Lentivirus targeted delivery GSDMD N-terminal protein system based on CRISPR-Tet-On double-control system as well as preparation method and application of lentivirus targeted delivery GSDMD N-terminal protein system

Abstract

The invention provides a lentivirus targeted delivery GSDMD N-terminal protein system based on a CRISPR-Tet-On double-control system and a preparation method and application thereof, and belongs to the technical field of genetic engineering and tumor targeted therapy. In the lentivirus targeted delivery system, the CRISPR / AAVS1 system is responsible for safe and fixed-point integration of an inducible expression cassette to a'safe port 'site of a genome, and the Tet-On system is responsible for precise control of the inducible expression opportunity and level of GSDMD-NT after integration so as to avoid packaging and production cell toxicity; the lentivirus targeted delivery system can solve the problems of difficult delivery, high cytotoxicity, insufficient targeting specificity and the like in a traditional delivery method, and has good application in targeted delivery of GSDMD-NT protein and preparation of tumor immunotherapy drugs, inflammatory disease intervention preparations or pyroptosis research tools.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and tumor targeted therapy technology, specifically relating to a lentiviral targeted delivery system for GSDMD N-terminal protein based on a CRISPR-Tet-On dual-control system and its application. Background Technology

[0002] Pyroptosis is a programmed cell death process characterized by continuous cell swelling, cell membrane rupture, and the release of large amounts of pro-inflammatory factors, exhibiting dual potential in clearing tumor cells and activating the immune response. Gasdermin D (GSDMD) protein is one of the key executors of the pyroptosis process. Under normal physiological conditions, GSDMD is widely expressed in various tissue cells as a full-length precursor protein, maintaining an inactive state through intramolecular self-inhibitory structures. When cells encounter external stimuli, caspase-1 / 4 / 11 specifically cleaves GSDMD, releasing the N-terminal domain (GSDMD-NT) with membrane-perforating activity, triggering an inflammatory cascade and inducing cell swelling and rupture. This process plays an important role in clearing tumor cells, activating the immune response, and resisting pathogen infection. Therefore, targeted delivery of GSDMD-NT is of great significance for research on infectious diseases and tumor immunotherapy.

[0003] The pore-forming activity of GSDMD-NT can easily disrupt cell membrane integrity during delivery. Traditional lentiviral delivery systems have a high risk of random integration, which further increases the risk of genomic mutations. Furthermore, the pore-forming activity of GSDMD-NT itself can damage cells during delivery, making effective delivery difficult with traditional methods. Therefore, developing an efficient, low-toxicity, and controllable GSDMD-NT delivery system has significant scientific and clinical application value. Summary of the Invention

[0004] To address some shortcomings in existing technologies, this invention provides a lentiviral targeted delivery system for GSDMD N-terminal protein based on a CRISPR-Tet-On dual-control system, along with its preparation method and applications. This invention constructs a lentiviral targeted delivery system based on a CRISPR-Tet-On dual-control system. In this system, the CRISPR / AAVS1 system is responsible for safely and site-specifically integrating the inducible expression cassette into a genomic "safe harbor" site, while the Tet-On system is responsible for precisely controlling the timing and level of GSDMD-NT induction expression after integration, avoiding cytotoxicity during packaging and production. The lentiviral targeted delivery system also contains the pMD2.G-Claudin18.2-scFv plasmid, which enables targeted delivery to gastric cancer cells. This lentiviral targeted delivery system solves the problems of difficult delivery, high cytotoxicity, and insufficient targeting specificity in traditional delivery methods, and has excellent applications in targeted delivery of GSDMD-NT protein, as well as in the preparation of tumor immunotherapy drugs, inflammatory disease intervention agents, or pyroptosis research tools.

[0005] To achieve the above-mentioned technical objectives, the present invention employs the following technical means:

[0006] This invention first provides a lentivirus targeted delivery system based on a CRISPR-Tet-On dual-control system, the lentivirus targeted delivery system comprising:

[0007] (1) An expression plasmid containing the GSDMD-NT gene regulated by the TRE3G promoter and the mCherry reporter gene; and

[0008] (2) A CRISPR integration plasmid encoding the Cas9 nuclease and gRNA targeting the AAVS1 site; and

[0009] (3) Packaging plasmids for encoding the Gag and Pol fusion protein; and

[0010] (4) Targeted modification plasmids containing the anti-Claudin18.2 single-chain antibody (scFv) gene and the VSV-G mutant gene (K47A, R350A).

[0011] Preferably, the lentivirus targeted delivery system includes:

[0012] (1) The expression plasmid pLVX-TetOne-GSDMD-NT-mCherry plasmid containing the GSDMD-NT gene regulated by the TRE3G promoter and the mCherry reporter gene, the construction steps of which include:

[0013] The pLVX-TetOne backbone vector obtained by linearizing pLVX-TetOne-Puro-p21 was recombined with the GSDMD-NT gene fragment to obtain pLVX-TetOne-GSDMD-NT;

[0014] Using the mCherry gene fragment as a template, the mCherry fragment was amplified by PCR; pLVX-TetOne-GSDMD-NT was linearized and then recombinated and ligated with the mCherry fragment to obtain the pLVX-TetOne-GSDMD-NT-mCherry plasmid.

[0015] The nucleotides of the GSDMD-NT gene fragment are shown in SEQ ID NO:1;

[0016] The nucleotides of the mCherry gene fragment are shown in SEQ ID NO:2;

[0017] (2) The packaging plasmid psPAX2-AAVS1-gRNA-Gag-Pol, used to encode the Gag and Pol fusion protein, is constructed using the following methods:

[0018] The coding sequence containing AAVS1-gRNA was amplified by PCR to obtain the AAVS1-gRNA fragment, which was then ligated to the linearized psPAX2 backbone vector to obtain the psPAX2-AAVS1-gRNA-Gag-Pol plasmid.

[0019] The nucleotides encoding the AAVS1-gRNA are shown in SEQ ID NO:4;

[0020] (3) The CRISPR integration plasmid psPAX2-AAVS1-gRNA-Gag-SpCas9, which encodes the Cas9 nuclease and the gRNA targeting the AAVS1 site, was constructed using the following methods:

[0021] Using the coding sequence containing SpCas9 as a template, the SpCas9 fragment was amplified by PCR; the plasmid psPAX2-AAVS1-gRNA-Gag-Pol was linearized and then recombinated with the SpCas9 fragment to obtain the psPAX2-AAVS1-gRNA-Gag-SpCas9 plasmid;

[0022] The nucleotides containing the SpCas9 coding sequence are shown in SEQ ID NO:3;

[0023] (4) The targeted modification plasmid pMD2.G-Claudin18.2-scFv, containing the anti-Claudin18.2 single-chain antibody gene and the VSV-G mutant gene (K47A, R350A), is constructed using the following methods:

[0024] The coding sequence of anti-Claudin18.2 scFv-VSVG (K47A, R350A) was amplified by PCR to obtain the scFv-VSVG fragment; the scFv-VSVG fragment was recombinated and ligated with the linearized envelope plasmid pMD2.G to obtain pMD2.G-Claudin18.2-scFv;

[0025] The nucleotides encoding the anti-Claudin18.2 scFv-VSVG(K47A,R350A) sequence are shown in SEQ ID NO:5.

[0026] Preferably, in the lentivirus targeted delivery system, the mass ratio of expression plasmid, CRISPR integration plasmid, packaging plasmid and targeting modification plasmid is 4.4-5:1.2-3.4:1.6-3.6:0.4-1.2.

[0027] Preferably, the mass ratio of the expression plasmid, CRISPR integration plasmid, packaging plasmid, and targeting modification plasmid is 4.4:1.2:3.6:0.4.

[0028] This invention also provides a method for preparing the above-mentioned lentivirus targeted delivery system based on the CRISPR-Tet-On dual-control system, the method comprising:

[0029] The cell line was seeded into a culture dish. When the cell confluence reached 60-80%, expression plasmids, CRISPR integration plasmids, packaging plasmids, and targeting modification plasmids were transfected into the cell line. After 4 hours of transfection, the medium was changed. After another 48 hours of transfection, the supernatant was collected, filtered, and concentrated to obtain lentivirus concentrate, which is the lentivirus targeted delivery system described in this invention.

[0030] Preferably, the cell line includes the HEK293T (human embryonic kidney cell) cell line, with a seeding density of 3 × 10⁻⁶ cells / year. 6 1 cell / 10cm culture dish

[0031] Preferably, the lentivirus targeted delivery system of the present invention has an MOI of 200 when transducing the virus into target cells, and the target cells are Claudin18.2 positive cells.

[0032] This invention also provides the application of the above-mentioned lentiviral targeted delivery system based on the CRISPR-Tet-On dual control system in the preparation of drugs that target and deliver GSDMD-NT protein.

[0033] Preferably, the drug comprises the aforementioned lentiviral targeted delivery system based on the CRISPR-Tet-On dual-control system and doxycycline, wherein doxycycline induces the expression of the N-terminal protein of GSDMD.

[0034] Preferably, the final concentration range of the doxycycline is 0.1-2 μg / mL, and more preferably 1 μg / mL.

[0035] This invention also provides the application of the above-mentioned lentiviral targeted delivery system based on the CRISPR-Tet-On dual-control system in the preparation of tumor immunotherapy drugs, inflammatory disease intervention agents, or pyroptosis research tools.

[0036] Preferably, the tumor includes Claudin18.2 positive cancers, such as gastric cancer, pancreatic cancer, esophageal cancer, ovarian cancer, and lung cancer;

[0037] The inflammatory diseases mentioned include those caused by cells that abnormally express the Claudin18.2 protein.

[0038] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0039] The lentiviral targeted delivery system based on the CRISPR-Tet-On dual-control system described in this invention comprises an expression plasmid for the GSDMD-NT gene and mCherry reporter gene regulated by the TRE3G promoter, a CRISPR integration plasmid encoding the Cas9 nuclease and gRNA targeting the AAVS1 site, a packaging plasmid encoding the Gag and Pol fusion protein, and a targeting modification plasmid containing the anti-Claudin18.2 single-chain antibody (scFv) gene and the VSV-G mutant gene (K47A, R350A). The expression plasmid containing the GSDMD-NT gene and mCherry reporter gene regulated by the TRE3G promoter is responsible for expressing the target protein and the mCherry gene. The TRE3G promoter is regulated by tetracycline (or doxycycline, Dox). In the absence of Dox, gene expression is strictly inhibited; with the addition of Dox, the gene is strongly activated. This achieves "spatiotemporal controllability" of the target protein expression, allowing treatment to be initiated at any time by drug administration, avoiding potential toxic side effects caused by the expression of the target gene at unexpected times or locations. GSDMD-NT is the N-terminal domain of the gasdermin D protein and is one of the key executors of pyroptosis. After being expressed intracellularly, it can create pores in the cell membrane, leading to severe inflammatory cell death (pyroptosis). This death method can effectively kill tumor cells and activate a strong anti-tumor immune response. mCherry is a red fluorescent protein gene. Its tandem expression with the target gene (GSDMD-NT) can conveniently track viral infection efficiency and the expression of the target gene. Through fluorescence microscopy or flow cytometry, it is easy to distinguish which cells have been successfully transduced and quantify the expression level, which greatly facilitates experimental monitoring and effect evaluation. In CRISPR integrative plasmids encoding the Cas9 nuclease and gRNA targeting the AAVS1 site, integrating exogenous genes into AAVS1 avoids the risks of oncogene activation or tumor suppressor gene inactivation caused by random insertion. Simultaneously, this site allows for long-term, stable, and high-level expression of the exogenous gene, ensuring therapeutic durability. The CRISPR / Cas9 system guides gRNA to specific sites in the genome for cleavage, significantly improving the efficiency and precision of target gene integration into the AAVS1 site. Packaging plasmids encoding the Gag and Pol fusion proteins are essential for producing infectious lentiviral particles, providing the tools for viral replication and packaging. Gag proteins constitute the viral capsid and matrix, while Pol proteins contain enzymes required for replication, such as reverse transcriptase and integrase.The targeted modification plasmid contains the anti-Claudin18.2 single-chain antibody (scFv) gene and the VSV-G mutant gene (K47A, R350A), which enables lentiviral particles to specifically recognize and infect Claudin18.2-expressing positive cells, thereby avoiding off-target effects on normal cells and significantly improving the safety of treatment.

[0040] This invention utilizes the Tet-On induction system to achieve spatiotemporally specific expression of GSDMD-NT, avoiding cell damage caused by partial GSDMD-NT expression during the packaging stage, and enabling safe and controllable targeted delivery of GSDMD-NT. Furthermore, this invention achieves visual tracking by co-expressing GSDMD-NT with mCherry and monitoring viral packaging and infection efficiency in real time using fluorescence signals. In addition, the envelope protein containing the Claudin18.2-scFv modification in this invention enables targeted delivery of lentiviruses to HEK-293T-Claudin18.2 cells, and achieves site-specific integration of the GSDMD-NT gene at the AAVS1 site via CRISPR-mediated integration, reducing the risk of random mutations.

[0041] This invention achieves stable inheritance of therapeutic genes through CRISPR-mediated integration at the AAVS1 site, utilizes the Tet-On system to control the induced expression of GSDMD-NT protein, modifies the envelope protein gene, and adds Claudin18.2-scFv modification to achieve targeted delivery to gastric cancer. qPCR confirmed that GSDMD-NT expression increased 17.57-fold after doxy induction (p<0.0001), and pyroptosis was observed after 48 hours of induction.

[0042] This invention employs a CRISPR-Tet-On dual-control lentiviral targeted delivery system to deliver the N-terminal protein of GSDMD into the HEK-293T-Claudin18.2 cell line, and utilizes doxycycline to achieve controllable expression of GSDMD-NT. This provides preliminary validation of the pyroptosis function of the GSDMD N-terminal protein, offering a new avenue for research on pyroptosis-related diseases. This patent is applicable to research on pyroptosis mechanisms, development of tumor immunotherapy, treatment strategies for inflammatory diseases such as sepsis, and the construction of in vitro models of related diseases. Attached Figure Description

[0043] Figure 1 Maps of lentiviral vector plasmids pLVX-TetOne-GSDMD-NT-mCherry (A), psPAX2-AAVS1-gRNA-Gag-SpCas9 (B), psPAX2-AAVS1-gRNA-Gag-Pol (C) and pMD2.G-Claudin18.2-scFv (D).

[0044] Figure 2 The image shows the red fluorescence expression in HEK293T cells 48 hours after lentivirus packaging; in the figure, A is the cell state and B is the fluorescence signal.

[0045] Figure 3 For lentivirus titer determination; in the figure, A is the standard curve of lentivirus titer; B is the bar chart of lentivirus titer determination.

[0046] Figure 4 The images show the red fluorescence expression of cells 72 hours after lentiviral targeted infection. In the figure, A is the fluorescence image of HEK-293T-Claudin18.2 infection; B is the fluorescence image of HEK-293T infection. The left images are cell status images, and the right images are fluorescence signal images.

[0047] Figure 5 The image shows pyroptosis in HEK-293T-Claudin18.2 cells after 48 hours of doxycycline induction; A in the image represents uninduced cells, and B represents induced cells.

[0048] Figure 6 The relative expression level of GSDMD-NT was detected by qPCR. In the figure, A represents the expression of GSDMD-NT in HEK-293T cells and HEK-293T-Claudin18.2 cells before and after induction; B represents the expression of GSDMD-NT in HEK-293T-Claudin18.2 cells at different doxy concentrations. Detailed Implementation

[0049] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto. The following embodiments are for a clear and complete description of the technical solutions of the present invention. Obviously, the described embodiments are some embodiments of the present invention, but not all embodiments. Based on the described embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0050] Unless otherwise defined, the technical or scientific terms used herein shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0051] In the following embodiments, the cells used include:

[0052] HEK-293T (human embryonic kidney cells), purchased from Pronosei (CL-0005).

[0053] The reagents used include:

[0054] jetPRIME Transfection Reagent: Purchased from Polyplus, France, item number 101000046;

[0055] DH5α competent cells: purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number B528413;

[0056] T5 Exouclease: Purchased from NEB Corporation, USA, part number M0663S;

[0057] EZ-10 Column DNA Gel Recovery Kit: Purchased from Sangon Biotech (Shanghai) Co., Ltd., item number B610353;

[0058] PrimeSTAR DNA polymerase: purchased from TaKaRa Corporation, Japan, catalog number R045;

[0059] 2×HyperMB universal SYBR Green qPCR premix: purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number B690016;

[0060] RIPA lysis buffer: purchased from Sangon Biotech (Shanghai) Co., Ltd., product number C500007;

[0061] PBS buffer: purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number E607008;

[0062] Pancreatic enzyme cell digestion solution: purchased from Shanghai Beyotime Biotechnology Co., Ltd., product number C0201;

[0063] DMEM (high glucose) culture medium: purchased from Sangon Biotech (Shanghai) Co., Ltd., product number E600003;

[0064] FBS fetal bovine serum: purchased from Wuhan Pronosai Life Science Technology Co., Ltd., product number 164210;

[0065] RNA extraction kit for virus detection (centrifuge column type): purchased from Tiangen Biotech (Beijing) Co., Ltd., item number B0513A;

[0066] UNIQ-10 Trizol Total RNA Extraction Kit (Column Type): Purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number B511321;

[0067] Doxycycline: Purchased from Sangon Biotech (Shanghai) Co., Ltd., product number A426819;

[0068] Endotoxin-free plasmid miniature column extraction kit: purchased from Omega Bio-Tek Biotechnology, USA, catalog number D6950;

[0069] HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper): Purchased from Nanjing Novizan Biosciences Co., Ltd., catalog number R312;

[0070] HiScipt IIOne Step qRT-PR SYBR Green Kit: Purchased from Nanjing Novizan Biosciences Co., Ltd., item number Q221.

[0071] T5 exonuclease (10U / μL): purchased from NEB Corporation, USA, catalog number M0363S;

[0072] 1M Tris-HCl (pH 7.5): Purchased from Sangon Biotech (Shanghai) Co., Ltd., product number B548124;

[0073] MgCl2·6H2O: purchased from Sangon Biotech (Shanghai) Co., Ltd., item number A601336;

[0074] PEG8000: Purchased from Sangon Biotech (Shanghai) Co., Ltd., product number A100159;

[0075] 50mM dithiothreitol: purchased from Sangon Biotech (Shanghai) Co., Ltd., product number A100281;

[0076] 5X TEDA solution (1 mL) preparation: 0.5 M Tris-HCl (pH 7.5), 50 mM MgCl2, 50 mM dithiothreitol (DTT), 0.25 g PEG8000 and 1 μL L5 exonuclease (10 U / μl).

[0077] Preparation of recombinant reagent: Take 300 μL of 5X TEDA buffer, add 0.3-0.6 μL of T5 exonuclease (10 U / μL), mix well, and aliquot 100 μL into 1.5 EP tubes for long-term storage at -80℃, or store 4 μL per PCR tube at -20℃ for later use.

[0078] Preparation of 10% FBSDMEM (high glucose) medium: In a clean bench, pour 50 mL of FBSFBS fetal bovine serum into 500 mL of LDMEM (high glucose) medium, shake well, and store at 4°C for later use.

[0079] Example 1:

[0080] like Figure 1As shown, this embodiment constructs the expression plasmid pLVX-TetOne-GSDMD-NT-mCherry containing the GSDMD-NT gene regulated by the TRE3G promoter and the mCherry reporter gene, the CRISPR integration plasmid psPAX2-AAVS1-gRNA-Gag-SpCas9 encoding the Cas9 nuclease and gRNA targeting the AAVS1 site, the packaging plasmid psPAX2-AAVS1-gRNA-Gag-Pol encoding the Gag and Pol fusion protein, and the targeting modification plasmid pMD2.G-Claudin18.2-scFv containing the anti-Claudin18.2 single-chain antibody (scFv) gene and the VSV-G mutant gene (K47A, R350A). The specific construction steps are as follows:

[0081] (1) Construction of pLVX-TetOne-GSDMD-NT-mCherry:

[0082] Using the commercially available plasmid pLVX-TetOne-Puro-p21 (Addgene#171122) as a template, the pLVX-TetOne backbone vector was linearized by double digestion with EcoRI and BamHI. The synthesized GSDMD-NT gene fragment (nucleotide sequence SEQ ID NO:1) was then amplified by PCR to obtain the GSDMD-NT fragment. The PCR reaction conditions were: 98℃, 30s; 98℃, 10s, 55℃, 10s, 72℃, 10s, 34 cycles; 72℃, 1min.

[0083] The linearized pLVX-TetOne backbone vector and the GSDMD-NT fragment were recombinantly ligated using recombinant reagents. After ligation at 30°C for 40 min, the ligation product was obtained. The ligation product was then used to transform E. coli DH5α competent cells, plated on LB agar plates containing 100 μg / mL ampicillin, and cultured overnight at 37°C. Positive clones were selected for sequencing, and if the sequencing was successful, the pLVX-TetOne-GSDMD-NT was considered successfully constructed.

[0084] Using pLVX-TetOne-GSDMD-NT as the vector backbone, it was linearized by double digestion with MIuI and XbaI. The synthesized mCHerry gene fragment (nucleotide sequence SEQ ID NO:2) was used as a template for PCR amplification to obtain the mCherry fragment (SEQ ID NO:2). The PCR reaction conditions were: 98℃, 30s; 98℃, 10s, 55℃, 10s, 72℃, 10s, 34 cycles; 72℃, 1min.

[0085] The linearized pLVX-TetOne-GSDMD-NT backbone vector and the mCherry fragment were recombinantly ligated using recombinant reagents at 30°C for 40 min. The ligation product was transformed into E. coli DH5α competent cells, plated on LB agar plates containing 100 μg / mL ampicillin, and incubated overnight at 37°C. Positive clones were selected for sequencing, and if the sequencing was successful, the pLVX-TetOne-GSDMD-NT-mCherry fragment was successfully constructed.

[0086] (2) Construction of psPAX2-AAVS1-gRNA-Gag-Pol:

[0087] Using psPAX2 (Addgene##12260) as the vector backbone, it was linearized with SalI enzyme, and the psPAX2 backbone vector was recovered. The coding sequence containing AAVS1-gRNA (SEQ ID NO:4) was synthesized and amplified by PCR to obtain the AAVS1-gRNA fragment. The PCR reaction conditions were: 98℃, 30s; 98℃, 10s, 55℃, 10s, 72℃, 10s, 34 cycles; 72℃, 1min.

[0088] The linearized psPAX2 backbone vector and the AAVS1-gRNA fragment were recombinantly ligated using recombinant reagents at 30°C for 40 min. The ligation product was transformed into E. coli DH5α competent cells, plated on LB agar plates containing 100 μg / mL ampicillin, and incubated overnight at 37°C. Positive clones were selected for sequencing, and if the sequencing was successful, the psPAX2-AAVS1-gRNA-Gag-Pol was successfully constructed.

[0089] (3) Construction of psPAX2-AAVS1-gRNA-Gag-SpCas9:

[0090] Using psPAX2-AAVS1-gRNA-Gag-Pol as the vector backbone, the vector was linearized by double digestion with XbaI and AgeI enzymes, and the psPAX2-AAVS1 backbone vector was recovered. The coding sequence containing SpCas9 (SEQ ID NO:3) was synthesized and amplified by PCR to obtain the SpCas9 fragment. The PCR reaction conditions were: 98℃, 30s; 98℃, 10s, 55℃, 30s, 72℃, 10s, 34 cycles; 72℃, 1min.

[0091] The linearized psPAX2 backbone vector and the SpCas9 fragment were recombinantly ligated using recombinant reagents at 30°C for 40 min. The ligation product was transformed into *E. coli* DH5α competent cells, plated on LB agar plates containing 100 μg / mL ampicillin, and incubated overnight at 37°C. Positive clones were selected for sequencing, and successful construction of psPAX2-AAVS1-gRNA-Gag-SpCas9 was confirmed.

[0092] (2) Construction of psPAX2-AAVS1-gRNA-Gag-Pol:

[0093] Using psPAX2 (Addgene##12260) as the vector backbone, it was linearized with SalI enzyme, and the psPAX2 backbone vector was recovered. The coding sequence containing AAVS1-gRNA (SEQ ID NO:4) was synthesized and amplified by PCR to obtain the AAVS1-gRNA fragment. The PCR reaction conditions were: 98℃, 30s; 98℃, 10s, 55℃, 10s, 72℃, 10s, 34 cycles; 72℃, 1min.

[0094] The linearized psPAX2 backbone vector and the AAVS1-gRNA fragment were recombinantly ligated using recombinant reagents at 30°C for 40 min. The ligation product was transformed into E. coli DH5α competent cells, plated on LB agar plates containing 100 μg / mL ampicillin, and incubated overnight at 37°C. Positive clones were selected for sequencing, and if the sequencing was successful, the psPAX2-AAVS1-gRNA-Gag-Pol was successfully constructed.

[0095] (4) Construction of pMD2.G-Claudin18.2-scFv:

[0096] Using the commercially available envelope plasmid pMD2.G (Addgene#12259) as the backbone, the pMD2.G backbone vector was linearized by double digestion with BstBI and PmlI and then recovered.

[0097] The coding sequence (SEQ ID NO:5) for anti-Claudin18.2 scFv-VSVG (K47A, R350A) was synthesized and amplified by PCR to obtain the scFv-VSVG fragment. The PCR reaction conditions were: 98℃, 30s; 98℃, 10s, 55℃, 30s, 72℃, 10s, 34 cycles; 72℃, 1min.

[0098] The linearized pMD2.G backbone vector and the synthesized scFv-VSVG fragment were recombinantly ligated using recombinant reagents at 30°C for 40 min. The ligation product was transformed into E. coli DH5α competent cells, plated on LB agar plates containing 100 μg / mL ampicillin, and cultured overnight at 37°C. Positive clones were selected and sequenced. Successful construction was confirmed upon verification of correct results.

[0099] Example 2:

[0100] In this embodiment, the four plasmids obtained in Example 1 are used to prepare a lentiviral targeted delivery system based on the CRISPR-Tet-On dual-control system. The preparation method includes:

[0101] 3x10 6 HEK293T cells were seeded in 10cm dishes and cultured in 10mL of 10% FBSDMEM medium. Transfection was performed when the cells reached 60-80% confluence using the JetPRIME transfection kit: In a clean 1.5mL EP tube, 500μL of JetPRIME buffer was added, followed by the four plasmids obtained in Example 1 according to Table 1. After thorough mixing, 20μL of JetPRIME transfection reagent was added and thoroughly mixed. The mixture was then incubated at room temperature for 10 minutes. The mixture was then slowly and evenly added dropwise to the culture dish, gently shaken to mix, and incubated at 37℃ in a 5% CO2 cell culture incubator for 4 hours. The old medium was discarded, and 10mL of 10% FBSDMEM medium was added for further culture. After 48 hours of culture, the cells could be observed under an inverted fluorescence microscope (e.g., ...). Figure 2 A distinct red fluorescent signal was observed, indicating that the lentivirus packaging process was successful.

[0102] Table 1. Amounts of the four plasmids obtained in Example 1

[0103] plasmid dosage Option 1 Option 2 Option 3 pLVX-TetOne-GSDMD-NT-mCherry 4.4μg 5μg 5μg psPAX2-AAVS1-gRNA-Gag-SpCas9 1.2μg 3.4μg 3.4μg psPAX2-AAVS1-gRNA-Gag-Pol 3.6μg 1.6μg 1.6μg pMD2.G-Claudin18.2-scFv 0.4μg 0.5μg 1.2μg

[0104] Cell culture medium, i.e., viral supernatant, was collected 48 h and 72 h after transfection. The supernatant was centrifuged at 3100 rpm for 10 min to remove cell debris. After filtering the supernatant through a 0.45 μm filter, 25% (w / v) PEG8000 was added, and the mixture was incubated at 4°C for 48 h. Subsequently, the supernatant was discarded after centrifugation at 3100 rpm for 10 min, and the virus concentrate was resuspended in 200 μL of PBS buffer to obtain the concentrated viral solution, which is the lentiviral targeted delivery system based on the CRISPR-Tet-On dual-control system described in this invention. This concentrate can be stored briefly at 4°C or aliquoted at -80°C for long-term storage.

[0105] Example 3:

[0106] In this embodiment, the lentiviral titers of the three schemes in Example 2 were determined by qPCR. The specific steps are as follows:

[0107] S1. Plotting the standard curve:

[0108] The concentration of pLVX-TetOne-GSDMD-NT-mCherry plasmid DNA, as determined by NanoDrop, was 1046.39 ng / μL. According to the formula:

[0109] This translates to a copy number of 6.06 × 10⁻⁶. 10 Copies / μL. Standard plasmids were serially diluted 10-fold (10 copies / μL). 10 -10 3 (copies / μL) was used as the template for the qPCR standard curve, with a total of 8 gradients, each with 3 replicates. The standard curve is shown below. Figure 3 As shown in Figure A.

[0110] S2. Viral RNA extraction: In a clean bench, the viral concentrate from Example 2 was extracted using a viral RNA extraction kit for virus detection to obtain lentivirus RNA.

[0111] S3. Viral titer determination: Using an appropriate amount of total RNA as a template, prepare the qPCR system using the HiScript II One step qPT-PCR SYBP Green Kit in the dark. The qPCR system is 2×One Step SYBR GreenMix.

[0112] 10 μL; One Step SYBR Green Enzyme Mix 1 μL; 50×ROX Reference Dye 1 0.4 μL; Forward primer (10 μM) 0.4 μL; Reverse primer (10 μM) 0.4 μL; RNA template 0.4 μL. The primer sequences are shown below:

[0113] NF(SEQ ID NO:6):AGGACAGGCAAAGATCGCAG;

[0114] NR (SEQ ID NO:7): GTCTGCCAGGTGTTAGGGTC.

[0115] The qPCR reaction program is shown in the table below. Also, set the instrument's default melting curve program.

[0116] Table 2. qPCR reaction procedures

[0117]

[0118] After qPCR, the Ct value of the GSDMD-NT gene was obtained from the real-time quantitative PCR instrument and substituted into the standard curve equation to estimate the infectious viral particles (TU). The titers of schemes 1, 2, and 3 were 5.26 × 10⁻⁶. 7 TU / mL, 4.93×10 7 TU / mL, 4.08×10 7 TU / mL, the optimal packaging option is Option 1 ( Figure 3 B)

[0119] Example 4:

[0120] In this embodiment, a lentiviral targeted delivery system based on the CRISPR-Tet-On dual-control system was used to infect target cells HEK-293T-Claudin18.2 and induce GSDMD-NT protein expression. The specific steps are as follows:

[0121] The HEK-293T-Claudin18.2 cell line was constructed and preserved in our laboratory. This cell line stably integrates the Claudin18.2 (CLDN18.2) gene into the HEK-293T genome using the PB transposon system. The construction process was as follows: donor plasmid and helper plasmid were co-transfected into HEK-293T cells at a 1:1 ratio; 48 hours after transfection, 3 μg / mL puromycin was added for pressure selection, and only cells containing the successfully integrated element survived; the positive cell pool was cultured as monoclonal using limiting dilution, and single clones were picked and expanded. Finally, flow cytometry was used to validate the monoclonal cell line and screen for the target cell line that stably and highly expresses the Claudin18.2 protein.

[0122] The donor plasmid PiggyBac-Claudin18.2 was constructed in our laboratory, and the construction process is as follows:

[0123] The PiggyBac Dual promoter (purchased from HonorGene, catalog number HG-VPS0614) was linearized, and the Claudin18.2 gene fragment was amplified by PCR. The PiggyBac backbone vector and the Claudin18.2 gene fragment were then recombined and ligated to obtain the PiggyBac-Claudin18.2 plasmid.

[0124] The helper plasmid Super PiggyBac Transposase (purchased from HonorGene, catalog number HG-VPS0615) was used to express the PB transposase.

[0125] HEK-293T-Claudin18.2 cells were seeded in 96-well plates at a seeding density of 1 × 10⁻⁶ cells / well. 4 / well, after culturing for 24 hours, infected cells (MOI=200), gently mixed, and incubated at 37℃, 5% CO2 for 24 hours. To reduce viral damage to cells, the medium needs to be changed after 24 hours of infection. After culturing for another 48 hours, a positive stable cell pool of HEK-293T-Claudin18.2-GSDMD-NT was obtained, i.e., a stable mixed cell pool for lentivirus production (e.g., ... Figure 4 The GSDMD-NT gene and the mCherry gene are co-expressed, and red fluorescence can be observed under an inverted fluorescence microscope.

[0126] After expanding the HEK-293T-Claudin18.2-GSDMD-NT cell pool, the cells were seeded into 6-well plates at a seeding density of 1×10⁻⁶. 5 / well, replace with complete culture medium to a final concentration of 1 μg / mL doxy, induce GSDMD-NT protein expression, observe cell status under an inverted microscope, results as follows. Figure 5 As shown in the figure, obvious pyroptosis can be observed after 48 hours.

[0127] Example 5:

[0128] This embodiment investigated the expression of GSDMD-NT RNA in target cells, and the specific steps are as follows.

[0129] S1. HEK-293T-Claudin18.2-GSDMD-NT cells were induced with a gradient of doxycycline at final concentrations of 0.1, 0.5, 1, 1.5, and 2 μg / mL. Total RNA was extracted from the cells using Trizol reagent after 48 h. An appropriate amount of total RNA was used as a template, and according to the reverse transcription kit instructions (R312), the random primers 00Oligo(dT) from the reverse transcription kit were added sequentially. 20 RNA is reverse transcribed into cDNA using components such as reverse transcriptase and dNTPs, according to the cDNA synthesis reaction program (Table 3).

[0130] Table 3. cDNA Synthesis Reaction Procedure

[0131] temperature time Cycle number 25℃ 5min 1 37℃ 45min 1 85℃ 5s 1

[0132] S2. Using the cDNA obtained in step S1 as a template, a real-time quantitative PCR reaction was performed using GSDMD-NT primers (NF / NR, SEQ ID NO:7 / 8) and β-actin (βF / βR, SEQ ID NO:9 / 10). The reaction system included cDNA template, PCR premix, primers, etc., and amplification was performed in a real-time quantitative PCR instrument according to the set program. Fluorescence signals were collected during the annealing and extension phase of each cycle to monitor the PCR reaction progress in real time. The qPCR reaction system was as follows: 10 μL of 2X Universal SYBR GreenqPCR Master Mix; 0.5 μL of Forward primer (10 μM); 0.5 μL of Reverse primer (10 μM); 0.5 μL of cDNA template; and 8.5 μL of RNase-free dH2O.

[0133] The qPCR primers are shown below:

[0134] βF (SEQ ID NO:8): CTGGAACGGTGAAGGTGACA;

[0135] βR (SEQ ID NO:9): AAGGGACTTCCTGTAACAATGCA.

[0136] The qPCR reaction program is shown in Table 4, and the instrument's default melting curve program is also set.

[0137] Table 4. qPCR reaction procedure

[0138]

[0139] After qPCR, the Ct (CycleThreshold) values ​​of GSDMD-NT and β-actin genes were obtained from a real-time quantitative PCR instrument. The relative quantification of GSDMD-NT was performed using the 2^-ΔΔCt method. Two-way ANOVA was performed using GraphPad Prism software. After induction with 1 μg / mL doxycycline, the expression level of GSDMD-NT increased by 17.57-fold (p<0.0001). Figure 6 A), and the optimal doxy induction concentration is 1 μg / mL ( Figure 6 B). This demonstrates that the lentivirus prepared in this invention successfully delivered the target protein, and that the GSDMD-NT protein was successfully expressed under doxy-induced conditions.

[0140] In summary, this invention constructs a lentiviral targeted delivery system based on a CRISPR-Tet-On dual-control system. In this system, the CRISPR / AAVS1 system is responsible for safely and site-specifically integrating the inducible expression cassette into a genomic "safe harbor" site, while the Tet-On system is responsible for precisely controlling the timing and level of GSDMD-NT induction after integration, avoiding cytotoxicity during packaging and production. The lentiviral targeted delivery system also contains the pMD2.G-Claudin18.2-scFv plasmid, which enables targeted delivery to gastric cancer cells. This lentiviral targeted delivery system solves the problems of difficult delivery, high cytotoxicity, and insufficient targeting specificity in traditional delivery methods, and has excellent applications in the targeted delivery of GSDMD-NT protein and in the preparation of tumor immunotherapy drugs, inflammatory disease intervention agents, or pyroptosis research tools.

[0141] The embodiments described above are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A lentivirus targeted delivery system based on a CRISPR-Tet-On dual-control system, characterized in that, The lentivirus targeted delivery system includes: (1) An expression plasmid containing the GSDMD-NT gene regulated by the TRE3G promoter and the mCherry reporter gene; and (2) A CRISPR integration plasmid encoding the Cas9 nuclease and gRNA targeting the AAVS1 site; and (3) Packaging plasmids for encoding the Gag and Pol fusion protein; and (4) A targeted modification plasmid containing the anti-Claudin18.2 single-chain antibody (scFv) gene and the VSV-G mutant gene (K47A, R350A).

2. The lentivirus targeted delivery system based on the CRISPR-Tet-On dual-control system according to claim 1, characterized in that, The lentivirus targeted delivery system includes: (1) The expression plasmid pLVX-TetOne-GSDMD-NT-mCherry plasmid containing the GSDMD-NT gene regulated by the TRE3G promoter and the mCherry reporter gene, the construction steps of which include: The pLVX-TetOne backbone vector obtained by linearizing pLVX-TetOne-Puro-p21 was recombined with the GSDMD-NT gene fragment to obtain pLVX-TetOne-GSDMD-NT; Using plasmid mCherry as a template, the mCherry fragment was amplified by PCR; pLVX-TetOne-GSDMD-NT was linearized and then recombinated with the mCherry fragment to obtain the pLVX-TetOne-GSDMD-NT-mCherry plasmid; The nucleotides of the GSDMD-NT gene fragment are shown in SEQ ID NO:1; The nucleotides of the mCherry fragment gene are shown in SEQ ID NO:2; (2) The packaging plasmid psPAX2-AAVS1-gRNA-Gag-Pol, used to encode the Gag and Pol fusion protein, is constructed using the following methods: The coding sequence containing AAVS1-gRNA was amplified by PCR to obtain the AAVS1-gRNA fragment, which was then ligated to the linearized psPAX2 backbone vector to obtain the psPAX2-AAVS1-gRNA-Gag-Pol plasmid. The nucleotides encoding the AAVS1-gRNA are shown in SEQ ID NO:4; (3) The CRISPR integration plasmid psPAX2-AAVS1-gRNA-Gag-SpCas9, which encodes the Cas9 nuclease and the gRNA targeting the AAVS1 site, was constructed using the following methods: Using the coding sequence containing SpCas9 as a template, the SpCas9 fragment was amplified by PCR; the plasmid psPAX2-AAVS1-gRNA-Gag-Pol was linearized and then recombinated with the SpCas9 fragment to obtain the psPAX2-AAVS1-gRNA-Gag-SpCas9 plasmid; The nucleotides containing the SpCas9 coding sequence are shown in SEQ ID NO:3; (4) The targeted modification plasmid pMD2.G-Claudin18.2-scFv, containing the anti-Claudin18.2 single-chain antibody gene and the VSV-G mutant gene (K47A, R350A), is constructed using the following methods: The coding sequence of anti-Claudin18.2 scFv-VSVG (K47A, R350A) was amplified by PCR to obtain the scFv-VSVG fragment; the scFv-VSVG fragment was recombinated and ligated with the linearized envelope plasmid pMD2.G to obtain pMD2.G-Claudin18.2-scFv; The nucleotides encoding the anti-Claudin18.2 scFv-VSVG(K47A,R350A) sequence are shown in SEQ ID NO:

5.

3. The lentivirus targeted delivery system based on the CRISPR-Tet-On dual-control system according to claim 1, characterized in that, In the lentivirus targeted delivery system, the mass ratio of expression plasmid, CRISPR integration plasmid, packaging plasmid, and targeting modification plasmid is 4.4–5:1.2–3.4:1.6–3.6:0.4–1.

2.

4. The lentivirus targeted delivery system based on the CRISPR-Tet-On dual-control system according to claim 3, characterized in that, The mass ratio of the expression plasmid, CRISPR integration plasmid, packaging plasmid, and targeting modification plasmid is 4.4:1.2:3.6:0.

4.

5. The method for preparing the lentivirus targeted delivery system based on the CRISPR-Tet-On dual-control system as described in claim 1, characterized in that, The preparation method includes: The cell line was seeded into a culture dish. When the cell confluence reached 60-80%, expression plasmids, CRISPR integration plasmids, packaging plasmids, and targeting modification plasmids were transfected into the cell line. After 4 hours of transfection, the medium was changed. After another 48 hours of transfection, the supernatant was collected, filtered, and concentrated to obtain lentivirus concentrate, which is the lentivirus targeted delivery system described in this invention.

6. The preparation method according to claim 5, characterized in that, The cell line included the HEK293T cell line, with a seeding density of 3 × 10⁻⁶ cells. 6 1 cell / 10cm culture dish 7. The application of the lentiviral targeted delivery system based on the CRISPR-Tet-On dual-control system as described in claim 1 in the preparation of a drug for targeted delivery of GSDMD-NT protein.

8. The application according to claim 7, characterized in that, The drug includes the aforementioned lentiviral targeted delivery system based on the CRISPR-Tet-On dual-control system and doxycycline.

9. The application of the lentiviral targeted delivery system based on the CRISPR-Tet-On dual-control system as described in claim 1 in the preparation of tumor immunotherapy drugs, inflammatory disease intervention agents, or pyroptosis research tools.

10. The application according to claim 9, characterized in that, The tumors include Claudin18.2 positive cancers, such as gastric cancer, pancreatic cancer, esophageal cancer, ovarian cancer, and lung cancer. The inflammatory diseases mentioned include those caused by cells that abnormally express the Claudin18.2 protein.

Images