Recombinant salmonella choleraesuis nuclease regulation vector as well as construction method and application thereof

Abstract

The invention discloses a recombinant salmonella choleraesuis nuclease regulation vector as well as a construction method and application thereof. After oral administration, the recombinant salmonella choleraesuis nuclease regulatory vector rSC0140 enters host immune cells, c-di-AMP is released, a host STING pathway is activated, and a broad-spectrum antiviral effect can be achieved; the recombinant strain rSC0140 is proved to be capable of activating STING pathways in macrophages and mice, causing antiviral states of the macrophages and the mice and resisting challenge of various influenza viruses; the recombinant strain has broad-spectrum antiviral efficacy and is suitable for preventing and treating various virus diseases clinically.

Description

Technical Field

[0001] This invention relates to a recombinant Salmonella choleraesuis nuclease regulatory vector, its construction method, and its application, belonging to the field of vector construction. Background Technology

[0002] STING (stimulator of interferon genes) is a very popular target in drug development. STING agonists are compounds that can bind to the STING protein and activate its downstream innate immune response. These compounds are usually two molecules of nucleotide or adenosine polymers, such as c-di-GMP and c-di-AMP. In recent years, STING agonists have been widely used in the field of anti-tumor therapy. Studies by Emily P et al. have shown that the human and mouse STING agonist ADU-S100 reduced the local and distant tumor burden in mice carrying pancreatic ductal adenocarcinoma (PDA). Although STING agonists have been extensively studied in tumor therapy, research and applications of STING agonists in the antiviral field are rare. Tina M. Sali et al. induced an antiviral state in human cells using the artificially synthesized STING agonist G10, enabling the cells to resist alphavirus attack. This study indicates that STING agonists have certain application and development potential in the field of anti-infection.

[0003] Currently, STING agonist administration relies on adjuvants or gene guns, which is related to the characteristics of the STING protein. STING protein is an intracellular protein; for STING agonists to exert their effects when administered in vitro, they must bind to the intracellular STING protein. This necessitates the use of adjuvants or gene guns to deliver the STING agonist into the cell, allowing for binding and inducing the subsequent drug response. Common methods for delivering STING agonists include cationic adjuvant encapsulation and gene gun injection. However, both methods have significant drawbacks. Cationic adjuvants are typically high-molecular-weight nanomaterials. These materials are difficult to metabolize and excrete in the body and exhibit cytotoxicity, increasing the risk of administration. Using cationic adjuvants to present STING agonists can damage cells. As for gene guns, gene gun injection technology is technologically advanced and costly. Combined with STING agonists, their widespread application is limited. Especially in the veterinary drug field, the high cost makes them almost unacceptable to the market. Furthermore, both cationic adjuvants and gene guns struggle to target innate immune cells. Most STING agonists are delivered to the injection or administration site, while STING proteins are primarily found in dendritic cells and macrophages—two types of innate immune cells. The aforementioned administration methods fail to target these cells, significantly reducing the efficacy of STING agonists. Therefore, developing a cost-effective and efficient new technology for delivering STING agonists is crucial for their application, especially in the veterinary field. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a recombinant Salmonella choleraesuis nuclease regulatory vector, its construction method and application, which can release CDA, activate the host STING pathway, and achieve a broad-spectrum antiviral effect.

[0005] Technical solution: To solve the above technical problems, the present invention provides a dacA gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] The present invention also provides an expression cassette, recombinant vector, recombinant cell or recombinant bacterium containing the dacA gene.

[0007] The nucleotide sequence of the expression cassette is shown in SEQ ID NO.2.

[0008] The present invention also provides a recombinant Salmonella choleraesuis nuclease regulatory vector containing the expression cassette.

[0009] The present invention also provides a method for constructing the recombinant Salmonella choleraesuis nuclease regulatory vector, wherein the expression cassette is introduced into the rSC0118 strain.

[0010] The specific preparation includes the following steps:

[0011] (1) The expression cassette gene fragment and plasmid were double-digested with enzymes, ligated, and then transformed into competent cells to form a recombinant suicide vector;

[0012] (2) Using the suicide vector described in step (1), the expression cassette was introduced into the Salmonella choleraesuis nuclease regulatory vector strain rSC0118 to construct the recombinant Salmonella choleraesuis nuclease regulatory vector.

[0013] The present invention also provides the use of the dacA gene, expression cassette, recombinant vector, recombinant cell, recombinant bacteria or recombinant Salmonella choleraesuis nuclease regulatory vector in the preparation of drugs for the synthesis and / or delivery of STING agonists.

[0014] The present invention also provides the application of the dacA gene, expression cassette, recombinant vector, recombinant cell, recombinant bacteria or recombinant Salmonella choleraesuis nuclease regulatory vector in the preparation of drugs that activate the STING pathway.

[0015] The present invention also provides the use of the dacA gene, expression cassette, recombinant vector, recombinant cell, recombinant bacteria or recombinant Salmonella choleraesuis nuclease regulatory vector in the preparation of drugs that induce cell expression and / or secretion of type I interferon.

[0016] The present invention also provides the use of the dacA gene, expression cassette, recombinant vector, recombinant cell, recombinant bacteria or recombinant Salmonella choleraesuis nuclease regulatory vector in the preparation of drugs for the prevention and / or treatment of viral infections.

[0017] The viruses mentioned include H1N1, H5N1 and H7N9 viruses.

[0018] STING proteins are primarily found in dendritic cells and macrophages, two types of innate immune cells, which are also the target cells of Salmonella. Therefore, using Salmonella to present STING agonists allows for targeted delivery of STING to these two types of innate immune cells, enabling the STING agonist to fully bind to the STING protein in these cells, thereby activating the downstream STING pathway and improving drug utilization. Normally, the active ingredients in recombinant bacterial vectors have difficulty crossing the bacterial cell wall to be released into host cells to exert their effects. However, the Salmonella choleraesuis nuclease regulatory vector used in this invention for delivering STING agonists possesses programmed lysis capabilities. This invention utilizes Salmonella's strong targeting and invasive ability towards immune cells, along with its programmed lysis function, to express STING agonists in Salmonella and release them into the host cytoplasm through lysis. There, they bind to the STING protein within the host cell, activating the STING pathway and inducing an antiviral innate immune response.

[0019] STING agonists have been extensively studied in the field of tumor therapy, but research and applications of STING agonists delivered via attenuated lysis by Salmonella in the antiviral field are rare. This invention utilizes a recombinant Salmonella choleraesuis nuclease-regulating vector to deliver STING agonists and evaluates the antiviral efficacy of this vector in porcine macrophages and mice.

[0020] Working principle of the invention ( Figure 1 In vitro culture of recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140, which delivers adenylate cyclase DacA, allows for the synthesis of adenylate cyclase DacA within the rSC0140 cells. Under the catalysis of DacA, intracellular ATP is converted into c-di-AMP. When Salmonella containing a large amount of c-di-AMP is administered to cells or mice, the Salmonella enters the host cell. Through gene regulation, the vector bacteria undergo programmed lysis, releasing c-di-AMP into the host cytoplasm. This c-di-AMP binds to the STING protein, activating the STING pathway. Activation of the STING pathway leads to the release of antiviral effector factors from the host cell. These effector factors kill viruses in the cell or environment, thus achieving an antiviral effect.

[0021] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. After oral administration, the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140 enters the host immune cells, releases c-di-AMP, and activates the host STING pathway to achieve a broad-spectrum antiviral effect; 2. The recombinant strain rSC0140 has been shown to activate the STING pathway in macrophages and mice, inducing an antiviral state in macrophages and mice, and resisting the challenge of various influenza viruses; 3. This recombinant strain has broad-spectrum antiviral efficacy and is suitable for the prevention and treatment of various viral diseases in clinical practice. Attached Figure Description

[0022] Figure 1 This is the working principle of the invention;

[0023] Figure 2 plasmid pRE112-ΔrecF:P lac dacA ACA- Double enzyme digestion identification diagram;

[0024] Figure 3 For ΔrecF:P lac dacA ACA Mutation pattern diagram;

[0025] Figure 4 PCR identification results for recombinant Salmonella choleraesuis rSC0118;

[0026] Figure 5 PCR identification results for the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140;

[0027] Figure 6 The concentration of CDA in the culture supernatant of rSC0118 and rSC0140; **: p < 0.01; ***: p < 0.001;

[0028] Figure 7 The concentration of CDA in the supernatant of 3D4 / 21 cells treated with rSC0118 and rSC0140 at different time points after infection; **: p < 0.01; ***: p < 0.001;

[0029] Figure 8 Westren Blot was used to detect the expression of STING protein induced by rSC0118 and rSC0140 in PK15 cells at different time points after infection.

[0030] Figure 9 To detect the concentration of type I interferon in the culture supernatant of PK15 cells treated with rSC0118 and rSC0140 at different time points after infection using ELISA; ***: p<0.001;

[0031] Figure 10 To detect the level of type I interferon secretion in mice infected with the corresponding strain using ELISA;

[0032] Figure 11 The viral titers of influenza virus in cells inoculated with different proportions of recombinant Salmonella rSC0118 and rSC0140 are as follows: A: viral titer of H1N1 virus; B: viral titer of H5N1 virus; C: viral titer of H7N9 virus. Detailed Implementation

[0033] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0034] Example 1: Construction and Identification of rSC0140

[0035] 1. Construction and identification of recombinant Salmonella choleraesuis nuclease-regulating vector strain rSC0118

[0036] To introduce the ΔmanA mutation into *Salmonella choleraesuis* rSC0117 (laboratory-preserved; public article: PMID:37867213; article title: Abacterial mRNA-lysis-mediated cargo release vaccine system for regulated cytosolic surveillance and optimized antigen delivery), a *rSC0118* deletion strain was constructed using suicide vector-mediated homologous recombination technology. rSC0117 was used as the recipient bacterium, and the suicide vector χ7213 (pYA3546) containing the pYA3546 suicide plasmid (a gift from Professor Roy Curtiss of the University of Florida; published article: PMID:20585446; title: Liverecombinant Salmonella Typhi vaccines constructed to investigate the role of rpoS in eliciting immunity to a heterologous antigen) was used as the donor bacterium. χ7213 was formed by transforming the pYA3546 plasmid into the χ7213 strain; χ7213 was a gift from Professor Roy Curtiss of the University of Florida; published article: PMID:20053874; title: Construction of recombinant attenuated Salmonellaenterica serovar Typhimurium vaccine vector strains for safety in newborn and infant mice) was used as the donor bacterium. The two bacterial strains were cultured to the logarithmic growth phase. 50 μL of each bacterial culture was added dropwise to LB agar medium containing diaminopimelic acid (DAP, 50 ng / mL) (hereinafter referred to as DAP agar medium). The LB agar medium (containing DAP) with the two bacterial cultures was incubated at 37°C for 12 h. Subsequently, bacterial growth was scraped from the LB agar medium (containing DAP) and streaked onto LB agar medium (hereinafter referred to as Tet agar medium) containing a final concentration of 25 μg / mL tetracycline, and incubated overnight at 37°C. On day 2, single colonies grown on Tet agar medium were picked and purified once. After the colonies grew, single colonies were picked and cultured in LB liquid medium until the logarithmic growth phase. The bacterial cultures were then subjected to 10... -4 Up to 10 -8The culture was serially diluted and spread onto LB agar medium containing 5% sucrose (hereinafter referred to as sucrose agar medium), and incubated at 26℃ for 2-3 days. Single colonies on the sucrose agar medium were picked and identified by PCR (upstream primer: SEQ ID NO.3: 5'-GGGGGTACCTTCGGCACGGAAACATGTTCGCT-3'; downstream primer: SEQ ID NO.4: 5'-GCTCGCCGCGCTGGTAGTTTTGATAACTTAA-3'; program: pre-denaturation 95℃ for 5 minutes, denaturation 95℃ for 30 seconds, annealing 55℃ for 30 seconds; extension 72℃ for 1 minute; system: 10 μL of Novizan Taq Master Mix enzyme (product number: P112-01); 1 μL each of upstream and downstream primers, 8 μL of water). The PCR results confirmed the colonies were correct. Figure 4 Positive strains were frozen at -70°C for later use. Experiments 1-5 were parallel experiments.

[0037] 2. pRE112-ΔrecF:P lac dacA ACA Construction and identification of plasmids

[0038] Using the complete genome sequence of Listeria monocytogenes NH1 strain (Genbank ID: 1358004970) as a template, the upstream and downstream homologous arms of the recF gene of Salmonella cholerae were amplified. Fusion PCR was used (program: pre-denaturation 95℃ for 5 min, denaturation 95℃ for 30 s, annealing 55℃ for 30 s; extension 72℃ for 2 min; system: 10 μL of Novizan Taq Master Mix enzyme (catalog number: P112-01); 1 μL each of upstream and downstream primers, 8 μL of water; primer sequences: upstream: SEQ ID NO. 5: ATGGACTTTTCCAATATGAGTAT, downstream: SEQ ID NO. 6: TCACTCGGA CTTACCTCCT) to amplify the dacA gene fragment (SEQ ID NO. 1).1: ATGGACTTTTCCAATATGAGTAT CCTTCACTATTTAGCGAATATTGTAGATATTTTGGTGGTTTGGTTCGTAATTTATAAGGTTATCATGCTTATCCGCGGCACGAAAGCCGTCCAGCTGTTGAAGGGGATTTTCATTATTATTGCCGTCAAGTTACTTAGCGGCTTCTTCGGATTGCAGACGGTGGAATGGATTACTGATCAAATGCTGACTTGGGGTTTCTTAGCCATTATCATTATCTTTCAACCGGAATTGCGTCGTGCCCTGGAGACTTTGGGGCGTGGCAATATCTTTACCCGCTATGGATCACGCATTGAGCGTGAGCAGCACCACCTTATTGAGTCTATTGAAAAGTCCACGCAATATATGGCGAAGCGTCGCATTGGAGCTTTGATCTCTGTGGCTCGTGATACCGGCATGGACGACTATATCGAGACTGGCATTCCGCTTAATGCGAAAATCTCATCGCAATTATTGATTAATATCTTCATCCCCAATACCCCTCTTCACGATGGCGCAGTGATCATTAAAGGTAACGAGATCGCGAGCGCTGCCAGTTATCTGCCATTGTCCGACTCGCCGTTTCTTTCTAAGGAGCTGGGAACTCGCCATCGTGCCGCATTAGGGATTTCCGAGGTGACCGATTCAATCACCATCGTTGTCAGCGAGGAAACGGGTGGGATTTCCCTTACGAAGGGAGGCGAACTGTTCCGTGATGTATCCGAAGAAGAATTGCATAAGATTTTGCTTAAAGAGCTGGTGACTGTCACGGCTAAAAAACCAAGCATTTTCTCCAAATGGAAAGGAGGTAAGTCCGAGTGA) was inserted into the homologous arms upstream and downstream of the recF gene to form ΔrecF:P. lac dacA ACA Expression cassette ( Figure 3lac dacA ACA The expression cassette gene fragment and pRE112 plasmid were simultaneously digested with Sac I and Kpn I (digestion system: 20 μL, including 10 μL plasmid, 1 μL each of Sac I and Kpn I, and 8 μL water). The digestion products were ligated with T4 ligase and transformed into χ7213 competent cells (a gift from Professor Roy Curtiss of the University of Florida; published article: PMID:20479086; article title: Immune responses to recombinant pneumococcal PsaAantigen delivered by alive attenuated Salmonella vaccine). Clones were selected and identified by double enzyme digestion and sequencing. The results of the double enzyme digestion identification are as follows: Figure 2 Among them, 1, 2, and 3 are three parallel experiments. Clones that were correctly identified by double enzyme digestion and sequencing are positive clones, named χ7213(pRE112-ΔrecF:P lac dacA ACA ).

[0039] 3. Construction and identification of recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140

[0040] Recombinant bacterial vector vaccines, due to their ability to induce mucosal immunity, humoral immunity, and cellular immunity, have been widely used as vectors for delivering protective antigens and nucleic acid vaccines to prevent certain infectious diseases. However, the protective antigens and nucleic acids recombinantly incorporated into bacterial vector vaccines are difficult to cross the bacterial cell wall and be released into the host cell to exert their effects. To address this challenge, this invention introduces ΔrecF:P into rSC0118, a Salmonella choleraesuis nuclease-regulating vector capable of programmed lysis and release of intracellular substances. lac dacA ACA- The expression box forms rSC0140.

[0041] To introduce ΔrecF:P into Salmonella choleraesuis rSC0118 lac dacA ACA- Expression cassettes were constructed using a suicide vector-mediated homologous recombination technique to create the rSC0140 deletion strain. rSC0118 was used as the recipient bacterium, and simultaneously, an expression cassette containing pRE112-ΔrecF:P was created. lac dacA ACA- Suicide vector χ7213(pRE112-ΔrecF:P) of suicide plasmid lac dacA ACA-The two bacterial strains were used as donor bacteria. The bacteria were cultured to the logarithmic growth phase, and 50 μL of each bacterial culture was added dropwise to LB agar medium containing diaminopimelic acid (DAP, 50 ng / mL) (hereinafter referred to as DAP agar medium). The LB agar medium (containing DAP) with the two bacterial cultures was incubated at 37°C for 12 h. Then, bacterial growth was scraped from the LB agar medium (containing DAP) and streaked onto LB agar medium containing chloramphenicol at a final concentration of 25 μg / mL (hereinafter referred to as Cm agar medium), and incubated overnight at 37°C. On day 2, single colonies grown on Cm agar medium were picked and purified once on Cm agar medium. After the colonies grew, single colonies were picked and cultured in LB liquid medium until the logarithmic growth phase. The bacterial cultures were then subjected to 10... -4 Up to 10 -8 The culture was serially diluted and spread onto LB agar medium containing 5% sucrose (hereinafter referred to as sucrose agar medium), and incubated at 26℃ for 2-3 days. Single colonies on the sucrose agar medium were picked and identified by PCR (upstream primer: SEQ ID NO.7: 5'-TTATAGGCGATGCTATTG-3'; downstream primer: SEQ ID NO.8: 5'-AAGCGCCGTTTTCGAGAG-3'; program: pre-denaturation 95℃ for 5 minutes, denaturation 95℃ for 30 seconds, annealing 55℃ for 30 seconds; extension 72℃ for 2 minutes; system: 10 μL of Novizan Taq MasterMix enzyme (product number: P112-01); 1 μL each of upstream and downstream primers, 8 μL of water). The PCR results confirmed the colonies were correct. Figure 5 Positive strains were frozen at -70°C for later use. Experiments 1-5 were parallel experiments.

[0042] Example 2: rSC0140 synthesizes c-di-AMP (CDA) in vitro and releases CDA into the extracellular space.

[0043] 1. rSC0140 synthesizes and releases the STING agonist CDA during growth in NB medium.

[0044] This embodiment evaluated the ability of the Salmonella choleraesuis nuclease regulatory vector rSC0140 to synthesize and release CDA in vitro using an in vitro passage experiment. rSC0118 and rSC0140 were retrieved from a -70°C freezer and streaked onto NB medium containing 0.2% arabinose for recovery. Single colonies were then picked and passaged separately in NB medium. For the first passage, 0.2% arabinose was added to the culture medium; subsequent passages did not add arabinose. CDA was extracted from the bacterial cells and culture supernatant using methanol. CDA was isolated and detected using liquid chromatography-mass spectrometry (LC-MS) on a Vanquish UHPLC / TSQ Altis LC-MS / MS 6500 system. The above samples were analyzed under the following conditions: chromatographic column: EC 150 / 2.0 NUCLEODUR C18 Pyramid (3 μm); mobile phase A: 0.2% formic acid-water solution; mobile phase B: acetonitrile; flow rate: 0.4 mL / min; column temperature: 35℃; injection volume: 5 μL. Under these mobile phase conditions, each sample was analyzed within 8 min. The mass spectrometry ion source was an electrospray ionization (ESI) source, the detection mode was multiple reaction monitoring (MRM), and the ionization mode was positive ion scanning. Ion source parameters: curtain gas 20 psi, spray voltage 5500 V, nebulization temperature 550℃, nebulizer gas 65 psi, auxiliary gas 65 psi, declustering voltage 90 V, intake voltage 7 V; quantitative ion pair: parent ion / daughter ion 675 / 524; qualitative ion pair: parent ion / daughter ion 675 / 506 or 675 / 136. The analysis was performed using an ACQUITY UPLC I-Class Plus chromatography-mass spectrometry system. The concentration of CDA was calculated using a 1 / X weighted linear 7-point standard curve (0.01–1000 ng / mL).

[0045] The results are as follows Figure 6 As shown, the recombinant Salmonella choleraesuis nuclease-regulating vector rSC0140 synthesized CDA at a significantly higher level than the conventional vector rSC0118. Furthermore, with increasing passage number and decreasing arabinose concentration in the culture environment, the CDA concentration detected in the culture supernatant of rSC0140 increased accordingly. These results indicate that as the concentration of arabinose in the environment decreases, rSC0140 gradually undergoes programmed cleavage, actively releasing CDA from the cytoplasm. This mechanism of CDA release through cleavage allows intracellular CDA to overcome the cell wall barrier and be released extracellularly.

[0046] 2. rSC0140 synthesizes and releases c-di-AMP in porcine lung macrophage cell line 3D4 / 21.

[0047] Frozen rSC0118 and rSC0140 were retrieved from the freezer at -70°C and streaked onto LB medium containing 0.2% arabinose for revival. Single colonies were then picked and incubated overnight at 37°C in LB medium containing 0.2% arabinose. The overnight cultures were inoculated 1:100 into LB liquid medium containing 0.2% arabinose and cultured until OD500 was reached. 600 Bacterial cells were collected by centrifugation at 0.85°C for infecting 3D4 / 21 cells (a gift from Professor Zhu Jianzhong of Yangzhou University; Publication: PMID:32922386; Title: Porcine IFI16 Negatively Regulates cGAS Signaling Through the Restriction of DNA Binding and Stimulation). Cell infection experiments were performed using 1 MOI rSC0118 and 1 MOI rSC0140 wells and PBS control wells, respectively. At 1 h, 6 h, 12 h, and 24 h after infection, digitalis saponins were used to permeate the cell membrane, and CDA was extracted from the cell culture supernatant with methanol (after adding an equal volume of methanol, shaking to mix, centrifuging at 12000 rpm for 10 minutes, and collecting the supernatant). The extract was separated and detected on a Vanquish UHPLC / TSQ Altis LC-MS / MS 6500 system (detection conditions as above). The detection results are as follows. Figure 7 As shown, the CDA concentration in the cell culture supernatant of the rSC0140-treated group was significantly higher than that of the rSC0118-treated group. Furthermore, the CDA concentration in the cell culture supernatant of the rSC0140-infected group increased with increasing infection time. In contrast, CDA was undetectable in the cell culture supernatant of the rSC0118-treated group and the PBS control group. This indicates that rSC0140 infection of 3D4 / 21 cells can synthesize a large amount of CDA and release it into the host cell cytoplasm. This release mechanism significantly increases CDA expression and ensures its efficient binding to STING protein in the cytoplasm, thereby activating the STING pathway.

[0048] Example 3: rSC0140 activates the STING pathway in PK15 cells

[0049] 1. rSC0140 upregulates STING expression in PK15 cells.

[0050] CDA can activate the STING pathway and upregulate the expression of STING protein. Since Salmonella infection of cells may upregulate cGAS expression and activate the subsequent STING pathway, this study aimed to demonstrate that the STING pathway activation was driven by CDA catalyzed by DacA expressed by rSC0140, rather than by cGAS. In this embodiment, cGAS was knocked down in porcine PK15 cells via lentiviral infection to investigate the characteristics of rSC0140 in activating the STING pathway. The cGAS-knocked PK15 cells (a gift from Professor Jianzhong Zhu of Yangzhou University; published article: PMID:32922386; article title: Porcine IFI16 Negatively Regulates cGAS Signaling Through the Restriction of DNA Binding and Stimulation) were seeded in 24-well plates, 2.5 × 10⁶ cells per well. 6 One cell. After the cells adhered tightly to the wall, the culture was shaken to OD200 using the method described in Example 2. 600 Bacterial cells were collected by centrifugation at 0.85 °C. Cell infection experiments were performed using 1 MOI of recombinant Salmonella choleraesuis rSC0118 and rSC0140. Cell suspensions were collected at 1 h, 6 h, 12 h, and 24 h after infection, and total cellular protein was extracted. Anti-cGAS polyclonal antibody (manufacturer: Proteintech; catalog number: 26416-1-AP; dilution: 1:5000, volume: 1 mL) and Anti-pSTING monoclonal antibody (manufacturer: Cell Signaling Technology; catalog number: 50907; dilution: 1:1000, volume: 2 mL) were used as primary antibodies, and HRP-labeled goat anti-mouse antibody (manufacturer: Sigma; catalog number: 12-349; dilution: 1:1000, volume: 2 mL) was used as secondary antibodies. Westren's blot experiments were then performed, and the concentrations of cGAS and pSTING proteins were analyzed using ImageJ. Higher protein concentrations indicated stronger signaling activity. Results are as follows: Figure 8As shown, compared to rSC0118, infection with rSC0140 significantly upregulated STING protein expression in porcine PK15 cells, with peak expression reaching its peak at 12 hours. At this point, the upregulation of STING protein expression by rSC0140 was 12.5 times that of the rSC0118 group (actin was used as an internal reference to correct for the loading amount). This indicates that as rSC0140 gradually synthesizes and releases CDA in PK15 cells, the STING pathway is gradually activated. Moreover, compared to non-nuclease-regulated vectors, the recombinant Salmonella choleraesuis nuclease-regulated vector rSC0140 significantly activates the STING pathway. Combined with the previous research, this confirms that rSC0118 can actively and programmedly cleave in host cells, simultaneously synthesizing and releasing large amounts of CDA from its own cytoplasm. When CDA is released into host cells, it binds fully to STING in the host cell cytoplasm, significantly upregulating STING expression and activating the STING pathway.

[0051] 2. rSC0140 upregulates the expression and secretion of type I interferon in cGAS knockout PK15 cells.

[0052] Type I interferon is a major effector of antiviral innate immunity and has been proven to inhibit infection by various viruses. Therefore, type I interferon is widely used clinically for antiviral therapy.

[0053] Cell infection experiments were conducted using recombinant Salmonella choleraesuis following the above method. Recombinant Salmonella nuclease regulatory vectors rSC0118 and rSC0140 were used to infect cGAS-knockout porcine PK15 cells. Cell culture supernatants were collected at 1 h, 6 h, 12 h, and 24 h after infection, and the secretion characteristics of type I interferon IFN-β in the culture supernatant were detected using indirect ELISA. The results showed that at 6 h, 12 h, and 24 h post-infection, the concentration of type I interferon in the cell supernatant of the rSC0140-infected group was significantly higher than that of the rSC0118-infected group, approximately 3.6, 4.1, and 3.7 times higher, respectively. These results indicate that (…). Figure 9 Compared to rSC0118, rSC0140 has a significantly enhanced ability to activate the STING pathway, inducing the expression and secretion of large amounts of type I interferon. This is because rSC0140 synthesizes and releases large amounts of CDA in cells, thereby inducing cells to secrete high levels of type I interferon.

[0054] Example 4: rSC0140 induces type I interferon expression and secretion in Balb / C mice.

[0055] Previous studies (article title: A bacterial mRNA-lysis-mediated cargo releasevaccine system for regulated cytosolic surveillance and optimized antigen delivery; authors: Yuan Li and Huoying Shi) have shown that the Salmonella choleraesuis nuclease regulatory vector rSC0118 can colonize mouse lymphoid tissues and spread to deep lymphoid tissues. This is beneficial for the synthesis of large amounts of exogenous antigens or exogenous effectors carried by the nuclease regulatory vector and for fully activating host lymphocytes, inducing a superior immune response. Therefore, this embodiment uses Balb / C mice as an animal model to further investigate the ability of the recombinant Salmonella nuclease regulatory vector rSC0140 to induce type I interferon expression and secretion in vivo.

[0056] Thirty Babl / C mice (purchased from the Experimental Animal Center of Yangzhou University) were randomly divided into three groups. Each mouse in each group was orally administered 1.2 × 10⁻⁶ ppm. 9 Live bacterial suspensions of CFU rSC0118 and rSC0140 were administered, with a control group receiving oral PBS. Serum was collected from mice in each group 24 hours after oral administration of the bacterial suspension, and the concentration of IFN-β in the serum was detected using an indirect ELISA method. The results showed ( Figure 10 The concentrations of type I interferon in the liver, spleen, intestine, and serum of mice orally administered rSC0140 were significantly higher than those in mice orally administered rSC0118, being 6.5 times, 4.7 times, 5.2 times, and 8.7 times higher, respectively. Oral administration of the lysed empty vector control rSC0118 also induced the production of small amounts of type I interferon in the liver, spleen, and intestine, which were secreted into the serum. This may be because the DNA released by the nuclease-regulated vector itself can also activate type I interferon expression in trace amounts via a cGAS-dependent mechanism. Type I interferon was undetectable within the sensitivity range in the liver, spleen, intestine (Paisley's section), and serum of mice orally administered PBS (kit sensitivity range: 20 pg / mL - 5000 pg / mL). These results indicate that rSC0140, after fully activating the STING pathway, induces a large amount of type I interferon expression and secretion. This may be because rSC0140 synthesizes and releases large amounts of CDA after colonization in mice, thereby inducing the secretion of high levels of type I interferon.

[0057] Example 5: rSC0140 in cellular resistance to influenza virus infection

[0058] Recombinant Salmonella choleraesuis was prepared for cell infection experiments according to the method in Part 2 of Example 2, with experimental groups infected with rSC0118 and rSC0140 respectively. After digestion, 3D4 / 21 cells were seeded into 24-well plates at 2.5 × 10⁶ cells per well. 6 Cells were cultured overnight at 37°C in a 5% CO2 incubator. Bacterial infection experiments were performed the following day. Before infection, cells were washed 2-3 times with PBS, and each well was refilled with blood-free, antibiotic-free DMEM. Cell infection experiments were performed using 0 MOI, 0.01 MOI, 0.1 MOI, 0.5 MOI, 1 MOI rSC0118, and rSC0140, respectively. After 30 min of infection, the above growth medium was removed, and 1.5 mL of growth medium containing 100 μg / mL of double antibiotics (gentamicin and amphotericin B mixed at a 1:1 concentration) was added to each well. The cells were then quickly returned to the incubator for further culture. 24 h after Salmonella infection, each group of cells was inoculated with 1 MOI of H1N1 virus (TCID50 = 10). 8.5 / mL), 1 MOL H5N1 virus (TCID50 = 10 7.3 / mL) or 1 MOl H7N9 virus (TCID50 = 10 6.5 Cells and cell supernatant were collected after 24 hours ( / mL), and the mixture was subjected to three freeze-thaw cycles before being filtered through a 0.45 μm filter to collect the virus. The collected virus was then inoculated into MDCK cells at a dose of 1 MOI for TCID50 detection. Results are as follows: Figure 11 As shown: When the inoculation dose was 0.1 MOI, 0.5 MOI, and 1 MOI, the viral titer of H1N1 in the rSC0140 inoculation group was significantly lower than that in the rSC0118 inoculation group. When the inoculation dose was 0.5 MOI and 1 MOI, the viral titer of H5N1 in the rSC0140 inoculation group was significantly lower than that in the rSC0118 inoculation group. When the inoculation dose was 0.5 MOI and 1 MOI, the viral titer of H7N9 in the rSC0140 inoculation group was significantly lower than that in the rSC0118 inoculation group. When the inoculation dose was 0.01 MOI, rSC0118 showed a slight inhibitory effect on H1N1, H5N1, and H7N9, with no significant decrease in viral titer. Notably, as the inoculation concentration of rSC0140 gradually increased, the viral titers of H1N1, H5N1, and H7N9 gradually decreased. This suggests that the inhibitory effect of rSC0140 on the virus is positively correlated with the inoculation dose.

[0059] Example 6: rSC0140's resistance to influenza virus infection in Balb / C mice

[0060] To evaluate the antiviral efficacy of rSC0140 in animals, this study used Balb / C mice as an animal model for protective experiments. The following experimental groups were established: oral administration of rSC0118 and rSC0140 recombinant nuclease regulatory vector, and an oral administration of PBS control group. The antiviral efficacy of the administered strains in each group was evaluated.

[0061] Bacterial suspensions of rSC0118 and rSC0140 were prepared according to the method described in Example 2. Thirty Balb / C mice were randomly divided into three groups, and each mouse in each group was orally administered 1.2 × 10⁻⁶ ppm. 9 The above-mentioned bacterial suspensions of CFU were used, and a control group was prepared by oral administration of PBS. Twenty-four hours after oral administration of the bacterial suspensions, mice were challenged by intraperitoneal injection of 100 μL of H1N1, H5N1, and H7N9 influenza viruses (100×TCID50).

[0062] Forty-eight hours after intraperitoneal injection of the virus, mice orally administered PBS and rSC0118 showed obvious clinical symptoms of H1N1 infection: rickets, tremors, agitation, and hyperactivity, and all died within 72 hours, with a protective efficacy of 0%. In contrast, mice orally administered rSC0140 did not show obvious clinical symptoms and did not die during the 30-day observation period, with a protective efficacy of 100% (Table 1).

[0063] Table 1. Survival status of mice after influenza virus challenge.

[0064]

[0065] These results indicate that oral administration of rSC0140 to mice can alleviate or eliminate clinical lesions caused by influenza virus and protect mice from lethal doses of influenza virus.

[0066] In summary, this invention constructs a recombinant expression cassette ΔrecF:P carrying adenylate cyclase. lac dacA ACA-The expression cassette was introduced into the Salmonella choleraesuis nuclease regulatory vector rSC0118 to form the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140. When DacA is expressed in the Salmonella choleraesuis nuclease regulatory vector, it catalyzes the formation of CDA from ATP. After oral administration of rSC0140, the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140 enters the host lymphoid tissue, synthesizes and releases CDA. The released CDA interacts with the STING protein in the host cells, thereby activating the STING pathway and inducing cells or mice to secrete high levels of type I interferon to resist the attack of H1N1, H5N1 and H7N9 influenza viruses. This recombinant strain has broad-spectrum antiviral efficacy and is suitable for the clinical prevention and treatment of H1N1, H5N1 and H7N9, reducing the harm of influenza viruses to human and animal health.

Claims

1. A dacA gene, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. An expression cassette, recombinant vector, recombinant cell, or recombinant bacterium, characterized in that, It contains the dacA gene as described in claim 1.

3. The expression box according to claim 2, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

2.

4. A recombinant Salmonella choleraesuis nuclease regulatory vector, characterized in that, It contains the expression box as described in claim 2 or 3.

5. A method for constructing the recombinant Salmonella choleraesuis nuclease regulatory vector as described in claim 4, characterized in that, The expression cassette of claim 2 or 3 is introduced into the rSC0118 strain.

6. The construction method according to claim 5, characterized in that, Includes the following steps: (1) The gene fragment of the expression cassette described in claim 2 or 3 is double-digested with a plasmid, ligated, and then transformed into competent cells to form a recombinant suicide vector; (2) Using the suicide vector described in step (1), the expression cassette was introduced into strain rSC0118 to construct a recombinant Salmonella choleraesuis nuclease regulatory vector.

7. The use of the dacA gene of claim 1, the expression cassette of claim 2, the recombinant vector, the recombinant cell or recombinant bacterium, or the recombinant Salmonella choleraesuis nuclease regulatory vector of claim 4 in the preparation of a drug for the synthesis and / or delivery of a STING agonist.

8. The use of the dacA gene of claim 1, the expression cassette of claim 2, the recombinant vector, the recombinant cell or recombinant bacterium, or the recombinant Salmonella choleraesuis nuclease regulatory vector rSC0140 of claim 4 in the preparation of drugs that activate the STING pathway.

9. The use of the dacA gene of claim 1, the expression cassette of claim 2, the recombinant vector, the recombinant cell or recombinant bacterium, or the recombinant Salmonella choleraesuis nuclease regulatory vector of claim 4 in the preparation of a drug that induces cell expression and / or secretion of type I interferon.

10. The use of the dacA gene of claim 1, the expression cassette of claim 2, the recombinant vector, the recombinant cell or recombinant bacterium, or the recombinant Salmonella choleraesuis nuclease regulatory vector of claim 4 in the preparation of drugs for the prevention and / or treatment of viral infections, characterized in that, The viruses mentioned include H1N1, H5N1, or H7N9 viruses.

Images