Preparation method and application of magnetic bead film based on DNA configuration

Abstract

The invention discloses a preparation method and application of a magnetic bead membrane based on DNA configuration, and belongs to the technical field of biological medicine. The method comprises the following steps: mixing an S2 chain coupled with a membrane protein ligand with an S1 chain at equal molar ratio, and forming a variable configuration DNA probe 1 through a thermal annealing procedure; fSY is introduced to a target membrane protein in a fixed point mode through a GCE technology, and a DNA probe 1 is covalently anchored to the surface of the membrane protein through a hexavalent sulfur-fluorine exchange reaction; mixing the activated carboxyl magnetic beads with the extracted cell membrane component containing the DNA probe 1, and co-incubating for 2-4 hours; and removing the uncombined free membrane to obtain the magnetic bead membrane based on DNA configuration. Based on the method, membrane protein target screening and active compound discovery can be achieved, the technology breaks through the application limitation of a traditional screening method on membrane protein targets on the technical level, and meanwhile a brand-new strategy and tool platform is provided for new drug development of targeted membrane protein which cannot be prepared into drugs.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to a magnetic bead film preparation method based on DNA configuration and application. BACKGROUND

[0002] Membrane proteins, as the key executors of cell functions, account for about 25% of the human proteome, and play an indispensable role in various important physiological processes, such as signal transduction (such as G protein-coupled receptor pathway), substance transmembrane transport (such as solute carrier family transporter), and immune response (such as MHC molecule presentation). Abnormalities in membrane protein function have been confirmed to be directly related to more than 60% of diseases, covering various pathological mechanisms such as immune escape of solid tumors, β-amyloid deposition of Alzheimer's disease, etc.

[0003] However, due to the hydrophobicity, dynamicity of conformation, and stability of natural conformation of membrane proteins, they have been regarded as “undruggable” targets for a long time. About 50% of drug targets have not been effectively developed due to the lack of effective action sites or stable conformations. Although some bifunctional molecules (such as lysosomal targeting chimera, antibody-based targeting chimera) have achieved the degradation of membrane proteins through the lysosomal pathway, their application is still limited by the complex “antibody-linker-ligand” coupling process and high dependence on specific membrane receptors (such as cation-independent mannose 6-phosphate receptor, iron transfer protein receptor CD71), and therefore can only cover less than 10% of membrane protein targets.

[0004] Although some drugs based on membrane protein targets have entered the preclinical or clinical trial stage, for example, a novel bifunctional small molecule drug NBQ72S targeting solute carrier family 7 member 5 (SLC7A5) is used for the treatment of solid tumor brain metastasis, and an oral small molecule SLC6A8 inhibitor Ompenaclid regulates creatine metabolism to treat colorectal cancer patients, but due to the strong dependence of transmembrane proteins on the cell environment and the difficulty in expression and purification, and the more times of transmembrane, the more difficult it is to express and purify, the vast majority of membrane protein superfamily members have not been successfully explored and utilized.

[0005] Magnetic bead technology has become a key tool to break through the bottleneck of membrane protein research due to its three advantages of directional coupling, conformational support and high specific surface area. Through the functional modification of superparamagnetic beads (such as carboxyl, amino or streptavidin modification, particle size of 1-5 μm), the membrane protein (such as extracellular loop or glycosylation site) can be directionally coupled, and the natural conformation and functional activity of the membrane protein can be effectively maintained under near physiological conditions. In addition, the magnetic beads have controllable magnetic response performance, which can realize the rapid enrichment, separation and purification of the membrane protein complex through an external magnetic field, greatly improving the operation convenience and efficiency, and being suitable for automation and high-throughput experimental process. This technology is expected to capture cell membranes, provide a support substrate for membrane protein conformation, and greatly facilitate high-throughput screening. However, how to accurately analyze a large amount of membrane protein information and provide a unique identification similar to a product barcode is still a technical problem to be solved.

[0006] DNA-encoded chemical library (DEL) technology provides a new way for efficient screening of compounds. In DEL, each compound is attached to a unique DNA tag as a "catalog number" of the compound structure information. This tag allows all compounds in the library to be mixed and screened against the target at the same time, thereby discovering compounds that can regulate the biological function of the target. However, DEL technology mainly targets intracellular proteins and is difficult to apply to membrane proteins. In addition, DEL technology cannot screen the target of the compound at multiple targets in reverse, because DEL encodes the compound, not the target. SUMMARY

[0007] The purpose of the present application is to provide a DNA configuration-based magnetic bead membrane and its preparation method and application, in order to break through the technical bottleneck in the research of existing membrane protein targets, especially the application limitations in the screening of membrane protein targets and the discovery of active compounds.

[0008] Combining DEL technology with magnetic bead technology can track the interaction between drugs and membrane protein targets using DNA encoding information based on magnetic bead enrichment. Based on this innovative idea, the present application proposes a new DNA configuration-based magnetic bead membrane preparation method and a membrane protein target screening method by deeply combining allosteric DNA probes with magnetic bead technology. The screening method of the present application can not only track the drug response behavior of more than 30 targets in parallel in a single experiment, but also greatly improve the high-throughput screening ability of membrane protein targets, providing a new path for the discovery of "undruggable" targets.

[0009] The application also proposes a specific application process of the magnetic bead film based on the DNA configuration in the membrane protein target point recognition.

[0010] Technical scheme: The purpose of the application is realized by the following technical scheme: The application provides a preparation method of a magnetic bead film based on DNA configuration, comprising the following steps: (1) Preparation of DNA allosteric probe: mix S2 chain coupled with membrane protein ligand and tag chain S1 chain at an equal molar ratio, and form allosteric DNA probe 1 through a heat annealing program; (2) In situ labeling of live cell membrane protein: introduce non-natural amino acid fluorosulfate-L-tyrosine (FSY) into the target membrane protein through genetic code expansion technology GCE, and covalently anchor the allosteric DNA probe 1 on the membrane protein surface by using sulfur fluoride exchange reaction (SuFEx), so as to realize in situ controllable labeling of the live cell membrane protein; (3) Preparation of covalent DNA probe 1 magnetic bead film: extract the cell membrane containing the allosteric DNA probe 1; activate the carboxyl magnetic bead in a pH 5.0-6.0 buffer solution for 15-30 min; mix the activated carboxyl magnetic bead with the extracted cell membrane components, and co-incubate for 2-4 h; remove the unbound free membrane fragments by using magnetic separation, and obtain the high-purity magnetic bead film based on DNA configuration.

[0011] The magnetic bead film is prepared by enriching the engineered cell membrane modified by the allosteric DNA on the surface of the carboxyl magnetic bead; the allosteric DNA realizes in situ engineering modification on the cell membrane protein site through the DNA allosteric effect, the DNA coding label effect and the orthogonal tRNA synthetase system. The magnetic bead film can effectively retain the natural conformation and post-translational modification of the membrane protein, and realize efficient capture and purification of the target drug through the action of the magnetic field.

[0012] In a preferred embodiment of the application, in step (1), the tag chain S1 chain is selected from any one of SEQ ID NO. 1, SEQ ID NO. 7-9; The S1 chain shown in SEQ ID NO. 1 is a specific tag chain of SLC7A5 membrane protein; The S1 chain shown in SEQ ID NO. 7 is a specific tag chain of SLC1A5 membrane protein; The S1 chain shown in SEQ ID NO. 8 is a specific tag chain of SLC38A1 membrane protein; S1 strand as shown in SEQ ID NO. 9: it is a specific tag strand of SLC38A2 membrane protein; The S2 strand coupled with the membrane protein ligand is a DBCO-S2 strand, which is modified with a DBCO group at its 5' end, and its sequence is shown in SEQ ID NO. 3.

[0013] Preferably, in step (1), the thermal annealing program is: 95℃, reaction for 5min; 4℃, reaction for 30min.

[0014] In a preferred embodiment of the present application, in step (2), the allosteric DNA probe 1 is subjected to SuFEx click chemistry reaction with FSY through the modified polypeptide chain aa on its S2 strand, and the fluorosulfate group of FSY reacts with the adjacent nucleophilic residues on the polypeptide chain aa to form a covalent bond, achieving stable anchoring of the probe on the membrane protein surface.

[0015] Further preferably, the sequence of the polypeptide chain aa is shown in SEQ ID NO. 4, which is modified with an azide group at its C-terminus.

[0016] In the present application, the design of the dynamic allosteric DNA probe takes into account the DNA allosteric effect, the compatibility of second-generation sequencing and the structural characteristics of DNA coding library. The allosteric DNA probe 1 is composed of two oligonucleotide strands which are not completely complementary, one of which is completely complementary to one of the strands of the allosteric DNA probe 2. This design allows DNA probe 2 to induce strand displacement reaction of DNA probe 1 under certain conditions, thereby triggering conformational change and releasing the preset DNA tag sequence, realizing the process of “dynamic hybridization”.

[0017] The 5' end of the DNA tag sequence is a uniformly designed primer segment, which is used for subsequent PCR amplification; while the 3' end is designed as a specific coding sequence corresponding to each membrane protein target, which is used for target analysis in high-throughput sequencing. In the process of sequence design, online tools such as OligoCalc and CompareTm are used to evaluate the thermal stability (T m m) of each probe sequence, thermodynamic parameters (such as entropy change, enthalpy change and free energy change) and complementarity, to ensure that the probe forms the target structure stably under physiological conditions and avoids self-paired structure caused by palindromic sequences.

[0018] To enhance the response specificity and control ability of the probe system, an exogenous condition trigger module is further introduced, such as an enzyme response element, a pH sensitive region or a specific nucleic acid sequence mediated allosteric module. By constructing an AND logic gate (i.e. only when DNA probe 2 and external trigger conditions exist at the same time, DNA probe 1 occurs allosteric), the background noise is effectively suppressed, and the response sensitivity and signal-to-noise ratio of the system to effective binding events are improved. This design strategy not only improves the controllability and accuracy of the allosteric DNA probe system, but also lays a foundation for subsequent visualization screening and high-throughput identification of membrane protein targets.

[0019] Preferably, in step (3), the core material of the carboxyl magnetic beads is polystyrene microspheres with a particle size of 1-5 μm, and the surface is modified with carboxyl groups, and the carboxyl content is 2400 nmol / mg.

[0020] Preferably, in step (3), a cell membrane protein extraction kit is used to extract the cell membrane containing allosteric DNA probe 1.

[0021] The application also provides the application of the DNA configuration-based magnetic bead membrane prepared by the preparation method in membrane protein target screening and active compound discovery.

[0022] The application also provides a method for screening membrane protein targets based on the preparation method of the magnetic bead membrane, comprising the following steps: (1) Preparation of DNA allosteric probe: mix the S2 chain coupled with the membrane protein ligand with the S1 chain of different membrane proteins in equal molar ratio, and form the allosteric DNA probe 1 corresponding to different membrane proteins through a heat annealing program; mix the S3 chain coupled with the drug with the S4 chain in equal molar ratio, and form the allosteric DNA probe 2 through a heat annealing program; (2) In-situ labeling of live cell membrane proteins: introduce the unnatural amino acid fluorosulfonic acid-L-tyrosine FSY into the target membrane protein by genetic code expansion technology GCE, and covalently anchor the allosteric DNA probe 1 on the membrane protein surface by using hexavalent sulfur fluorine exchange reaction SuFEx, to realize in-situ controllable labeling of live cell membrane proteins; (3) Preparation of covalent DNA probe 1 magnetic bead membrane: extract the cell membrane containing the allosteric DNA probe 1 corresponding to different membrane proteins; activate the carboxyl magnetic beads in pH 5.0-6.0 buffer for 15-30 min by using EDC / NHS; mix the activated carboxyl magnetic beads with the extracted cell membrane components, and co-incubate for 2-4 h; remove the unbound free membrane fragments by magnetic separation, and obtain the covalent DNA probe 1 magnetic bead membrane; (4) Adding dynamic allosteric DNA probe 2: adding dynamic allosteric DNA probe 2 containing a single active drug to the magnetic bead film covalently modified with DNA probe 1 above, after co-incubation, removing the unbound probe 2 by magnetic separation, adding RNAse to trigger probe allosterism, using the allosteric effect between the allosteric DNA probe 1 and the probe 2 and the magnetic field effect to release the tag encoding the membrane protein target point; collecting the supernatant, and using specific primers compatible with high-throughput sequencing for PCR amplification and sequencing, so as to identify the membrane protein target point acted by the active compound.

[0023] Preferably, in step (1), the nucleotide sequence of the S3 chain is as shown in SEQ ID NO. 5; the nucleotide sequence of the S4 chain is as shown in SEQ ID NO. 6; The thermal annealing program is: 95℃, reaction for 5 min; 4℃, reaction for 30 min.

[0024] Preferably, in step (1), the DNA base complementary pairing length of the S2 chain coupled with the membrane protein ligand and the S1 chain is less than the DNA base complementary pairing length of the S2 and S3 chains. When this condition is met, S3 and S1 compete, S3 and S2 complementary pairing form S2S3, and S1 DNA tag chain is dropped. Beneficial effects

[0025] 1. The application is suitable for "non-druggable" membrane protein targets: thanks to the stable support of magnetic beads on the natural conformation of membrane proteins, the application can cover membrane protein targets with strong hydrophobicity, unstable structure or dynamic positioning, which are difficult to handle by traditional methods, and effectively expands the drug target space.

[0026] 2. Encoding and identification are highly specific: the molecular recognition system constructed by using allosteric DNA probes has high conformational response specificity and information fidelity. Whether from target to compound or from compound to target, accurate tracing and identification can be achieved by sequencing the DNA tag chain.

[0027] 3. Strong technical versatility, suitable for multiple types of active compounds: the application is suitable for screening of active small molecules, natural products, fragment compounds of various structural types, and even can be extended to screening of polypeptide or cyclic peptide and other medium molecular compounds, and has good platform versatility and expandability.

[0028] 4. Simple operation and controllable cost of experimental system: compared with antibody-coupled targeting tools, the application does not need complex antibody-linker design, and the experimental process mainly uses conventional molecular biology and magnetic bead enrichment operation, which is easy to standardize, automate and scale up.

[0029] 5. Adapt to the cell membrane microenvironment, maintain the biological activity of membrane proteins: The present application carries out membrane protein fixation and screening under near physiological conditions, maximally retains the conformational activity and natural state of membrane proteins, and improves the biological relevance and transformation value of screening results. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 The polyacrylamide gel electrophoresis characterization diagram of the dynamic allosteric DNA probe 1 prepared for the embodiment 1 of the present application; Figure 2 The hydrated particle size analysis diagram of the magnetic bead film; wherein, Figure 2 A, Figure 2 B, Figure 2 C respectively represent the hydrated particle size distribution diagrams of the blank carboxyl magnetic beads, the magnetic bead film and the covalent DNA probe 1 magnetic bead film; Figure 3 The potential distribution diagram of the magnetic bead film; wherein, Figure 3 A, Figure 3 B, Figure 3 C respectively represent the potential distribution diagrams of the blank carboxyl magnetic beads, the magnetic bead film and the covalent DNA probe 1 magnetic bead film; Figure 4 The transmission electron microscope diagram of the magnetic bead film; Figure 5 The magnetic bead film structure schematic diagram and construction flow diagram of the covalent allosteric DNA probe 1; Figure 5 A represents the single magnetic bead film structure schematic diagram of the covalent DNA probe 1; Figure 5 B represents the different magnetic bead film structure schematic diagram of the covalent DNA probe 1; Figure 6 The schematic diagram of the magnetic bead film based on the DNA configuration constructed by the present application for the membrane protein target point discovery of active compounds; Figure 7 The DNA gel electrophoresis result diagram of the supernatant solution collected in the membrane protein target point screening process; Figure 8 The sequencing result diagram of the recovered DNA tag chain after amplification by the SLC38A1 primer; Figure 9 The sequencing result diagram of the recovered DNA tag chain after amplification by the SLC38A2 primer; Figure 10 The sequencing result diagram of the recovered DNA tag chain after amplification by the SLC1A5 primer; Figure 11 The sequencing result diagram of the recovered DNA tag chain after amplification by the SLC7A5 primer. DETAILED DESCRIPTION

[0031] The technical solutions of the present application will be described in detail below through specific examples, but the protection scope of the present application is not limited to the examples.

[0032] Preparation of dynamic conformational DNA probe 1 (antibody conjugated targeting tool) In this comparative example, the preparation of dynamic conformational DNA probe 1 is suitable for the case where the membrane protein ligand is a macromolecular substance.

[0033] Firstly, the SLC1A5 membrane protein ligand-antibody (20350-1-AP, 1 μg / μL) was purchased from Wuhan Sanying Biotechnology Co., Ltd., 50 uL of which was dissolved in PBS (pH 7.4) to prepare a 100 uL system, and the crosslinking agent 4-(N-maleimidomethyl) cyclohexane-1-carboxylic acid succinimidyl ester (Succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate, SMCC) was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., dissolved in ddH2O to prepare a 200 μM solution for standby. The above antibody solution and 100 uL SMCC solution (200 μM) were reacted in a metal bath at 37°C with 800 rpm shaking for 2 h, and then purified using a 10 kDa ultrafiltration tube to remove excess SMCC. The ultrafiltration buffer was PBS (pH 7.4) containing a final concentration of 1 mM EDTA. The purified antibody-SMCC intermediate was obtained.

[0034] Further, the above purified antibody-SMCC intermediate was mixed with the thiol-modified S2 chain (100 μM) at an equal molar ratio, and reacted at 28°C with 800 rpm shaking in a metal bath for 2 h.

[0035] Then, the unreacted S2 chain was removed by using a 50 kDa ultrafiltration tube for purification, and the ultrafiltration buffer was PBS (pH 7.4), to obtain the purified “membrane protein antibody ligand conjugated S2 chain”.

[0036] Finally, the obtained “membrane protein antibody ligand conjugated S2 chain” was mixed with the S1 chain at an equal molar ratio, and a dynamic conformational DNA probe 1 was formed through a thermal annealing program.

[0037] The thermal annealing program was as follows: ① 95°C, reaction for 5 min; ② 4°C, reaction for 30 min.

[0038] The DNA sequences used are as follows (shown in SEQ ID NO. 1-2), and the S1 chain and HS-S2 chain were purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0039] The S1 chain shown in SEQ ID NO. 1: 5'-TCTTCTAACCTCTCACTCGTCTACACAGCAAATCCGATATCAGAACCGTCAAACCCCTTAAGTCCTCCGCAAACCTTATC-Cy3-3'; HS-S2 strand shown in SEQ ID NO. 2, the 5' end of which is modified with a thiol group: 5'-HS-CATTAGAACGGATAAGGTTTGCGGAGGACTTAAGGGGTAA-3'.

[0040] Example 1 Preparation of dynamic allosteric DNA probe 1 (conventional molecular coupling type targeting tool) In this example, the preparation of dynamic allosteric DNA probe 1 is suitable for small molecule substances as membrane protein ligands.

[0041] The DNA sequences used are as follows (shown in SEQ ID NO. 3-4), and the DBCO-S2 strand is purchased from Baorui Biotechnology (Beijing) Co., Ltd.; the SLC7A5 membrane protein ligand-azide modified polypeptide chain (aa) is purchased from Shanghai Chupeibio Biotechnology Co., Ltd.

[0042] DBCO-S2 strand shown in SEQ ID NO. 3, the 5' end of which is modified with a DBCO group: 5'-DBCO-CATTAGAACGGATAAGGTTTGCGGAGGACTTAAGGGGTAA-3'; Polypeptide chain (aa) shown in SEQ ID NO. 4, the C-terminal of which is modified with an azide group: His-Tyr-Pro-Ser-Lys(N3).

[0043] Take 1 mg of SLC7A5 membrane protein ligand-azide modified polypeptide chain (aa) and dissolve it in PBS (pH 7.4) to prepare a solution with a concentration of 500 μM for standby. Dissolve the DBCO-modified DNA S2 strand dry powder (i.e. DBCO-S2 strand) in PBS (pH 7.4) to prepare a solution with a concentration of 50 μM for standby.

[0044] Prepare DNA probe 1 with a molar ratio of 10:1 between polypeptide chain (aa) and DBCO-S2 strand by adding 50 uL of polypeptide chain solution (500 μM) and 50 uL of DBCO-S2 strand (50 μM). Perform the reaction in a metal bath with 28°C 800 rpm shaking for 2h through click chemistry reaction.

[0045] Subsequently, use a 50 kDa ultrafiltration tube for purification to remove unreacted S2 strands, and the ultrafiltration buffer is PBS (pH 7.4) to obtain purified "membrane protein polypeptide ligand-S2 strand".

[0046] The obtained "membrane protein polypeptide ligand-S2 strand" was mixed with the S1 strand (the sequence is shown as SEQ ID NO. 1) in an equimolar ratio to form a dynamic allosteric DNA probe 1 through a heat annealing procedure.

[0047] The heat annealing procedure was as follows: ① 95℃, reaction for 5 min; ② 4℃, reaction for 30 min.

[0048] The preparation of the dynamic allosteric DNA probe 1 was characterized by 10% polyacrylamide gel electrophoresis. Figure 1 As shown in the results, compared with the S2 strand alone, the delayed migration band of the "membrane protein polypeptide ligand-S2 strand" indicated that the membrane protein polypeptide ligand was successfully coupled on the S2 through click chemistry. Further delayed migration band indicated the successful preparation of the dynamic allosteric DNA probe 1.

[0049] Compared with the preparation of the dynamic allosteric DNA probe 1 using the antibody-coupled targeting tool in Comparative Example 1, the experimental system of the conventional molecule-coupled targeting tool used in Example 1 of the present application is more convenient to operate and controllable in cost, without the need to use customized antibodies, heterobifunctional cross-linking agents (such as SMCC) and other special linkers. The present application has significant advantages in the aspects of simplicity of operation, controllability of cost, and standardization and potential for large-scale production. The dynamic allosteric DNA probe 1 prepared by the conventional molecule-coupled targeting tool in Example 1 of the present application was used in subsequent experiments.

[0050] Example 2 Preparation of dynamic allosteric DNA probe 2 The dry powder of the DBCO group-modified DNA S3 strand (i.e. DBCO-S3 strand) was dissolved in PBS (pH 7.4) to prepare a solution with a concentration of 50 μM for standby use. The azide-modified SLC7A5 inhibitor JPH203 (JPH-N3, purchased from Shanghai Aladdin Biochem Technology Co., Ltd.) was dissolved in DMSO to prepare a solution with a final concentration of 500 μM for standby use.

[0051] The DBCO-S3 strand (50 μL, 50 μM) and JPH203 (5 μL, 500 μM) were mixed in an equimolar ratio, and reacted in a metal bath at 28℃ with 800 rpm shaking for 2 h. After the click chemistry reaction, the S3 strand coupled with JPH203, i.e. "JPH203-S3 strand", was obtained.

[0052] Then, the "JPH203-S3 strand" was mixed with the S4 strand RNA in an equimolar ratio to form a dynamic allosteric DNA probe 2 through a heat annealing procedure.

[0053] The heat annealing procedure was as follows: ① 95℃, reaction for 5 min; ② 4℃, reaction for 30 min.

[0054] The DNA and RNA sequences used are as follows (shown in SEQ ID NO. 5-6), DBCO-S3 chain, S4 chain are purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0055] DBCO-S3 chain shown in SEQ ID NO. 5, the 3' end is modified with DBCO group: 5'-TTACCCCTTAAGTCCTCCGCAAACCTTATCGTCCACCTCATCCATATCTAGTATCTCGTT-DBCO-3'.

[0056] S4 chain shown in SEQ ID NO. 6: 5'-UGAGGUGGACGAUAAGGUUUGCGGAGGACUUAAGGGGUAA-3'.

[0057] Example 3 Preparation of covalent DNA probe 1 magnetic bead film The present application introduces non-natural amino acid Fluorosulfate-L-tyrosine (FSY) into the target membrane protein (membrane protein SLC7A5 in this embodiment) by genetic code expansion technology GCE, realizes the site-specific insertion of non-natural amino acid FSY in situ in living cells, to obtain SLC7A5 membrane protein containing FSY modified. And using six-valent sulfur fluoride exchange reaction (Sulfur Fluoride Exchange, SuFEx) to covalently anchor the allosteric DNA probe 1 on the membrane protein surface (in this embodiment, the overexpressed non-natural amino acid FSY on the SLC7A5 membrane protein forms a covalent bond with the histidine and tyrosine side chains in the polypeptide chain aa through the sulfur fluoride exchange (SuFEx) reaction), to realize the in-situ controllable labeling of the membrane protein of living cells.

[0058] The specific steps are as follows: 1. Plasmid construction: The structure file of membrane protein SLC7A5 was downloaded from the AlphaFold protein structure database, the potential FSY integration site in the membrane protein SLC7A5 was screened by a machine learning model, the 220th amino acid of the gene coding sequence (CDS) of the membrane protein SLC7A5 was simulated as the best insertion site of fluorosulfonic acid-L-tyrosine (FSY), and the gene coding at the 220th position was mutated to a TAG codon. The HindIII / NotI multiple cloning site was inserted into the pcDNA3.1(+) vector to construct the expression plasmid pcDNA3.1(+)_SLC7A5-220TAG_-C-eGFP. The vector used contains an eGFP signal sequence at the C terminus. The expression plasmid pcDNA3.1(+)_SLC7A5-220TAG_-C-eGFP of the application was synthesized by Nanjing Kingsriver Biotechnology Co., Ltd. The plasmids used in the experiment were purchased from Nanjing Kingsriver Biotechnology.

[0059] 2. Cell preparation: HEK293T cells (Shanghai Zhijiao Xin Zhou Biotechnology Co., Ltd.) were seeded in a T75 cell culture flask at a density of 4x10 6  cells / well, and cultured in a 37°C, 5% CO2 incubator using DMEM high glucose medium containing 10% FBS for 24 h until the cell confluence reached 70%-80%.

[0060] 3. Transfection complex preparation: Take 10 μL of transfection reagent Lipofectamine® 2000 (Invitrogen), add 240 μL of serum-free Opti-MEM® medium (Gibco), mix gently and stand for 2 min to obtain a liposome diluent. The pcDNA3.1(+)_SLC7A5-220TAG_-C-eGFP plasmid (4 μg) and the pNEU-FSYRS plasmid (4 μg, a mutant pyrrolysyl-tRNA synthetase FSYRS specific for FSY, provided by Nanjing Kingsriver Biotechnology Co., Ltd.) were dissolved in 250 μL of Opti-MEM® medium, respectively, and incubated at room temperature for 2 min to obtain a plasmid diluent. The plasmid diluent was slowly added to the liposome diluent, mixed gently and incubated at room temperature for 20 min to form a plasmid DNA-Lipofectamine transfection complex.

[0061] 4、293T cell transfection expression: The transfection complex was added dropwise to the culture bottle (the blank control group was added with the same volume of Opti-MEM® medium), and after 8 h of continuous culture at 37°C, 5% CO2, the transfection mixture was removed. Fluorosulfonic acid-L-tyrosine (FSY, MCE) was weighed and dissolved with ddH2O to prepare a 100 mM solution for standby use. 10 mL of DMEM complete medium (Gibco) containing fluorosulfonic acid-L-tyrosine (100 mM, 25 μL) was added to each culture bottle, and the culture was continued at 37°C, 5% CO2 for 48 h to express SLC7A5 membrane protein containing FSY modification.

[0062] 5、Add dynamic allosteric DNA probe 1: The HEK293T cells expressing SLC7A5 membrane protein containing FSY modification were washed twice with pre-cooled PBS (pH 7.4) to completely remove the residual medium on the cell surface. Dynamic allosteric DNA probe 1 prepared in Example 1 (2.5 μM, 2500 μL, solvent PBS) was added to each bottle, and incubated at room temperature for 30 min in the dark; the solution was discarded and washed once with PBS.

[0063] 6、Preparation of covalent DNA probe 1 magnetic bead membrane The cell membrane containing dynamic allosteric DNA probe 1 obtained in step 5 was extracted using a cell membrane protein extraction kit (Wuhan Sanying Biotechnology Co., Ltd., PK10015). The extracted cell membrane component solution was placed on ice for standby use.

[0064] Take 100 uL of 1 μm carboxyl magnetic beads (Nanjing Dongna Biological Technology Co., Ltd., carboxyl content 2400 nmol / mg, 10 mg / mL), i.e. 1 mg / mL. Wash with 100 mM MEST buffer (100 mM MES solution + 0.05% Tween 20, adjust pH to 6.0 with NaOH) for 2 times, separate with a magnetic stand, and add 100 uL of freshly prepared 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 100 mM) and N-hydroxysuccinimide (NHS, 100 mM) to the removed carboxyl magnetic beads, both EDC and NHS are prepared with 100 mM MEST (pH=6.0) buffer and used immediately, and react for 20 min on a rotary shaker for activation.

[0065] Then incubate the activated carboxyl magnetic beads with the extracted cell membrane components on a rotary shaker at room temperature for 3 h. After incubation, separate the magnetic bead membrane by magnetic stand, discard the supernatant buffer, add PBST buffer (PBS, 0.1% Tween 20, 1% BSA) for 1 h to block the unreacted active carboxyl groups on the surface of the magnetic beads, and thus a high-purity magnetic bead membrane covalently linked with DNA probe 1 is prepared.

[0066] To the prepared magnetic bead film structure system covalently connected with DNA probe 1, 1 mL of preservative solution (PBST+1% BSA+0.1% PC-300) was added, and stored at 4°C for further use.

[0067] PC-300 biological preservative bacteriostatic agent was purchased from Shanghai Yipu Rui Biological Technology Co., Ltd.

[0068] Comparative Example 2 Preparation of magnetic bead film (without DNA probe 1) Referring to the preparation steps of the magnetic bead film covalently connected with DNA probe 1 in Example 3, after SLC7A5-220TAG-eGFP was successfully transfected into HEK293T cells, no allosteric DNA probe 1 was added for incubation, and then the membrane components were extracted by the membrane protein extraction kit and coupled with carboxyl magnetic beads to prepare the magnetic bead film according to the preparation method of the magnetic bead film. The prepared magnetic bead film structure system was stored at 4°C for further use.

[0069] The specific steps are as follows: Steps 1-4: The experimental steps of plasmid construction, cell preparation, transfection complex preparation, and 293T cell transfection expression are the same as steps 1-4 in Example 3.

[0070] Step 5: The HEK293T cells expressing SLC7A5 membrane protein containing FSY modification were washed with pre-cooled PBS (pH 7.4) twice to completely remove the residual culture medium on the cell surface. Each bottle was incubated at room temperature for 30 min in the dark; the solution was discarded and washed with PBS once.

[0071] Step 6: Preparation of magnetic bead film The cell membrane obtained in step 5 was extracted using a cell membrane protein extraction kit (Wuhan Sanying Biological Technology Co., Ltd., PK10015). The extracted cell membrane components were placed on ice for standby.

[0072] Take 100 uL of 1 pm carboxyl magnetic beads (Nanjing Dongna Biological Technology Co., Ltd., carboxyl content 2400 nmol / mg, 10 mg / mL), i.e. 1 mg / mL. Wash with 100 mM MEST (pH=6.0) buffer solution for 2 times respectively, separate with a magnetic stand, add 100 uL of freshly prepared 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 100 mM) and N-hydroxysuccinimide (NHS, 100 mM) to the removed carboxyl magnetic beads, both EDC and NHS are prepared with 100 mM MEST (pH=6.0) buffer solution and used immediately, and react on a rotary shaker for 20 min for activation.

[0073] Then the activated carboxyl magnetic beads were incubated with the extracted cell membrane components on a rotary shaker at room temperature for 3 h. After the incubation, the magnetic bead membranes were separated by a magnetic stand, the supernatant buffer was discarded, and PBST buffer (PBS, 0.1% Tween 20, 1% BSA) was added for 1 h to block the unreacted active carboxyl groups on the surface of the magnetic beads, thereby preparing the magnetic bead membranes.

[0074] Example 4 Particle size analysis of magnetic bead membranes To characterize the construction of the magnetic bead membranes and the covalent modification effect of the allosteric DNA probe 1 (a conventional molecular coupling type targeting tool) prepared in Example 1, a particle size analyzer was used to analyze and compare the hydrated particle sizes of the blank magnetic beads, the magnetic bead membranes prepared in Comparative Example 2, and the magnetic bead membranes covalently modified with the DNA probe 1 prepared in Example 3.

[0075] The magnetic bead membranes prepared above and the magnetic bead membranes covalently linked with the DNA probe 1 were used as the experimental group, and carboxyl magnetic beads without any treatment were used as the blank control group. The above three types of samples were used for particle size analyzer detection of their hydrated particle sizes: (1) blank magnetic beads; (2) magnetic bead membranes (without DNA probe 1); (3) magnetic bead membranes covalently modified with DNA probe 1.

[0076] The detection results are shown in Table 1: Figure 2 Table 1: Detection results of the hydrated particle sizes of the magnetic bead membranes The above results show that the effective coating of the cell membrane on the surface of the magnetic beads significantly increases the particle size of the magnetic beads, and the covalent modification of the DNA probe 1 further leads to an increase in the particle size, indicating that the DNA probe 1 is successfully anchored on the surface of the membrane protein, and the entire membrane-magnetic bead composite structure is stably constructed, providing a structural basis and physical support for subsequent target screening.

[0077] Example 5 Zeta potential analysis of magnetic bead membranes On the basis of Example 4, a Zeta potential analyzer was used to analyze and compare the potential values of the blank magnetic beads, the magnetic bead membranes, and the magnetic bead membranes covalently modified with the DNA probe 1. The above three types of samples were used for potential analyzer detection of their potential values: (1) blank magnetic beads; (2) magnetic bead membranes (without DNA probe 1); (3) magnetic bead membranes covalently modified with DNA probe 1.

[0078] Figure 3The average potential values of the blank magnetic beads, the magnetic bead film, and the magnetic bead film containing DNA probe 1 were about -33.68721 mV, -25.84788 mV, and -22.40071 mV, respectively. The above results showed that the effective coating of the cell membrane on the surface of the magnetic beads significantly neutralized the negative charge of the carboxyl group, and the potential was significantly increased. The covalent modification of DNA probe 1 further led to an increase in the potential, indicating that DNA probe 1 was successfully covalently anchored on the surface of the membrane protein, and the entire membrane-magnetic bead composite structure system was successfully constructed. This system laid a solid foundation and provided strong methodological support for the subsequent discovery and verification of membrane protein targets, screening of active compounds, and in-depth study of their functional characteristics.

[0079] Example 6 Transmission electron microscope analysis of magnetic bead film On the basis of Example 4, a transmission electron microscope (TEM) analysis method was used to observe the microstructure characteristics of the blank magnetic beads, the magnetic bead film, and the magnetic bead film covalently modified with DNA probe 1. The above three types of samples were detected and analyzed by transmission electron microscope: (1) blank magnetic beads; (2) magnetic bead film (without DNA probe 1); (3) magnetic bead film covalently modified with DNA probe 1.

[0080] The detection results are shown in Figure 4 The TEM detection results clearly showed the microstructure differences of the three types of samples: the blank magnetic bead image was smooth, while the magnetic bead film and the DNA probe 1 modified magnetic bead film showed obvious membrane coating structure formation, indicating that a stable membrane-magnetic bead composite system was successfully constructed, forming a complete screening module for subsequent target screening.

[0081] Example 7 Construction of a method for discovering membrane protein targets based on DNA configuration magnetic bead film This example used the DNA configuration-based magnetic bead film prepared in Example 3 for the discovery of membrane protein targets. The specific implementation steps of the method are as follows: 1. Plasmid construction The structure file of membrane protein SLC7A5 was downloaded from the AlphaFold protein structure database, and the encoding gene of fluorosulfonic acid-L-tyrosine was modified at the 220th amino acid site of the membrane protein SLC7A5 gene coding sequence (CDS). The HindIII / NotI multiple cloning site was inserted into the pcDNA3.1(+) vector to construct the expression plasmid pcDNA3.1(+)_SLC7A5-220TAG_-C-eGFP. The vector used contains an eGFP signal sequence at the C terminus.

[0082] For other membrane proteins, such as SLC38A1, SLC38A2, SLC1A5, etc., in addition to the different modification sites of fluorosulfonic acid-L-tyrosine, the rest of the operation steps are the same as the SLC7A5 membrane protein plasmid construction process. All plasmids are purchased from Nanjing Kingsriver Biotechnology Co., Ltd.

[0083] SLC38A1: The amino acid site at position 256 of the membrane protein SLC38A1 was modified to code for fluorosulfonic acid-L-tyrosine, which was inserted into the pcDNA3.1(+) vector using the HindIII / NotI multiple cloning site, to construct the expression plasmid pcDNA3.1(+)_SLC38A1-256TAG_-C-eGFP.

[0084] SLC38A2: The amino acid site at position 272 of the membrane protein SLC38A2 was modified to code for fluorosulfonic acid-L-tyrosine, which was inserted into the pcDNA3.1(+) vector using the HindIII / NotI multiple cloning site, to construct the expression plasmid pcDNA3.1(+)_SLC38A2-272TAG_-C-eGFP.

[0085] SLC1A5: The amino acid site at position 217 of the membrane protein SLC1A5 was modified to code for fluorosulfonic acid-L-tyrosine, which was inserted into the pcDNA3.1(+) vector using the HindIII / NotI multiple cloning site, to construct the expression plasmid pcDNA3.1(+)_SLC1A5-217TAG_-C-eGFP.

[0086] 2. Cell preparation HEK293T cells were seeded in a T75 cell culture flask at a density of 4 x 10 6  cells / well, and cultured in a 37°C, 5% CO2 incubator using DMEM high glucose medium containing 10% FBS for 24 h until the cell confluence reached 70-80%.

[0087] 3. Transfection complex preparation Take 10 μL of transfection reagent Lipofectamine® 2000, add 240 μL of serum-free Opti-MEM® medium, mix gently, and let stand for 2 min to obtain a liposome diluent.

[0088] The pcDNA3.1(+)_SLC7A5-220TAG_-C-eGFP plasmid (4 μg) and the pNEU-FSYRS plasmid (4 μg) were respectively dissolved in 250 μL of Opti-MEM® medium, and the plasmid diluent was obtained by standing at room temperature for 2 min. The plasmid diluent was slowly added to the liposome diluent, and after gentle mixing, the plasmid DNA-lipofectamine transfection complex was formed by incubation at room temperature for 20 min.

[0089] The preparation of the remaining plasmid DNA-lipofectamine transfection complex was the same as above.

[0090] 4. Expression of 293T cells transfected The transfection complex was added dropwise to the culture bottle (the same volume of Opti-MEM® medium was added to the blank control group), and after further incubation at 37°C, 5% CO2 for 8 h, the transfection mixture was removed.

[0091] Fluorosulfonic acid-L-tyrosine (FSY, MCE) was weighed and dissolved with ddH2O to prepare a 100 mM solution for standby.

[0092] 10 mL of DMEM complete medium containing fluorosulfonic acid-L-tyrosine (100 mM, 25 μL) was added to each bottle, and the culture was continued at 37°C, 5% CO2 for 48 h to express SLC7A5 membrane protein containing FSY modification.

[0093] The remaining FSY-modified SLC38A1, SLC38A2, SLC1A5, etc. membrane proteins were expressed by transfection in HEK293T cells, and the method was the same as above.

[0094] 5. Addition of dynamic allosteric DNA probe 1 The HEK293T cells expressing SLC7A5, SLC1A5, SLC38A1, SLC38A2 membrane proteins containing FSY modification were washed twice with pre-cooled PBS (pH 7.4) to completely remove the residual medium on the cell surface.

[0095] The dynamic allosteric DNA probe 1 (2.5 μM, 2500 μL) corresponding to different membrane proteins was added to each bottle, in which the tag chain S1 (the sequence information of the specific tag chain of different membrane proteins is shown in SEQ ID NO: 1, SEQ ID NO. 7-9) in the DNA probe 1 corresponded to the membrane protein target one by one, and the incubation was carried out at room temperature for 30 min in the dark; the solution was discarded and washed once with PBS.

[0096] The DNA sequence information used is as follows, and the S1 chain is purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0097] S1 strand as shown in SEQ ID NO. 1: which is a specific tag strand of SLC7A5 membrane protein 5'-TCTTCTAACCTCTCACTCGTCTACACAGCAAATCCGATATCAGAACCGTCAAACCCCTTAAGTCCTCCGCAAACCTTATC-Cy3-3'; S1 strand as shown in SEQ ID NO. 7: which is a specific tag strand of SLC1A5 membrane protein 5'-GCCACGTAGGCACAATTTTTACATCCTCAACCGCTATAGTCAGAACCGTCAAACCCCTTAAGTCCTCCGCAAACCTTATC-Cy3-3'; S1 strand as shown in SEQ ID NO. 8: which is a specific tag strand of SLC38A1 membrane protein 5'-AGAATGTATTATCTAGTCACTCGCCTCCCTACGTAGCTCTCAGAACCGTCAAACCCCTTAAGTCCTCCGCAAACCTTATC-Cy3-3'; S1 strand as shown in SEQ ID NO. 9: which is a specific tag strand of SLC38A2 membrane protein 5'-ACGCTAGTAGTCACAAATCCCTGGAATCACGTCATATGAACAGAACCGTCAAACCCCTTAAGTCCTCCGCAAACCTTATC-Cy3-3'。

[0098] 6. Preparation of covalent DNA probe 1 magnetic bead film Cell membranes containing dynamic allosteric DNA probe 1 obtained in step 5 were extracted using a cell membrane protein extraction kit. According to the experimental purpose, four (N≥1) cell membranes were mixed in this experiment (260 nm absorbance quantification to ensure the same content of DNA probe 1).

[0099] Take 1 μm carboxyl magnetic beads (carboxyl content is 2400 nmol / mg, 10 mg / mL) 200 uL, that is, 2 mg / mL. Wash with 100 mM MEST (pH=6.0) buffer for 2 times respectively, separate with magnetic stand, add 200 uL of freshly prepared 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 100 mM) and N-hydroxysuccinimide (NHS, 100 mM) to the removed carboxyl magnetic beads, both EDC and NHS are prepared with 100 mM MEST (pH=6.0) buffer and used immediately, react for 20 min on a rotary shaker for activation.

[0100] After incubation of the cell membrane components extracted from each bottle with EDC / NHS-activated carboxyl magnetic beads 2 mg / mL (particle size 1 μm, carboxyl density 2400 nmol / mg) on a rotary shaker at room temperature for 3 h, the magnetic bead membrane was separated by a magnetic stand, the supernatant buffer was discarded, and PBST buffer (PBS, 0.1% Tween 20, 1% BSA) was added for 1 h of reaction to block the unreacted active carboxyl groups on the surface of the magnetic beads, thereby preparing a high-purity magnetic bead membrane covalently linked with DNA probe 1. To the prepared magnetic bead membrane covalently linked with DNA probe 1, 1 mL of a storage solution (PBST+1% BSA+0.1% PC300) was added, and the structure system was stored at 4°C for standby.

[0101] The present application constructs a magnetic bead membrane structure covalently linked with DNA probe 1 as shown in Figure 5 .

[0102] After the carboxyl magnetic beads are activated by EDC / NHS, the cell membrane-coated magnetic beads are separated by a magnetic stand after reaction with the cell membrane component solution. The allosteric DNA probe 1 is composed of S1 chain and S2 chain, which realizes covalent coupling with the target membrane protein by SuFEx click chemistry reaction of the modified polypeptide segment (aa) on the S2 chain with FSY. The single membrane protein containing FSY modification is prepared by genetic code expansion technology, and the single magnetic bead membrane structure covalently linked with DNA probe 1 is prepared, as shown in Figure 5 A. By analogy, different magnetic bead membrane structure systems covalently linked with DNA probe 1 can be prepared by preparing different membrane proteins containing FSY modification through genetic code expansion technology, as shown in Figure 5 B. .

[0103] Each membrane protein is designed to have a one-to-one corresponding tag chain S1. Different magnetic bead membranes prepared based on DNA configuration can be resuspended in a solution of allosteric DNA probe 2 containing a single active compound, and the membrane protein target of the active compound can be screened.

[0104] 7. Add dynamic allosteric DNA probe 2: subsequently, add dynamic allosteric DNA probe 2 (5 μM, 2500 μL, solvent PBS) containing inhibitor JPH203 (Aladdin reagent) to the magnetic bead membrane covalently modified with DNA probe 1, incubate at room temperature for 30 min, separate the magnetic bead membrane by a magnetic stand, and wash once with PBS. Add RNase H (RNase H 20 μL, Reaction Buffer (10X) 200 μL, PBS 1780 μL) solution, and incubate at room temperature for 30 min.

[0105] If the candidate compound interacts with a certain membrane target, it will trigger the dynamic conformation of the DNA probe, release the S1 chain encoding the membrane protein, and then use the magnetic frame to separate the magnetic bead membrane again to collect the supernatant. Otherwise, the DNA will not trigger dynamic conformation, and false positive signals caused by random touch of dynamic conformational DNA probe 2 are avoided. The construction process of DNA conformation-based magnetic bead membrane for active compound membrane protein target discovery is shown in Figure 6 , which shows the basic principle of membrane protein target discovery through DNA conformation effect.

[0106] 8. Gel imaging: The collected supernatant was subjected to 15% polyacrylamide gel electrophoresis (S1 as a control). The electrophoresis conditions were 120V electrophoresis for 120min, followed by SYBR Green I nucleic acid dye (Beijing Solabio Technology Co., Ltd.) staining for 30min in the dark, and imaging was performed using a Bio-Rad imaging system.

[0107] The polyacrylamide gel electrophoresis imaging results are shown in Figure 7 . As can be seen from the figure, the addition of dynamic conformational DNA probe 2 to the magnetic bead membrane structure system constructed based on the DNA conformation strategy can displace the tag chain S1 of the drug JPH-203 action protein target (magnetic bead membrane corresponding target appears band), and the specific tag chain S1 of SLC7A5 membrane protein (Cy3-S1) is used as a reference.

[0108] 9. PCR amplification, sequencing and analysis: The corresponding band in the gel was cut using a clean scalpel blade, and the DNA in the gel strip was recovered and purified by EZ-10 column DNA PAGE gel recovery kit (Shanghai Genechem Co., Ltd.). The recovered DNA was amplified with the corresponding primers (sequences shown in SEQ ID NO: 10-17), and PCR amplification reaction was performed using polymerase 2 × Phanta Max Master Mix, and the reaction system was as follows: 4μL of recovered DNA sample, 0.8μL of upstream and downstream primers (10μM), 5μL of 2 × Phanta Max Master Mix, 0.2μL of DEPC H2O; The amplification reaction program is as follows: Pre-denaturation, 95℃ 5min; denaturation, 95℃ 15sec; annealing, 52℃, 15sec; extension, 72℃, 30sec; repeat steps 2-4, 45 cycles; complete extension at 72℃ for 5min. The amplified product was used for Sanger sequencing.

[0109] The sequencing results were compared, and the drug action target was determined by the membrane protein tag chain.

[0110] The sequences of the amplification primers used are as follows (SEQ ID NO. 10-17), and all the primer sequences are purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0111] SEQ ID NO. 10: SLC7A5-F: 5'-TCTTCTAACCTCTCACTCGTCT-3'; SEQ ID NO. 11: SLC7A5-R: 5'-GATAAGGTTTGCGGAGGACTTAA-3'; SEQ ID NO. 12: SLC1A5-F: 5'-CCACGTAGGCACAATTTTTACA-3'; SEQ ID NO. 13: SLC1A5-R: 5'-GATAAGGTTTGCGGAGGACTTAA-3'; SEQ ID NO. 14: SLC38A1-F: 5'-TGTATTATCTAGTCACTCGCCTC-3'; SEQ ID NO. 15: SLC38A1-R: 5'-GATAAGGTTTGCGGAGGACTTAA-3'; SEQ ID NO. 16: SLC38A2-F: 5'-ACGCTAGTAGTCACAAATCCC-3'; SEQ ID NO. 17: SLC38A2-R: 5'-GATAAGGTTTGCGGAGGACTTAA-3'.

[0112] The Sanger sequencing results are as follows Figure 8 、 Figure 9 、 Figure 10 、 Figure 11 .

[0113] The sequencing ab1 sequence of SLC7A5 shows: TCTTCTAACCTCTCACTCGTCTACACAGCAAATCCGATATCAGAACCGTCAAACCCCTTAAGTCCTCCGCAAACCTTATC, which is consistent with the tag chain S1 corresponding to the SLC7A5 membrane protein. The sequencing results of SLC1A5, SLC38A1, and SLC38A2 membrane proteins are poor compared with the reference tag chain alignment results.

[0114] By Figure 7 , Figures 8-11 The specific target point of the inhibitor JPH203 was verified and found to be SLC7A5, which is consistent with the known (SLC7A5(LAT1), DOI: 10.1186 / s13046-018-0907-z). It is shown that the magnetic bead film based on DNA configuration can effectively find and identify the membrane protein target point information of active compounds, and the feasibility of the method is verified.

[0115] The magnetic bead film structure constructed based on the DNA conformation strategy effectively maintains the natural conformation of the membrane protein, and realizes the efficient capture and purification of the target drug by engineering modification of the in-situ membrane protein of the living cell and the action of the magnetic field. The technology not only breaks through the applicable limitations of traditional screening methods for membrane protein targets in the technical aspect, but also realizes the accurate tracing and identification of the DNA tag chain sequence of the target (active compound) by relying on the high specificity of coding and recognition.

[0116] As described above, although the present application has been shown and described with reference to specific preferred embodiments, it is to be understood that such is by way of illustration and not of limitation. Various changes and modifications can be made therein without departing from the spirit and scope of the application as defined in the appended claims.

Claims

1. A method for preparing a magnetic bead membrane based on DNA conformation, characterized in that, Includes the following steps: (1) Preparation of DNA allosteric probe: The S2 chain coupled with the membrane protein ligand and the tag chain S1 chain were mixed in an equimolar ratio and subjected to a thermal annealing process to form allosteric DNA probe 1. (2) In situ labeling of live cell membrane proteins: The non-natural amino acid fluorosulfonic acid-L-tyrosine FSY is introduced into the target membrane protein by genetic code expansion technology GCE, and the conformational DNA probe 1 is covalently anchored to the surface of the membrane protein by hexavalent sulfur-fluorine exchange reaction SuFEx, so as to achieve in situ controllable labeling of live cell membrane proteins. (3) Preparation of covalent DNA probe 1 magnetic bead membrane: Extract cell membrane containing conformational DNA probe 1; activate carboxyl magnetic beads in EDC / NHS buffer at pH 5.0-6.0 for 15-30 min; mix the activated carboxyl magnetic beads with the extracted cell membrane components and incubate for 2-4 h; remove unbound free membrane fragments by magnetic separation to obtain high-purity DNA conformation-based magnetic bead membrane.

2. The preparation method according to claim 1, characterized in that, In step (1), the tag chain S1 is selected from any sequence of SEQ ID NO.1 and SEQ ID NO.7-9; The S1 strand shown in SEQ ID NO.1: It serves as a specific tag strand for the SLC7A5 membrane protein; The S1 strand shown in SEQ ID NO.7: It serves as a specific tag strand for the SLC1A5 membrane protein; The S1 strand shown in SEQ ID NO.8: It serves as a specific tag strand for the SLC38A1 membrane protein; The S1 strand shown in SEQ ID NO.9: it serves as a specific tag strand for the SLC38A2 membrane protein; The S2 chain coupled with the membrane protein ligand is a DBCO-S2 chain, with a DBCO group modified at its 5' end, as shown in SEQ ID NO.

3.

3. The preparation method according to claim 1, characterized in that, In step (1), the heat annealing procedure is: 95℃ for 5 min; 4℃ for 30 min.

4. The preparation method according to claim 1, characterized in that, In step (2), the allosteric DNA probe 1 undergoes a SuFEx click chemical reaction with FSY through the polypeptide chain aa modified on its S2 chain. The fluorosulfate group of FSY reacts with the adjacent nucleophilic residues on the polypeptide chain aa to form a covalent link, thereby achieving a stable anchoring of the probe on the surface of the membrane protein.

5. The preparation method according to claim 1, characterized in that, In step (3), the core material of the carboxyl magnetic beads is polystyrene microspheres with a particle size of 1~5μm and a surface modified with carboxyl groups, and the carboxyl content is 2400nmol / mg.

6. The preparation method according to claim 1, characterized in that, In step (3), a cell membrane containing the conformational DNA probe 1 is extracted using a cell membrane protein extraction kit.

7. The application of a DNA-based magnetic bead membrane prepared by the method described in any one of claims 1-6 in the screening of membrane protein targets and the discovery of active compounds.

8. A method for screening membrane protein targets based on the preparation method of the magnetic bead membrane according to any one of claims 1-6, characterized in that, Includes the following steps: (1) Preparation of DNA allosteric probes: The S2 chain coupled with the membrane protein ligand is mixed with the tag chain S1 chain of different membrane proteins in an equimolar ratio and then subjected to a heat annealing process to form allosteric DNA probe 1 corresponding to different membrane proteins; the S3 chain and S4 chain coupled with the drug are mixed in an equimolar ratio and then subjected to a heat annealing process to form allosteric DNA probe 2. (2) In situ labeling of live cell membrane proteins: The non-natural amino acid fluorosulfonic acid-L-tyrosine FSY is introduced into the target membrane protein by genetic code expansion technology GCE, and the conformational DNA probe 1 is covalently anchored to the surface of the membrane protein by hexavalent sulfur-fluorine exchange reaction SuFEx, so as to achieve in situ controllable labeling of live cell membrane proteins. (3) Preparation of covalent DNA probe 1 magnetic bead membrane: cell membranes containing different allosteric DNA probe 1 corresponding to different membrane proteins were extracted respectively; carboxyl magnetic beads were activated in EDC / NHS buffer at pH 5.0~6.0 for 15~30 min; the activated carboxyl magnetic beads were mixed with the extracted cell membrane components and incubated for 2~4 h; unbound free membrane sheets were removed by magnetic separation to obtain covalent DNA probe 1 magnetic bead membrane; (4) Add dynamic allosteric DNA probe 2: Add dynamic allosteric DNA probe 2 containing a single active drug to the magnetic bead membrane covalently modified with DNA probe 1. After co-incubation, remove the unbound probe 2 by magnetic separation, add RNase to trigger probe allosteric change, and release the tag encoding the membrane protein target by utilizing the allosteric effect between allosteric DNA probe 1 and probe 2 and the magnetic field. The supernatant was collected and PCR amplification and sequencing were performed using specific primers compatible with high-throughput sequencing to identify the membrane protein targets of the active compound.

9. The screening method according to claim 8, characterized in that, In step (1), The nucleotide sequence of the S3 chain is shown in SEQ ID NO.5; The nucleotide sequence of the S4 chain is shown in SEQ ID NO. 6; The heat annealing procedure is as follows: 95℃ for 5 min; 4℃ for 30 min.

10. The screening method according to claim 8, characterized in that, In step (1), the DNA base complementary pairing length of the S2 chain coupled with the membrane protein ligand and the tag chain S1 chain is less than the DNA base complementary pairing length of the S2 and S3 chains.

Images