs to downregulate PTEN expression; among them... Figure 1 A shows the results of the Western blotting test. Figure 1 B is a bar chart comparing the ability of different siRNAs to downregulate PTEN expression.

[0018] Figure 2 A graph assessing the ability of different siRNAs to downregulate SOCS3 expression; among them... Figure 2 A shows the results of the Western blotting test. Figure 2 B is a bar chart comparing the ability of different siRNAs to downregulate SOCS3 expression.

[0019] Figure 3 Transmission electron microscopy image of LNP-siRNA (PTEN+SOCS3).

[0020] Figure 4 This is a particle size distribution map of LNP-siRNA (PTEN+SOCS3).

[0021] Figure 5 The image shows the WB detection results of LNP-siRNA (PTEN+ SOCS3).

[0022] Figure 6 This is a fluorescence signal detection image after CAR lentivirus transfection into 293T cells.

[0023] Figure 7 This is a particle size distribution map of CAR-sEVs.

[0024] Figure 8 Transmission electron microscope image of CAR-sEVs.

[0025] Figure 9 This is a WB test result image of CAR-sEVs.

[0026] Figure 10 Fluorescence signal detection for fused nanovesicles (CAR-HNV).

[0027] Figure 11 This is a transmission electron microscope image of CAR-HNV.

[0028] Figure 12 The image shows the Western blot results of CAR-HNV@siRNA (PTEN+SOCS3); among them, Figure 12 A is a schematic diagram illustrating the ability of CAR-HNV@siRNA (PTEN+SOCS3) to downregulate PTEN expression; Figure 12 B is a schematic diagram illustrating the ability of CAR-HNV@siRNA (PTEN+SOCS3) to downregulate SOCS3 expression.

[0029] Figure 13 These are laser confocal microscopy images of DRG ganglion neuron axons after various HNV interventions.

[0030] Figure 14 The image shows the WB detection results for each HNV that upregulated GAP43 and Tuj1 expression.

[0031] Figure 15 A schematic diagram of HNV targeting the spinal cord nerve tissue of SD rats.

[0032] Figure 16 The images show the morphology of the lower limbs of seven groups of SD rats after corresponding interventions. In the Sham group, the hind limbs could fully bear weight and push off the ground, generating effective forward thrust, and the entire foot made stable contact with the ground upon landing. In the SCI group, the hind limbs could not support the weight at all when walking, and the rats dragged behind their bodies. The HNV@siRNA(PTEN), HNV@siRNA(SOCS3), and HNV@siRNA Scramble groups were similar to the SCI group. HNV@siRNA(PTEN+SOCS3) showed some improvement. In contrast, CAR-HNV@siRNA(PTEN+SOCS3) restored some support function and alternating gait, and the foot landing pattern tended to be normal.

[0033] Figure 17 A comparison chart of BBB scores for 7 groups of SD rats.

[0034] Figure 18 Images of HE and LFB staining of spinal cord specimens from 7 groups of SD rats.

[0035] Figure 19 The image shows the liver and kidney function test results of 7 groups of SD rats 42 days after spinal cord injury surgery.

[0036] Figure 20 HE staining results of organs from 7 groups of SD rats 42 days after spinal cord injury surgery. Detailed Implementation

[0037] To make the inventive objectives, technical solutions, and beneficial effects of this application clearer, the following description, in conjunction with embodiments, further illustrates this application. It should be understood that the embodiments described are for illustrative purposes only and are not intended to limit the scope of the application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and those skilled in the art can easily understand other advantages and effects of this application from the content disclosed in this description.

[0038] The first aspect of this application provides a fused nanovesicle, which is formed by fusing small extracellular vesicles and lipid nanoparticles. The small extracellular vesicles carry a targeting element, and the small extracellular vesicles and lipid nanoparticles are fused by physical fusion or chemical coupling.

[0039] In this application, the term "physical fusion" refers to a method in which small extracellular vesicles and the lipid membrane of lipid nanoparticles are mixed and reorganized through physical external force or conditions without the introduction of chemical cross-linking agents, ultimately forming a single, stable fused vesicle. This includes, but is not limited to, methods such as extrusion, ultrasonic treatment, freeze-thaw cycles, and electrofusion.

[0040] In this application, the term "chemical coupling" refers to a method of linking small extracellular vesicles and lipid nanoparticles together by introducing a specific chemical cross-linking agent or utilizing chemical reactions between functional groups to form covalent bonds. This includes, but is not limited to, maleimide-thiol coupling, click chemistry, SPDP coupling, and enzymatic coupling.

[0041] In some specific embodiments, the targeting element is an element that targets a target cell surface protein.

[0042] Preferably, the target cells are spinal cord VSX2 subset neurons.

[0043] Preferably, the target cell surface protein is VGlut2.

[0044] In some specific embodiments, the targeting element is a chimeric antigen receptor.

[0045] Preferably, the chimeric antigen receptor comprises a single-chain antibody targeting VGlut2, wherein the single-chain antibody comprises a heavy chain variable region and a light chain variable region.

[0046] More preferably, the sequence of the heavy chain variable region of the single-chain antibody includes the sequence shown in SEQ ID NO.18, and the sequence of the light chain variable region of the single-chain antibody includes the sequence shown in SEQ ID NO.19.

[0047] More preferably, the sequence of the single-chain antibody includes the sequence shown in SEQ ID NO.17.

[0048] Preferably, the chimeric antigen receptor includes a hinge region.

[0049] More preferably, the sequence of the hinge region includes the sequence shown in SEQ ID NO.20.

[0050] Preferably, the chimeric antigen receptor includes a transmembrane region.

[0051] More preferably, the sequence of the transmembrane region includes the sequence shown in SEQ ID NO.21.

[0052] In some specific embodiments, the lipid nanoparticles are encapsulated with nucleic acid drugs.

[0053] Preferably, the nucleic acid drug is a nucleic acid drug that specifically downregulates the expression of PTEN and / or SOCS3.

[0054] Preferably, the nucleic acid drug is siRNA.

[0055] More preferably, the siRNA sequence comprises any one or more of the following sets of siRNA sequences:

[0056] a) The siRNA shown in SEQ ID NO:1~2;

[0057] b) The siRNA shown in SEQ ID NO:3~4;

[0058] c) The siRNA shown in SEQ ID NO:5~6;

[0059] d) The siRNA shown in SEQ ID NO: 9~10;

[0060] e) The siRNA shown in SEQ ID NO: 11~12;

[0061] f) The siRNA shown in SEQ ID NO:13~14.

[0062] More preferably, the siRNA sequence comprises the siRNA sequences shown in SEQ ID NO:5~6 and SEQ ID NO:13~14.

[0063] In some specific embodiments, the mass ratio of the small extracellular vesicles to lipid nanoparticles is 1:(1~5).

[0064] Preferably, the mass ratio of the small extracellular vesicles to the lipid nanoparticles is 1:1.

[0065] In some specific implementations, the physical fusion method is extrusion.

[0066] In this application, the term "extrusion method" refers to the physical process of repeatedly passing a mixture of small extracellular vesicles and lipid nanoparticles through a filter membrane with a specific pore size under pressure, thereby using fluid shear force and membrane pore constraint to fuse the membrane structure and obtain fused nanovesicles with uniform particle size.

[0067] In some specific embodiments, the fused nanovesicles have a core-shell structure and carry targeting elements on their surface.

[0068] A second aspect of this application provides a pharmaceutical composition comprising the fused nanovesicles described in the first aspect, and pharmaceutical excipients.

[0069] In this application, the term "pharmaceutical excipient" refers to any substance, other than the fused nanovesicles, added to maintain their physicochemical properties and bioactivity stability, ensure the sterility and safety of the formulation, and meet the requirements for administration, including but not limited to: buffers such as phosphate buffer, Tris-HCl buffer, 4-hydroxyethylpiperazine ethanesulfonic acid; isotonic adjusters such as sucrose, trehalose, mannitol, or sodium chloride; stabilizers such as trehalose, sucrose, and mannitol; surfactants such as poloxamer 188 and polysorbate 80; and water for injection.

[0070] In some specific embodiments, the pharmaceutical composition is an injectable formulation.

[0071] The third aspect of this application provides the use of the fused nanovesicles described in the first aspect or the pharmaceutical composition described in the second aspect in the preparation of a medicament for treating spinal cord injury.

[0072] In this application, the term "spinal cord injury" refers to a class of neurological diseases caused by traumatic or non-traumatic factors that disrupt the structural integrity of the spinal cord, cause nerve cell death and interruption of neural pathways, and result in motor, sensory and autonomic dysfunction.

[0073] The fourth aspect of this application provides a method for preparing the fused nanovesicles described in the first aspect, comprising the following steps:

[0074] a) Preparation of lipid nanoparticles encapsulated with nucleic acid drugs;

[0075] b) Prepare small extracellular vesicles carrying targeting elements;

[0076] c) The small extracellular vesicles and lipid nanoparticles are fused by extrusion to obtain fused nanovesicles.

[0077] In some specific embodiments, step a) includes adding a lipid organic phase to an aqueous phase containing a nucleic acid drug.

[0078] Preferably, the lipid organic phase comprises Dlin-MC3-DMA, DOPE, DMG-PEG2000 and cholesterol.

[0079] Preferably, the volume ratio of the lipid organic phase to the aqueous phase is 1:3.

[0080] Preferably, the addition of the lipid organic phase to the aqueous phase containing the nucleic acid drug is performed using a microfluidic chip.

[0081] In some specific embodiments, step b) of the preparation method includes: using lentivirus transduced cells containing a chimeric antigen receptor coding sequence to collect small extracellular vesicles secreted by the cells.

[0082] Preferably, the cells are 293T cells.

[0083] In some specific embodiments, in step c), the mass ratio of the small extracellular vesicles to the lipid nanoparticles is 1:(1~5).

[0084] Preferably, the mass ratio of the small extracellular vesicles to the lipid nanoparticles is 1:1.

[0085] In some specific implementations, in step c), the final controlled pore size of the extrusion method is 200 nm.

[0086] The present invention will be further illustrated by the following examples, but these examples do not limit the scope of the invention.

[0087] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. All reagents or instruments whose manufacturers are not specified are conventional products that can be purchased commercially. In addition to the specific methods, equipment, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, equipment, and materials similar to or equivalent to those described, used, and materials in the embodiments of this invention may be used to implement this invention.

[0088] Example 1: Preparation of fused nanovesicles (HNV)

[0089] 1. Selection of siRNA sequences

[0090] We selected the PTEN gene (ID: 50557), chose the PTEN gene sequence from GenBank, and designed three groups of specific small interfering RNAs (siRNAs) according to the design principles of RNAi. At the same time, we designed a non-specific siRNA (Scramble). The corresponding siRNA powder was produced by Shanghai Sangon Biotech Co., Ltd.

[0091] The sequences of the three siRNAs are as follows:

[0092] siRNA1 group:

[0093] CAGUAGAAAUUGUCCUACA(SEQ ID No.1)

[0094] UGUAGGACAAUUUCUACUG(SEQ ID No.2)

[0095] siRNA group 2:

[0096] GGGUAAAUACGUUCUUCAU (SEQ ID No.3)

[0097] AUGAAGAACGUAUUUACCC(SEQ ID No.4)

[0098] siRNA3 group:

[0099] GAGGCGCUAUGUAUAUUAU(SEQ ID No.5)

[0100] AUAAUAUACAUAGCGCCUC(SEQ ID No.6)

[0101] siRNA Scramble group:

[0102] UUCUCCGAACGUGUCACGUTT(SEQ ID No.7)

[0103] ACGUGACACGUUCGGAGAATT (SEQ ID No.8)

[0104] In addition, a control group (PBS group) was set up, which did not receive any treatment.

[0105] Following the same steps, we selected the SOCS3 gene (ID: 89829), obtained the SOCS3 gene sequence from GenBank, and designed three groups of specific small interfering RNAs (siRNAs) according to the design principles of RNAi. At the same time, we designed a non-specific siRNA (Scramble). The corresponding siRNA powder was produced by Shanghai Sangon Biotech Co., Ltd.

[0106] The sequences of the three siRNAs are as follows:

[0107] siRNA1 group:

[0108] GCUCCAAGAGCGAGUACCA(SEQ ID No.9)

[0109] UGGUACUCGCUCUUGGAGC(SEQ ID No.10)

[0110] siRNA group 2:

[0111] GCUUUGACUGUACUCAA (SEQ ID No.11)

[0112] UUGAGUACACAGUCAAAGC(SEQ ID No.12)

[0113] siRNA3 group:

[0114] AGAGAGCUUACUACAUCUA(SEQ ID No.13)

[0115] UAGAUGUAGUAAGCUCUCU(SEQ ID No.14)

[0116] siRNA Scramble group:

[0117] UUCUCCGAACGUGUCACGUTT(SEQ ID No.15)

[0118] ACGUGACACGUUCGGAGAATT (SEQ ID No.16)

[0119] In addition, a control group (PBS group) was set up, which did not receive any treatment.

[0120] PC12 neurons were used at a concentration of 1×10⁻⁶. 6 Inoculate one cell per well into a 6-well plate, and begin transfection the following day.

[0121] (1) Dilution of siRNA: Carefully check the label on the EP tube containing the siRNA powder to confirm the nmol amount of RNA, and dilute it to a 20 μM stock solution. Then take four sterile EP tubes and add 125 μL of Opti-MEM™ I serum-reduced medium (Gibco, catalog number 31985070) to each tube. Then add 7.5 μL of the three designed siRNA groups and Scramble stock solution to each tube, and gently pipette to mix.

[0122] (2) Diluting Liposome 3000: Take four more sterile EP tubes and add 125 μL of Opti-MEM™ I serum-reduced medium to each tube. Then add 5 μL of Lipofectamine™ 3000 reagent (Thermo Fisher Scientific, catalog number L3000015) to each tube and gently pipette to mix, thus obtaining the diluted Liposome 3000 solution.

[0123] (3) Add all of the diluted Liposome3000 solution from step (2) to the diluted siRNA solution from step (1) and gently mix by pipetting or by vortexing briefly for 1 minute to obtain a mixture.

[0124] (4) Let the mixture from step (3) stand at room temperature for 10-15 minutes to allow the liposome-siRNA complex to form.

[0125] (5) Remove the P12 cells from the 6-well plate, aspirate the old culture medium from the wells, and replace it with 1250 μL of fresh serum-free DMEM medium (Gibco). Add 250 μL of the liposome-siRNA complex from step (4) dropwise evenly to the corresponding cell wells. Gently shake the cell plate back and forth and side to side to distribute the cells evenly. Place the cell plate back in a 37°C, 5% CO2 incubator for further culture. After 6-8 hours of transfection, replace the medium with complete culture medium (Gibco). Continue culturing. Complete culture medium refers to DMEM medium containing 10% FBS.

[0126] (6) Cell proteins were extracted 48-72 h after transfection and the expression of the target protein was detected by Western Blot.

[0127] Western Blot (WB) results are as follows Figure 1 and Figure 2 As shown in the figure. PTEN used GADPH as an internal reference gene, and SOCS3 used β-tublin as an internal reference gene. The expression levels of PTEN and SOCS3 proteins were statistically analyzed.

[0128] from Figure 1 and Figure 2 It was found that, compared with the control group (LPS group) and the negative control group (siRNA Scramble), the expression levels of PTEN and SOCS3 proteins in the siRNA treatment groups (siRNA 1, siRNA 2, siRNA 3) were significantly reduced. Among them, compared with the control group (LPS group), the siRNA 3 group was able to significantly silence the expression levels of PTEN and SOCS3 proteins. P <0.01), and subsequent experiments were conducted using PTEN and SOCS3 siRNA 3.

[0129] 2. Preparation and Identification of Lipid Nanoparticles (LNPs)

[0130] LNPs were prepared according to the following method, and siRNA was bound to the LNPs to encapsulate siRNA PTEN and siRNA SOCS3 within the lipid nanoparticles LNPs, ensuring stability and delivery efficiency. This structure effectively protects siRNA from nuclease degradation, enabling targeted uptake by nerve cells.

[0131] (1) Preparation of lipid nanoparticles encapsulating siRNA

[0132] ① Obtaining the lipid organic phase

[0133] Four raw materials were weighed: dioleoylphosphatidylcholine-dimethacrylate (Dlin-MC3-DMA), dioleoylphosphatidylethanolamine (DOPE), cholesterol, and DMG-PEG2000 (distearyl methyl propylene glycol-polyethylene glycol 2000). They were dissolved in anhydrous ethanol to obtain 10 mg / mL Dlin-MC3-DMA stock solution, 5 mg / mL DOPE stock solution, 10 mg / mL cholesterol stock solution, and 10 mg / mL DMG-PEG2000 stock solution. Then, 12 μL of the corresponding volume of Dlin-MC3-DMA stock solution, 56 μL of DLE stock solution, 56 μL of cholesterol stock solution, and 14 μL of DMG-PEG2000 stock solution were respectively taken and ethanol was added to make up to 333 μL to obtain the lipid organic phase.

[0134] ② Obtaining the aqueous phase of siRNA REST

[0135] The mass of siRNA PTEN and siRNA SOCS3 (i.e. siRNA 3) was calculated based on the obtained molar amounts. DEPC water was added to prepare siRNA PTEN and siRNA SOCS3 stock solutions. Then, the siRNA PTEN and siRNA SOCS3 stock solutions were diluted to 0.1 mg / mL with sodium citrate buffer (50 nM, pH=4.5) to obtain the siRNA REST aqueous phase.

[0136] Mass = molar mass × average molecular mass of nucleotide (330 Da).

[0137] ③ LNP-siRNA REST preparation

[0138] Based on the ratio of the molar number of nitrogen (N) atoms in the cationic lipid to the molar number of phosphorus (P) atoms in the siRNA, with an N / P ratio of 6:1, the amounts of siRNA PTEN and siRNA SOCS3 in the aqueous phase were determined. Using an organic phase injection method, the obtained organic phase was added dropwise to the aqueous phase (Vorganic phase:Vaqueous phase = 1:3), vortexed, allowed to stand, and assembled to form lipid nanoparticles encapsulated with siRNA (labeled LNP-siRNA PTEN). The specific steps are as follows:

[0139] The organic phase was injected into the aqueous phase using a microfluidic chip (Hangzhou Tingke Biotechnology Co., Ltd., NSR-E20). Specifically, 333 μL of the lipid organic phase obtained in step ① was drawn into a syringe, and 1 mL of the siRNA aqueous phase was drawn into another syringe. The flow rate ratio of the organic phase to the aqueous phase was set to 1:3, and the total flow rate was set to 12 mL / min. The organic phase and the aqueous phase were injected into the microfluidic chip at the same time. Inside the chip, the organic phase and the aqueous phase met and mixed rapidly in a specific mixing region to form lipid nanoparticles. The lipid nanoparticles encapsulating siRNA (abbreviated as LNP-siRNA PTEN) were collected from the chip outlet.

[0140] Meanwhile, lipid nanoparticles (LNP-siRNA Scramble, LNP-siRNA SOCS3 and LNP-siRNA (PTEN+SOCS3)) were prepared by using siRNA SOCS3, siRNA (PTEN+SOCS3) and non-specific siRNA (Scramble) in the same way as siRNA PTEN.

[0141] (2) Identification of lipid nanoparticles encapsulating siRNA

[0142] Images of LNP-siRNA (PTEN+SOCS3) were captured using transmission electron microscopy. The particle size distribution and zeta potential of LNP-siRNA (PTEN+SOCS3) were detected using NTA. Western blotting was used to determine its inhibitory effect on PTEN and SOCS3.

[0143] ① Transmission electron microscopy images of LNP-siRNA (PTEN+SOCS3)

[0144] The sample was placed on a 2 mm diameter copper grid and allowed to stand at room temperature for 5 minutes. The residual liquid at the edge of the copper grid was then gently absorbed with filter paper. The copper grid was then inverted onto a drop of 30 g / L phosphotungstic acid (pH 6.8) and negatively stained at room temperature for 5 minutes. Finally, the copper grid was dried under an incandescent lamp and observed and photographed under a transmission electron microscope.

[0145] like Figure 3 As shown, LNP-siRNA (PTEN+SOCS3) particles are approximately spherical or near-spherical in shape, relatively uniformly distributed, and without obvious aggregation. The typical nucleus-shell structure can be clearly observed, and the particle surface is relatively smooth with clear boundaries.

[0146] ② Detection of particle size distribution of LNP-siRNA (PTEN+SOCS3)

[0147] Dilute the sample to the optimal concentration for instrument detection, mix thoroughly, and then inject 1 mL of sample into the sample chamber at a uniform rate using a disposable syringe. The particle size of the sample will be displayed through the instrument's built-in software (e.g., ...). Figure 4 (As shown).

[0148] The average particle size of LNP-siRNA (PTEN+SOCS3) is around 200 nm.

[0149] ③ Western blot analysis of LNP-siRNA (PTEN+SOCS3)

[0150] The effects of the prepared LNP-siRNA (PTEN+SOCS3) on the expression of PTEN and SCOS3 in nerve cells were detected by Western blotting.

[0151] PC12 neurons were seeded in 6-well plates at a seeding rate of 220,000 cells per well and divided into 3 groups:

[0152] CON group: PC12 neurons were supplemented with only complete culture medium. Complete culture medium refers to DMEM containing 10% serum.

[0153] LNP-siRNA Scramble group: Add complete culture medium containing 100 nM of the prepared LNP-siRNA Scramble.

[0154] LNP-siRNA (PTEN+SOCS3) group: Add complete culture medium containing 100 nM of the prepared LNP-siRNA PTEN+SOCS3.

[0155] The cells were incubated at 37°C for 48 hours before Western blot analysis.

[0156] like Figure 5 As shown, LNP-siRNA (PTEN+SOCS3) can be well transfected into P12 nerve cells and then taken up, significantly downregulating the expression of PTEN and SCOS3.

[0157] 3. Preparation and identification of small extracellular vesicles (sEVs) expressing CAR molecules (CAR-sEVs)

[0158] 293T cells stably transfected with the CAR gene construct were selected, and sEVs expressing the CAR molecule were obtained via exosome secretion. The particle size distribution and zeta potential of the obtained CAR-sEVs were determined by NTA (nanoparticle tracking analysis), their morphology was photographed by TEM (transmission electron microscopy), and the expression of typical marker proteins (such as Alix, CD81, and TSG101) and CAR-specific domains were verified by Western blotting.

[0159] The chimeric antigen receptor (CAR) was designed by the inventors targeting VGlut2. Its structure includes a single-chain antibody fragment (scFv), a hinge region, and a transmembrane region, with the specific sequence as follows:

[0160] Single-chain antibody fragments (scFv):

[0161] (SEQ ID No. 17)

[0162] in,

[0163] Full-length sequence of the variable region of the heavy chain of a single-chain antibody fragment:

[0164] ATGGGCTGGTCCTGCATCATTCTGTTTCTGGTGGCCACAGCCACCGGCGTGCACTCTGAAGTTCAGCTGCAACAGTCTGGCGCCGAGGTTGTGAAACCTGGCGCCTCTGTGAAGCTGAGCTGTACCGCCAGCGGCTTCAACATCAAGGACACCTACATGCACTGGGTCAACCAGCGGCCTGAGCAGGGACTCGAGTGGATCGGAAGAATCGACCCCGCCAACGGCAACACCCAGTACGACCCCAAGTTCAGAGACAAGGCCACCATCACCGCCGACACCAGCAGCAATACTGCCTACCTGCAGCTGAGCAGCCTGACCTCTGAAGATACCGCCGTGTACTACTGTGCCAAGGGCGCCTATT(SEQ IDNo.18)

[0165] Full-length sequence of the variable region of the single-chain antibody fragment light chain:

[0166] CCAGGGAACACTGGTCACAGTTAGCTCTGGTGGCGGAGGATCTGGCGGAGGTGGAAGCGGCGGAGGCGGTAGCGGAGGTGGTGGATCTGATATCGTGCTGACACAGAGCCCCAGCAGCCTGTCTGCCTCTCTGGGAGAAAGAGTGTCCCTGACCTGTAGAGCCAGCCAGGATATCGGCAGCTCCCTGATCTGGCTGCAGCAAGAGCCTGACGGCACCATCAAGAGACTGATCTACGCCACCTCCAGCCTGGATAGCGGCGTGCCAAAGAGATTTTCTGGCAGCGGCAGCGGCTCCGAGTTCAGCCTGACAATCAGCTCTCTGGAAAGCGAGGACTTCGTGGACTACTACTGCCTGCAGTACGCCAGCTCTCCCTACACATTTGGCGGAGGCACCAAGCTGGAAATCAAG(SEQ ID No.19)

[0167] Hinge region:

[0168] ACCACCACCAAGCCTGTGCTGAGAACCCCTTCTCCTGTGCACCCTACCGGCACAAGCCAGCCTCAAAGACCTGAGGACTGCAGACCTAGAGGCTCCGTGAAAGGCACAGGCCTGGACTTCGCCTGCGACATCTAT (SEQ ID No. 20)

[0169] Transmembrane region:

[0170] ATCTGGGCTCCTCTGGCCGGCATCTGTGTGGCTCTGCTGCTGTCTCTGATCATCACCCTGATC (SEQID NO.21)

[0171] To facilitate subsequent tracking, the intracellular segment structure of this CAR molecule was specially designed: its traditional signal transduction domain was completely removed and replaced with a novel intracellular segment composed of EGFP fluorescent protein.

[0172] EGFP (intracellular fragment):

[0173] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA (SEQ ID No.22)

[0174] The full-length sequence of the chimeric antigen receptor (CAR) used subsequently is as follows:

[0175]

[0176] (1) Preparation of CAR-sEVs

[0177] CAR-293T cells were obtained by co-culturing 293T cells with lentivirus containing CAR. The CAR-293T cells were then passaged and serum-free α-MEM was added to collect the culture supernatant. The collection time was 48 hours, and the cell density of the collected supernatant was above 70%.

[0178] The collected supernatant was centrifuged sequentially at 500g (4℃) and 2000g (4℃) for 10 min to remove dead cells and cell debris. The supernatant was then centrifuged at 4℃ and 10000g for 30 min to remove organelles. The supernatant was then transferred to a 100kDa MWCO ultrafiltration centrifuge tube and centrifuged at 2000g for 30 min. The concentrate was then collected and ultracentrifuged at 4℃ and 100000g for 70 min to collect the precipitate (i.e., CAR-sEVs particles).

[0179] Then, the CAR-sEVs particles were resuspended in phosphate-buffered saline (PBS) and centrifuged again at 100,000 g for 70 min to collect the precipitate.

[0180] Finally, the CAR-sEVs particles were resuspended in phosphate-buffered saline (PBS), the purified CAR-sEVs were collected, and filtered through a 0.22 μm pore filter to obtain a CAR-sEVs suspension. The solution was stored in a freezer at -80°C for later use.

[0181] (2) Identification of CAR-sEVs

[0182] ① Detection of fluorescence signals in transfected cells

[0183] like Figure 6 As shown, CAR lentivirus transfected 293T cells emitted green fluorescence, proving that the transfection was successful.

[0184] ② Detection of particle size distribution of CAR-sEVs

[0185] like Figure 7 As shown, the average particle size of CAR-sEVs is around 100 nm.

[0186] ③ Transmission electron microscopy images of CAR-sEVs

[0187] like Figure 8 As shown, the sample particles are approximately spherical or near-spherical in shape, relatively uniformly distributed, without obvious aggregation, and a membrane structure can be observed.

[0188] ④ Western blot analysis of CAR-sEVs

[0189] like Figure 9 As shown, the sEVs marker proteins TSG101, CD81, and Alix were positively expressed, while Calnexin was negative, indicating that sEVs were successfully extracted.

[0190] The GFP positivity of the CAR-sEVs sample indicates that the target molecule has been expressed on its membrane and can target nerve cells.

[0191] 4. Preparation and characterization of fused nanovesicles (CAR-HNV)

[0192] CAR-HNV is obtained by combining LNP and CAR-sEVs.

[0193] (1) Preparation of CAR-HNV

[0194] After extracting total protein from CAR-sEVs, the protein concentration was determined using a BSA protein quantification kit, and the protein concentration was used to represent the mass of CAR-sEVs. LNP was quantified according to the total lipid mass in the component, and the LNP mass was used to represent the LNP mass. Then, the two were mixed at a mass ratio of 1:1 and extruded sequentially through a polycarbonate membrane with 400 nm and 200 nm pore sizes using an Avanti liposome extruder, for a total of 30 extrusions, thereby forming fused nanovesicles (CAR-HNV).

[0195] The preparation of HNV is the same as that of CAR-HNV, except that during fusion, CAR-sEVs are replaced with non-targeted, control-type CON-sEVs.

[0196] HNV@siRNA SOCS3; HNV@siRNA PTEN; HNV@siRNA (PTEN+SOCS3) were prepared by pre-encapsulating siRNA SOCS3, siRNA PTEN, and siRNA (PTEN+SOCS3) with LNP.

[0197] Similarly, CAR-HNV@siRNA SOCS3; CAR-HNV@siRNA PTEN; and CAR-HNV@siRNA (PTEN+SOCS3) were prepared by pre-encapsulating siRNA SOCS3, siRNA PTEN, and siRNA (PTEN+SOCS3) with LNPs.

[0198] (2) Characterization of CAR-HNV

[0199] ① Detection of CAR-HNV fluorescence signals

[0200] like Figure 10As shown, the successful construction of CAR-HNV was verified by labeling LNP with the fluorescent dye DiO and CAR-sEVs with Dil.

[0201] ② Transmission electron microscopy images of CAR-HNV

[0202] like Figure 11 As shown, CAR-HNV particles are approximately spherical or near-spherical in shape, relatively uniformly distributed, and without obvious aggregation. A typical core-shell structure can be clearly observed, and the particle surface is relatively smooth with clear boundaries.

[0203] ③ Western blot analysis of CAR-HNV@siRNA (PTEN+SOCS3)

[0204] like Figure 12 As shown, the CAR-HNV@siRNA (PTEN+SOCS3) prepared in this invention can inhibit the expression of PTEN and SOCS3.

[0205] Example 2: Efficacy verification of fused nanovesicles (CAR-HNV)

[0206] 1. In vitro experiments

[0207] ① Immunofluorescence validation experiment to promote DRG neuron axonal growth

[0208] After co-culturing each group (HNV@siRNA SOCS3; HNV@siRNA PTEN; HNV@siRNA scramble; HNV@siRNA (PTEN+SOCS3); CAR-HNV@siRNA (PTEN+SOCS3)) with dorsal root ganglion cells (DRG) for 48 h, they were fixed with 4% formaldehyde, washed with PBS, blocked with 5% bovine serum albumin (BSA) for at least 30 min, and then the excess liquid was removed. The cells were incubated overnight at 4°C with primary antibody (1:200 dilution) and Tuj1 antibody. The primary antibody was recovered, and the cells were washed with PBS for histochemistry. Subsequent steps were performed in the dark, and the corresponding fluorescent antibodies were incubated at room temperature for 45 min (1:200 dilution). The cells were gently washed with PBS for histochemistry. The slides were mounted and photographed using a laser confocal microscope.

[0209] like Figure 13 As shown, compared with the PBS group, CAR-HNV@siRNA (PTEN+SOCS3) significantly increased axonal growth in DRG neurons after knocking down PTEN and SOCS3 expression.

[0210] ② Western blot (WB) validation experiment to promote axonal growth in DRG neurons

[0211] Upregulation of GAP43 and Tuj1 expression is a strong positive indicator supporting the enhanced growth capacity of DRG neurons.

[0212] Each group (HNV@siRNA SOCS3; HNV@siRNA PTEN; HNV@siRNA scramble; HNV@siRNA (PTEN+SOCS3); CAR-HNV@siRNA (PTEN+SOCS3)) was co-cultured with DRG neurons for 48 h, and then related proteins were extracted. The levels of GAP43 and Tuj1 were detected by Western blotting.

[0213] like Figure 14 As shown, inhibiting PTEN or SOCS3 expression upregulated the expression of axon growth-related proteins GAP43 and Tuj1; while in the HNV@siRNA (PTEN+SOCS3) and CAR-HNV@siRNA (PTEN+SOCS3) groups that jointly inhibited PTEN and SOCS3 expression, the expression of GAP43 and Tuj1 was upregulated even more.

[0214] 2. Animal experiments

[0215] ① Spinal cord VSX2 subset neuron cell targeting experiment

[0216] Three SD rats were injected intravenously with siRNA (PTEN+SOCS3); HNV@siRNA (PTEN+SOCS3); and CAR-HNV@siRNA (PTEN+SOCS3), respectively.

[0217] like Figure 15 As shown, small animal imaging revealed that CAR-HNV@siRNA(PTEN+SOCS3) can better target neural tissue.

[0218] ② Experiment on assessing the recovery of hindlimb motor function after spinal cord injury in rats

[0219] A spinal cord injury model was established in SD rats using the following method:

[0220] Forty-two 6-8 week old, 200-220g female SD rats were divided into 7 groups of 6 rats each. The specific groups are as follows:

[0221] Sham group: sham surgery group, where only the spinal canal is opened without damaging the spinal cord;

[0222] SCI group: spinal cord injury group, model group;

[0223] HNV@siRNA SOCH3 group: HNV@siRNA SOCH3 was injected into the tail vein after modeling;

[0224] HNV@siRNA PTEN group: HNV@siRNA PTEN was injected into the tail vein after modeling;

[0225] HNV@siRNA scramble group: HNV@siRNA scramble was injected via tail vein after modeling;

[0226] HNV@siRNA(PTEN+SOCS3) group: HNV@siRNA(PTEN+SOCS3) was injected into the tail vein after modeling;

[0227] CAR-HNV@siRNA(PTEN+SOCS3) group: CAR-HNV@siRNA(PTEN+SOCS3) was injected via the tail vein after modeling.

[0228] After being weighed and anesthetized, rats were placed in a prone position on the operating table. The fur on the rat's back was prepared. After disinfection with povidone-iodine, a midline dorsal incision was made, separating the skin and muscles to fully expose the spine. After accurate positioning, a T9-T11 laminectomy was performed, with the movements as gentle as possible to avoid spinal cord damage. The laminectomy was removed to fully expose the spinal cord. The T9-T11 segments were exposed, and the spinal cord was clamped for 5 seconds using microforceps before being released. After achieving adequate hemostasis, the wound was sutured layer by layer. Postoperatively, different groups of drugs were administered via the tail vein, with each rat receiving 10 nmol of the corresponding drug for 5 consecutive days. Artificial urination was assisted twice daily until the rat's spontaneous urination function recovered.

[0229] Their Basso-Beattie-Bresnahan (BBB) ​​scores were measured and compared at 1, 7, 14, 21, 28, 35, and 42 days after surgery.

[0230] Table 1 Basso-Beattie-Bresnahan (BBB) ​​Scoring Table

[0231]

[0232] The BBB scoring results showed that on postoperative day 1, the Sham group rats were able to move normally, scoring 21 points, while the other 6 groups of rats dragged their hind limbs behind them, exhibiting bilateral hind limb paralysis, indicating that the spinal cord injury model was successfully established. Figure 17 As shown, spinal cord function gradually recovered and scores gradually increased in all groups of rats over time. Moreover, at 6 weeks post-surgery, the scores of the CAR-HNV@siRNA (PTEN+SOCS3) treatment group were significantly higher than those of the SCI group, and the difference was statistically significant.

[0233] ③ HE staining and LFB staining experiments on rat spinal cord specimens

[0234] Forty-two days after spinal cord injury surgery in SD rats, the rats were anesthetized, fixed in a supine position, and the chest was opened to expose the heart for cardiac puncture. Simultaneously, the right atrial appendage was cut open. Pre-cooled 0.9% saline solution (4°C) was rapidly perfused into the left ventricle. When the tissue turned white and the fluid flowing from the right atrial appendage became clear, 100 mL of pre-cooled 4% paraformaldehyde (PFA) (4°C) was perfused. Immediately after PFA injection, the rats exhibited limb twitching and tail shaking, indicating successful perfusion. Perfusion continued until the rats were completely rigid. After perfusion, spinal cord tissue was isolated and extracted, with the sampling area 1 cm above and below the injury site. The extracted spinal cord tissue was immersed in 4% PFA for 48 hours, then embedded in paraffin, sectioned, and stained using hematoxylin-eosin (HE) and Laucker's Fast Blue (LFB).

[0235] Specifically, the hematoxylin-eosin (HE) staining procedure is as follows:

[0236] Paraffin sections were placed on stainless steel slides and baked in a 65°C oven for 8 hours. They were then sequentially immersed in xylene for 15 min, xylene for 15 min, anhydrous ethanol for 2 min, anhydrous ethanol for 2 min, 95% ethanol for 2 min, 85% ethanol for 2 min, 75% ethanol for 2 min, ddH2O for 2 min, and histochemical PBS for 3 min. This step was dewaxing to water. Following this, they were gently washed three times in ddH2O for 2 min each time. Hematoxylin staining was performed for 5 min, followed by rinsing the dye with running water. 1% hydrochloric acid-ethanol was added for 20 s, followed by washing with ddH2O for 2 min. 1% ammonia solution was used for blueing for 20 s, followed by microscopic observation and washing with ddH2O for 2 min. 0.5% eosin staining was performed for 2 min, followed by washing with ddH2O for 30 s. The sections were then dehydrated using the reverse dewaxing to water procedure, mounted with neutral resin, scanned using a slide scanner, and the observations were recorded.

[0237] Specifically, the Lauker Fast Blue (LFB) staining procedure is as follows:

[0238] (1) Place the paraffin sections on a stainless steel glass slide rack and bake them in an oven at 65°C for 8 hours. Then, soak them in xylene for 15 minutes, xylene for 15 minutes, anhydrous ethanol for 2 minutes, anhydrous ethanol for 2 minutes, 95% ethanol for 2 minutes, 85% ethanol for 2 minutes, 75% ethanol for 2 minutes, ddH2O for 2 minutes, and histochemical PBS for 3 minutes. This step is to dewax them to water.

[0239] (2) Soak the slices in 0.1% LFB solution and incubate in a 60℃ oven for 15 hours.

[0240] (3) The next day, take out the slices, soak them in 95% alcohol for 4 min, then wash them twice in double-distilled water for 3 min each time. Then, use 0.05% lithium carbonate aqueous solution for 15 s to separate the colors, and continue to separate the colors in 70% alcohol for 10 s. Repeat step 2 and this step until the boundary between gray matter and white matter is clear when observed under a microscope.

[0241] (4) Final dehydration: Dehydration is carried out in reverse order of the dewaxing to water step.

[0242] (5) Mounting and observation: Spin dry and mount the slide, then scan the slide using a slide scanner to obtain the staining results.

[0243] like Figure 18 As shown, HE staining results revealed that the Sham group exhibited intact and well-organized tissue structure; while the other six groups all showed round or irregular cavities of varying sizes at the site of spinal cord injury, surrounded by residual nerve tissue. Furthermore, the CAR-HNV@siRNA (PTEN+SOCS3) group demonstrated significantly better spinal cord structural integrity and improved structural disorder compared to the SCI group, and the CAR-HNV@siRNA (PTEN+SOCS3) group also exhibited the smallest cavity area.

[0244] Myelin is a membrane that surrounds the axon of a nerve cell. It is a multi-layered lipid bilayer structure formed by the plasma membrane of the nerve cell spirally winding along the axon. LFB can bind to the myelin sheath, thus staining it. The myelin sheath appears bright blue, which can reveal the morphology, structure, and pathological changes of the myelin sheath, allowing observation of its integrity, degree of necrosis, and repair status.

[0245] like Figure 18 As shown, LFB staining results indicate that the myelin sheath structure in the SCI group was severely damaged and lost. After CAR-HNV@siRNA (PTEN+SOCS3) treatment, the myelin sheath condition improved and the myelin sheath structure was more intact.

[0246] The above results indicate that CAR-HNV@siRNA (PTEN+SOCS3) can play a repair role and improve the pathological condition of the spinal cord after SCI (spinal cord injury).

[0247] Example 3: Biosafety assessment after fusion nanovesicle (CAR-HNV) therapy

[0248] 1. Liver and kidney function tests

[0249] Forty-two days after spinal cord injury surgery, serum was collected from rats in each group for liver and kidney function tests. Specifically, ALT (alanine aminotransferase) and AST (aspartate aminotransferase), which reflect hepatocellular parenchymal damage, and BUN (blood urea nitrogen) and CREA (creatinine), which reflect renal filtration function, were tested.

[0250] For rats, the normal range for ALT is 21.53–61.75 U / L; the normal range for AST is 41.47–195.65 U / L; the normal range for BUN is 9.75–22.71 mg / dL; and the normal range for CREA is 10.90–118.07 mmol / L.

[0251] like Figure 19 As shown, the test results for each group are all within the normal range.

[0252] 2. HE staining experiment on rat organs

[0253] Forty-two days after spinal cord injury surgery, major organs of rats in each group were harvested, sectioned, and stained with hematoxylin and eosin (HE) to assess the safety of the treatment. Figure 20 As shown, no obvious pathological changes were observed in any of the organs.

[0254] In summary, the novel nucleic acid drug delivery system provided in this application has good safety.

[0255] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit this application. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of this application. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in this invention should still be covered by the claims of this application.

Claims

1. A fused nanovesicle, formed by fusing small extracellular vesicles and lipid nanoparticles, wherein the small extracellular vesicles carry a targeting element, and the small extracellular vesicles and lipid nanoparticles are fused by a physical fusion method; The targeting element is an element that targets the VGlut2 protein on the surface of VSX2 subset neurons in the spinal cord; The targeting element is a chimeric antigen receptor; The lipid nanoparticles encapsulate a nucleic acid drug; the nucleic acid drug is a nucleic acid drug that specifically downregulates the expression of PTEN and SOCS3; the nucleic acid drug is siRNA; the sequence of the siRNA that specifically downregulates the expression of PTEN is shown in SEQ ID NO: 5~6; the sequence of the siRNA that specifically downregulates the expression of SOCS3 is shown in SEQ ID NO: 13~14.

2. The fused nanovesicles as described in claim 1, characterized in that, The fused nanovesicles have a core-shell structure and carry targeting elements on their surface.

3. The fused nanovesicles as described in claim 1, characterized in that, The physical fusion method is extrusion.

4. The fused nanovesicles as described in claim 1, characterized in that, The chimeric antigen receptor includes a single-chain antibody targeting VGlut2, the single-chain antibody including a heavy chain variable region and a light chain variable region; the nucleotide sequence of the heavy chain variable region of the single-chain antibody includes the sequence shown in SEQ ID NO.18, and the nucleotide sequence of the light chain variable region of the single-chain antibody includes the sequence shown in SEQ ID NO.

19.

5. The fused nanovesicles as described in claim 1, characterized in that, The chimeric antigen receptor includes a hinge region; the nucleotide sequence of the hinge region includes the sequence shown in SEQ ID NO.

20.

6. The fused nanovesicles as described in claim 1, characterized in that, The chimeric antigen receptor includes a transmembrane region; the nucleotide sequence of the transmembrane region includes the sequence shown in SEQ ID NO.

21.

7. The fused nanovesicles as described in claim 4, characterized in that, The nucleotide sequence of the single-chain antibody includes the sequence shown in SEQ ID NO.

17.

8. The fused nanovesicles as described in claim 1, characterized in that, The mass ratio of the small extracellular vesicles to lipid nanoparticles is 1:(1~5).

9. A pharmaceutical composition comprising the fused nanovesicles as described in any one of claims 1 to 8, and pharmaceutical excipients.

10. Use of the fused nanovesicles as described in any one of claims 1 to 8 or the pharmaceutical composition as described in claim 9 in the preparation of a medicament for treating spinal cord injury.

11. The method for preparing fused nanovesicles according to any one of claims 1 to 8, comprising the following steps: a) Preparation of lipid nanoparticles encapsulated with nucleic acid drugs; b) Prepare small extracellular vesicles carrying targeting elements; c) The small extracellular vesicles and lipid nanoparticles are fused by extrusion to obtain fused nanovesicles.

12. The preparation method according to claim 11, characterized in that, The preparation method includes one or more of the following features: A. In step a), the preparation method includes: adding a lipid organic phase to an aqueous phase containing a nucleic acid drug; the lipid organic phase contains Dlin-MC3-DMA, DOPE, DMG-PEG2000 and cholesterol; B. In step b), the preparation method includes: using lentivirus transduced cells containing a chimeric antigen receptor coding sequence to collect small extracellular vesicles secreted by the cells; C. In step c), the mass ratio of the small extracellular vesicles to lipid nanoparticles is 1:(1~5).

Images