Electrochemical biosensor based on TdT-Cas12a reaction system and HaeIII enzyme and Alzheimer's biomarker detection method

Abstract

The invention discloses an electrochemical biosensor based on a TdT-Cas12a reaction system and a HaeIII enzyme and an Alzheimer's biomarker detection method.The electrochemical biosensor comprises a TdT reaction system and a Cas12a reaction system, the TdT reaction system comprises a TdT enzyme, a TdT buffer solution, deoxyadenine triphosphate (dATP) and a marker nucleic acid conversion product, and a TdT extension product is obtained through reaction; the Cas12a reaction system comprises a reaction buffer solution, Cas12a protein, crRNA and a TdT extension product, and a Cas12a system product is obtained after incubation; the construction method of the electrochemical biosensor comprises the following steps: combining a biological probe P on the surface of a gold electrode to finish electrode surface modification; and adding a Cas12a system product to the surface of the gold electrode, and continuing incubation. The electrochemical biosensor has excellent sensitivity and specificity, can significantly improve the detection sensitivity of AD related proteins in NDE, can be used for analysis of human serum samples, and is high in recovery rate.

Description

Technical Field

[0001] This invention relates to the field of electrochemical biosensor technology, specifically to an electrochemical biosensor based on the TdT-Cas12a reaction system and HaeⅢ enzyme, and a method for detecting Alzheimer's biomarkers. Background Technology

[0002] Alzheimer's disease (AD), a progressive degenerative disease of the central nervous system, is the leading cause of dementia and has become the fifth leading cause of death worldwide. It is important to note that there is currently no cure for AD; treatment can only manage the symptoms with medication.

[0003] The currently widely accepted characteristic pathological changes in Alzheimer's disease (AD) are senile plaques formed by the aggregation of β-amyloid protein (Aβ) outside nerve cells and neurofibrillary tangles formed by the aggregation of hyperphosphorylated tau protein inside nerve cells. Neuron-derived exosomes (NDEs) in serum, which can specifically reflect pathobiological changes in the brain, are considered an emerging and attractive blood biomarker for neurological diseases.

[0004] Currently, almost all methods for detecting NDE-Aβ42 employ enzyme-linked immunosorbent assay (ELISA). For example, the Goetzl and Kapogiannis team first extracted total exosomes from plasma using chemisorption, then further extracted NDE using immunoprecipitation and antibodies against human neural cell adhesion molecule (NCAM) or L1 cell adhesion molecule (L1CAM), and used ELISA to detect the AD-related protein levels of NDE. However, only a portion of NDE crosses the blood-brain barrier, arachnoid granules, glycoprotein systems, and vascular systems into the peripheral fluid system, resulting in weak brain penetrance. Subsequently, it is diluted in the blood, leading to low levels of NDE-Aβ42 in the blood of early-stage AD patients, requiring high detection sensitivity. However, ELISA suffers from long turnaround times, complex external reagents, and insufficient sensitivity, limiting its further application. Summary of the Invention

[0005] The purpose of this invention is to provide an electrochemical biosensor based on the TdT-Cas12a reaction system and HaeIII enzyme, and a method for detecting Alzheimer's biomarkers, in order to solve the problems mentioned in the background art.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] An electrochemical biosensor based on the TdT-Cas12a reaction system and HaeIII enzyme includes a TdT reaction system and a Cas12a reaction system. The TdT reaction system includes TdT enzyme, TdT buffer, deoxyadenine triphosphate (dATP), and biomarker nucleic acid conversion product. The reaction yields a TdT extension product. The preparation method of the biomarker nucleic acid conversion product is as follows: Alzheimer's biomarker is captured by enriching magnetic beads modified with biomarker primary antibody. Then, a gold nanocomplex containing biomarker secondary antibody and probe group (rdsDNA) is added. Finally, HaeIII enzyme is added, and the reaction is carried out. After removing the magnetic beads, the biomarker nucleic acid conversion product is obtained.

[0008] The Cas12a reaction system includes a reaction buffer, Cas12a protein, crRNA and TdT extension product, and the Cas12a system product is obtained after incubation.

[0009] The electrochemical biosensor is constructed by: binding a biological probe P to the surface of a gold electrode to modify the electrode surface; adding the Cas12a system product to the surface of the gold electrode and continuing incubation, which is the electrochemical biosensor used to detect Alzheimer's biomarkers.

[0010] As a further aspect of the present invention, the Alzheimer's biomarker is specifically the biomarker Aβ42.

[0012] As a further embodiment of the present invention, the sequence of the biological probe P is: Biotin-TGGAGCTTTTTTTTTTTTACGCCATCAGCTCCA-Ferrocene;

[0013] The crRNA sequence is: UAAUUUCUACUAAGUGUAGAUU ...

[0014] As a further embodiment of the present invention, the probe set (rdsDNA) includes:

[0015] Probe 1, its sequence is: Biotin-ATGCGGCCATGATGGAATGACGGT;

[0016] Probe 2, its sequence is: ACCGTCATTCCATCATGGCCGCAT.

[0017] As a further aspect of the present invention, the preparation method of the biomarker nucleic acid transformation product specifically includes the following steps:

[0018] Add 0.1% Triton's reagent to neuronal exosomes and incubate in a 37°C water bath for 10 min to completely lyse them and release the Alzheimer's biomarker (Aβ42);

[0019] Carboxylated magnetic beads (MNPs) were activated using 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS), and a marker primary antibody was added to couple the marker primary antibody to the magnetic beads (MNPs). BSA blocking solution was then added to block the magnetic beads (MNPs-Ab1) modified with the marker primary antibody.

[0020] Alzheimer's biomarker (Aβ42) released from solution was captured using magnetic beads modified with a primary antibody (MNPs-Ab1), and then magnetically separated. The separated mixture of magnetic beads was then washed.

[0021] At 37°C, a gold nanocomplex containing a marker secondary antibody and a probe group (rdsDNA) was added to a mixture of magnetic beads. After the reaction, the supernatant was removed by magnetic separation to obtain a magnetic nanomaterial complex.

[0022] Finally, HaeIII enzyme was added to the obtained magnetic nanomaterial composite. HaeIII enzyme cut the DNA sequence in the composite. The supernatant was obtained by centrifugation, which is the marker nucleic acid conversion product.

[0023] As a further aspect of the present invention, the method for preparing the gold nanocomplex combining the marker secondary antibody and the probe set (rdsDNA) is as follows:

[0024] Add 50 mL of ultrapure water and 0.5 mL of 0.05 M HAuCl4·3H2O solution to a 100 mL conical flask; heat the mixture until boiling while stirring continuously; then, while stirring vigorously at the boiling temperature, quickly add 0.75 mL of 1% sodium citrate solution to the above solution; when the solution turns wine red, heat the solution and stir for another 15 min to obtain the AuNPs solution.

[0025] Take 1 mL of AuNPs solution, add 10 μL of 0.1 M K2CO3 and 4 μL of 2 μg / mL secondary antibody marker, incubate at 37 °C for 1 h, then add 5 μL of 1 mg / mL streptavidin, incubate at 37 °C for 1 h, and the resulting nano-gold secondary antibody complex (Ab2-AuNPs).

[0026] Probe 1 and Probe 2 were first reacted at 90℃ for 5 min, and then at 70℃ for 30 min to form a probe set (rdsDNA), wherein the concentration of Probe 1 and Probe 2 was 1 uM.

[0027] Finally, the probe group (rdsDNA) was added to the gold nanoparticle secondary antibody complex (Ab2-AuNPs) and incubated at 37°C for 1 h to obtain the gold nanoparticle complex (Ab2-AuNPs-rdsDNA).

[0028] As a further aspect of the present invention, the specific process of binding the biological probe P to the gold electrode surface is as follows:

[0029] The surface of the gold electrode was cleaned and activated; a mixed solution containing streptavidin, ruthenium pyridine and chitosan solution was added to the surface of the gold electrode and incubated at 37°C.

[0030] The non-specific active sites of the gold electrode were then blocked with BSA blocking solution at 37°C. The surface of the gold electrode was then repeatedly rinsed with ultrapure water and dried with nitrogen.

[0031] Next, biotin-modified bioprobe P was added. Through the specific binding of biotin and streptavidin, bioprobe P was bound to the surface of the gold electrode. Then, the surface of the gold electrode was repeatedly rinsed with ultrapure water and dried with nitrogen to complete the surface modification of the electrode.

[0032] As a further aspect of the present invention, the electrochemical detection conditions of the electrochemical biosensor are as follows:

[0033] At 5mM [Fe(CN)6] 3- / 4- Cyclic voltammetry scans were performed in the solution from -0.2V to 0.6V at a scan rate of 50mV / s.

[0034] In 1mM [Fe(CN)6] 3- / 4- Electrochemical impedance spectroscopy was performed in the solution at a frequency of 0.1 Hz to 10 kHz at 0.2 V.

[0035] The electrochemiluminescence signal was detected in a solution containing 0.1 M PBS, 10 mM K2S2O8, and pH 7.4. The scan potential range was -1.6 V to 0 V, and the voltage was set to 600 V.

[0036] The method for detecting Alzheimer's biomarkers includes the following steps:

[0037] S1. Prepare Alzheimer's biomarker solutions of various standard concentrations;

[0038] S2, Alzheimer's biomarker solution was enriched with magnetic beads and cleaved by HaeIII to prepare the corresponding biomarker nucleic acid conversion products;

[0039] S3. The TdT extended product is prepared by reacting the biomarker nucleic acid conversion product with the TdT reaction system.

[0040] S4. The TdT extension product was reacted with the Cas12a reaction system to prepare the Cas12a system product.

[0041] S5. The probe P bound to the gold electrode was cut by the product of the Cas12a system to obtain an electrochemical biosensor for detecting Alzheimer’s biomarkers. Electrochemical detection was performed, and a standard curve was constructed that correlated the electrochemical signal with the concentration of Alzheimer’s biomarkers.

[0042] S6. Extract the sample containing the unknown concentration of Alzheimer's biomarker and perform electrochemiluminescence detection using the same processing method as steps S2-S5. Substitute the detected electrochemiluminescence signal into the standard curve to obtain the concentration of Alzheimer's biomarker in the sample.

[0043] Compared with the prior art, the beneficial effects of the present invention are:

[0044] 1. This invention first enriches the biomarker Aβ42 by modifying magnetic beads with a primary antibody. Then, it binds a gold nanoparticle complex containing a secondary antibody and multiple probe sets (rdsDNA) to the Aβ42. The probe sets (rdsDNA) are cleaved by HaeIII enzyme, converting the target of detection from biomarker Aβ42 into the cleaved double-stranded nucleic acid (i.e., biomarker nucleic acid conversion product). The biomarker nucleic acid conversion product is then reacted in a TdT reaction system to prepare a TdT extension product. The TdT extension product is then reacted in a Cas12a reaction system to prepare a Cas12a system product. The Cas12a system product is used to cleave the probe P bound to the gold electrode. Finally, the concentration of Alzheimer's biomarker can be detected by electrochemical treatment.

[0045] 2. The single gold nanocomplex in the invention binds multiple probe sets (rdsDNA). When it binds to the marker Aβ42 and is cleaved by HaeIII enzyme, it can form multiple marker nucleic acid conversion products, which play a cascade amplification role. The marker nucleic acid conversion products generate Cas12a system products through the TdT-Cas12a reaction system. The Cas12a system products cleave the probe P bound to the gold electrode, which can play a cascade amplification role again, thereby significantly improving the detection sensitivity of AD-related proteins in NDE.

[0046] 3. The electrochemical biosensor of the present invention exhibits excellent sensitivity and specificity, establishing a good linear calibration curve in the concentration range of 0.000005 ng / ml to 50 ng / ml, with R² = 0.9943 and a detection limit of 2.793 fg / mL. The method of the present invention has good specificity for the detection of Aβ42 and can be used for the analysis of human serum samples with high recovery rate. Attached Figure Description

[0047] Figure 1 This is a schematic diagram illustrating the principle of Alzheimer's biomarker detection in this invention; Figure 2 This is a diagram showing the coupling results between the magnetic beads and the marker primary antibody in this invention; Figure 3 This is a diagram showing the preparation results of the gold nanocomplex containing the marker secondary antibody and the probe set (rdsDNA) in this invention; Figure 4 This is a graph showing the results of capturing the marker Aβ42 in this invention; Figure 5 This is a diagram showing the verification results of the TdT enzyme extension activity in this invention; Figure 6 This is a diagram showing the verification results of the TdT-Cas12a reaction system under fluorescence conditions in this invention; Figure 7 The images show the CV (A), EIS (B), and ECL (C) results of the sensor detecting marker Aβ42 in this invention. Figure 8 The graph shows the detection results of the electrochemiluminescence sensor in this invention for different concentrations of Aβ42. Figure 9 This is a graph showing the relationship between the ECL intensity and the logarithm of the target Aβ42 in this invention; Figure 10 The specific detection results of the electrochemiluminescence biosensor in this invention are shown in the figure. Detailed Implementation

[0057] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0058] 1. Reagents and Instruments

[0059] Terminal deoxynucleotidyl transferase (TdT enzyme), restriction endonuclease HaeIII and Lba Cas12a protein was purchased from New England Biolabs (Beijing, China). K3Fe[CN]6 and K4Fe[CN]2 were supplied by Shanghai Guoyao Chemical Reagent Co., Ltd., China. Gold electrodes, platinum wire electrodes, and reference electrodes were purchased from Shanghai Chenhua Instrument Co., Ltd., and chloroauric acid (HAuCl4·3H2O) and tetramethylethylenediamine (TEMED) were purchased from Shanghai Aladdin Reagent Co., Ltd. N,N'-methylenebisacrylamide (Acr-Bis), ammonium persulfate (APS), bovine serum albumin (BSA), 20×PBS (pH=7.2-7.6), DNA marker (25-500bp), 5×TBE buffer (pH=8.0), chitosan, deoxyadenine triphosphate (dATP), trisodium citrate, and streptavidin (SAV) were purchased from Shanghai Sangon Biotech Co., Ltd., China. SYBR Green I (10000×) nucleic acid dye and 6×DNA loading buffer were purchased from Beijing Solarbio Science & Technology Co., Ltd. The magnetic beads were purchased from Jiangsu Xianfeng Nanomaterials Technology Co., Ltd. The primary and secondary antibodies were both purchased from Anhui Mesaite Biotechnology Co., Ltd.

[0060] The oligonucleotides and biological probe P purified by HPLC were synthesized by Shanghai Sangon Biotech Co., Ltd., and the RNA probe (crRNA) was purchased from General Biotech Co., Ltd. Specific information is shown in Table 1.

[0061] Table 1 Sequence Information

[0062]

[0063] The experimental equipment is shown in Table 2:

[0064] Table 2 Main Experimental Instruments

[0065]

[0066] 2. Release of neuronal exosomes containing the marker Aβ42:

[0067] Relatively pure neuronal exosomes were obtained by centrifuging the culture supernatants of SH-SY5Y and HEK293T cells at different speeds. Then, 0.1% Triton's reagent was added to the neuronal exosomes, and they were incubated in a 37°C constant temperature water bath for 10 min to completely lyse them and release the marker Aβ42.

[0068] 3. Preparation and validation of gold nanoparticle complex (Ab2-AuNP s-rdsDNA) combining marker secondary antibody and probe kit (rdsDNA):

[0069] Add 50 mL of ultrapure water and 0.5 mL of 0.05 M HAuCl4·3H2O solution to a 100 mL conical flask; heat the mixture until boiling while stirring continuously. Then, while stirring vigorously at the boiling temperature, quickly add 0.75 mL of 1% sodium citrate solution to the above solution; when the solution turns wine red, heat the solution and stir for another 15 min to obtain the AuNPs solution; finally, cool the solution to room temperature and store it at 4 °C for future use.

[0070] Take 1 mL of AuNPs solution, add 10 μL of 0.1 M K2CO3 and 4 μL of 2 μg / mL secondary antibody marker, incubate at 37°C for 1 h, then add 5 μL of 1 mg / mL streptavidin, incubate at 37°C for 1 h, and the resulting nano-gold secondary antibody complex (Ab2-AuNPs) is obtained.

[0071] Probe 1 and Probe 2 were reacted at 90℃ for 5 min and then at 70℃ for 30 min to form a probe set (rdsDNA), wherein the concentration of Probe 1 and Probe 2 was 1 uM.

[0072] Finally, the probe group (rdsDNA) was added to the gold nanoparticle secondary antibody complex (Ab2-AuNPs) and incubated at 37°C for 1 h to obtain the gold nanoparticle complex (Ab2-AuNPs-rdsDNA).

[0073] The results are as follows Figure 3 As shown in Figure A, the particle size of AuNPs is 12.02 nm. Figure 3 As shown in Figure B, the particle size after adding the marker secondary antibody is 15.57 nm. Figure 3 As shown in Figure C, the particle size after adding streptavidin and the probe set (rdsDNA) was 23.73 nm. These results indicate that AuNPs were successfully conjugated with the marker secondary antibody and successfully ligated with the probe set (rdsDNA).

[0074] 4. Preparation and validation of primary antibodies for magnetic bead coupling markers:

[0075] Take a clean 1.5 ml centrifuge tube, add 10 μL of magnetic beads, 500 μL of BB solution at pH 7.4, and then add 5 μL of EDC and NHS for activation. After incubation for 30 min, perform magnetic separation, remove the supernatant, add 500 μL of BB solution at pH 7.4 for reconstitution, add 10 μL of a 10 μg / ml marker primary antibody for conjugation for 1 h, which is MNPs-Ab1. Then, add 50 μL of 10% BSA for blocking for 1 h, magnetically separate to remove the supernatant, and resuspend in 50 μL of resuspension solution D. The BB solution is prepared by mixing 0.2 M / L boric acid solution and 0.05 M / L borax solution, and the resuspension solution D is prepared by 0.5% PVP K40, 15% sucrose, and 0.5% C-Na. The results are as follows. Figure 2 As shown in Figure A, the magnetic beads have a particle size of 154 nm. Figure 2 As shown in Figure B, the particle size of the magnetic beads after coupling with the primary antibody marker is 183.34 nm, indicating that the magnetic beads and the primary antibody marker were successfully coupled.

[0076] 5. Enrichment, capture, and validation of the biomarker Aβ42:

[0077] After successful conjugation of magnetic beads with the primary antibody against the biomarker, a solution of neuronal exosomes releasing the biomarker Aβ42 was added to the tube and incubated at 37°C for 1 hour. The released biomarker Aβ42 was captured using MNPs-Ab1. Then, the AuNPs complex was added to the tube and incubated at 37°C for 1 hour to recognize and immobilize the AuNPs complex (Ab2-AuNPs-rdsDNA). The supernatant was removed by magnetic separation to obtain the magnetic nanomaterial complex. Figure 4 As shown, the particle size of the obtained magnetic nanomaterial composite is 241.89 nm, indicating that the magnetic beads successfully enriched the marker Aβ42 in neuronal exosomes.

[0078] 6. Preparation of biomarker nucleic acid transformation products:

[0079] HaeIII enzyme was added to the obtained magnetic nanomaterial composite to cut the DNA sequence. After centrifugation to remove the magnetic beads, the marker nucleic acid conversion product was obtained.

[0080] 7. Preparation of TdT extended products:

[0081] The biomarker nucleic acid transformation product was used as the extension template for the TdT reaction system. The reaction was first carried out at 37℃ for 1 h, and then at 80℃ for 10 min. The TdT reaction system included 5 μL of 10×TdT buffer, 2 μL of 10 mM dATP and 0.5 μL of 8 U / μL TdT enzyme. The TdT extension product was obtained by 12% polyacrylamide electrophoresis.

[0082] 8. Preparation of Cas12a system products: Add the Cas12a reaction system to the TdT extension product and incubate at 37°C for 30 min. The Cas12a reaction system includes 1 μL of 10×NEB buffer 2.1, 1 μL of Cas12a protein at a concentration of 1 μM, and 0.5 μL of crRNA at a concentration of 2.5 μM.

[0083] 9. Please refer to Figure 1 Taking the biomarker Aβ42 as the target biomarker as an example, the specific construction method of the electrochemical biosensor based on the TdT-Cas12a reaction system and HaeIII enzyme is as follows:

[0084] Using a gold electrode (GE) as the working electrode, the electrode surface is cleaned and activated;

[0085] 10 μL of a solution containing 2 μL of streptavidin (SAV) at a concentration of 1 mg / mL and 2 μL of ruthenium pyridine (Ru(bpy)3) was added. 2+ A mixed solution [dispersed in 0.5% (w / w) chitosan solution] and 6 μL of chitosan solution were added to the surface of the gold electrode (GE) and incubated at 37°C for 60 min.

[0086] The non-specific active sites were then blocked with 1% BSA blocking solution at 37°C for 1 hour. Then, the surface of the gold electrode (GE) was repeatedly rinsed with ultrapure water and dried with nitrogen.

[0087] Next, 5 μL of biotin-modified bioprobe P (Fc-ssDNA) at a concentration of 500 nM was added. Through the specific binding of biotin and streptavidin, bioprobe P (Fc-ssDNA) was bound to the surface of the gold electrode (GE). Then, the surface of the gold electrode (GE) was repeatedly rinsed with ultrapure water and dried with nitrogen to complete the surface modification of the electrode.

[0088] Adding the Cas12a system product to the surface of a gold electrode and incubating at 37°C for 20 min yields an electrochemiluminescent biosensor for detecting target biomarkers.

[0089] Electrochemiluminescence detection was performed using the aforementioned electrochemical biosensor, with the specific electrochemical detection conditions being: 5 mM [Fe(CN)6] 3- / 4- Cyclic voltammetry (CV) scans were performed in the solution at a scan rate of 50 mV / s from -0.2 V to 0.6 V.

[0090] In 1mM [Fe(CN)6] 3- / 4- Electrochemical impedance spectroscopy (EIS) scans were performed in the solution at a frequency of 0.1 Hz to 10 kHz at 0.2 V.

[0091] The electrochemiluminescence signal was detected in a solution of 0.1M PBS, 10mM K2S2O8, pH=7.4; the scanning potential range was -1.6V to 0V, and the voltage was set to 600V.

[0092] 10. Alzheimer's biomarker detection methods include the following steps:

[0093] S1. Prepare Alzheimer's biomarker solutions of various standard concentrations;

[0094] S2, Alzheimer's biomarker solution was enriched with magnetic beads and cleaved by HaeIII to prepare the corresponding biomarker nucleic acid conversion products;

[0095] S3. The TdT extended product is prepared by reacting the biomarker nucleic acid conversion product with the TdT reaction system.

[0096] S4. The TdT extension product was reacted with the Cas12a reaction system to prepare the Cas12a system product.

[0097] S5. The probe P bound to the gold electrode was cut by the product of the Cas12a system to obtain an electrochemical biosensor for detecting Alzheimer’s biomarkers. Electrochemical detection was performed, and a standard curve was constructed that correlated the electrochemical signal with the concentration of Alzheimer’s biomarkers.

[0098] S6. Extract the sample containing the unknown concentration of Alzheimer's biomarker and perform electrochemiluminescence detection using the same processing method as steps S2-S5. Substitute the detected electrochemiluminescence signal into the standard curve to obtain the concentration of Alzheimer's biomarker in the sample.

[0099] The working principle of this invention is as follows: In the presence of the marker Aβ42, the marker Aβ42 is enriched and captured by magnetic beads (MNPs-Ab1) modified with the marker primary antibody, and then combined with a gold nanocomplex (Ab2-AuNPs-rdsDNA) to obtain a magnetic nanomaterial complex. Since the HaeIII enzyme only cleaves specific sites, the corresponding nucleic acid product can be generated by cleaving the relevant sequence (rdsDNA) on the magnetic nanomaterial complex by HaeIII enzyme. The quantitative detection of the marker Aβ42 can be transformed into the quantitative detection of the nucleic acid product, thereby improving the sensitivity of the sensor and the detection efficiency.

[0100] In the TdT-Cas12a reaction system, the extension reaction involving TdT enzyme requires an oligonucleotide consisting of at least three nucleotides as a primer. TdT enzyme can only function after HaeIII enzyme cleaves the relevant sequence (rdsDNA) on the magnetic bead.

[0101] The Cas12a protein, guided by crRNA, cleaves rdsDNA using a PAM sequence. With the aid of the PAM sequence, the trans-cleavage activity of the Cas12a protein is activated, thereby cleaving any surrounding rdsDNA. A TdT-CRISPR / Cas12a integrated system was designed, utilizing the extended A base sequence of TdT and a universal crRNA to activate the non-specific ssDNA cleavage effect of the CRISPR / Cas12a system, significantly improving the detection sensitivity of AD-related proteins in neuronal exosomes (NDEs).

[0102] During the detection process, streptavidin (SAV) and ruthenium pyridine [dispersed in 0.5% (w / w) chitosan solution] were added to the surface of the GE working electrode. Non-specific active sites were blocked with BSA, and the bioprobe P (Fc-ssDNA) was immobilized on the electrode through the interaction of streptavidin (SAV) and biotin. Only in the presence of the marker Aβ42 could the HaeIII enzyme cleave the relevant sequence on the magnetic beads, thereby extending the relevant base sequence of the TdT enzyme and activating the cleavage activity of the Cas12a protein. After being dropped onto the electrode surface, the activated Cas12a protein cleaves the probe P (Fc-ssDNA), resulting in the recovery of the electrochemiluminescence signal. Conversely, in the absence of the target protein (marker Aβ42), the Cas12a protein could not be activated, and when added to the electrode surface, it could not cleave the probe P (Fc-ssDNA), and the electrochemiluminescence signal could not be recovered.

[0103] I. Validation of the TdT-Cas12a reaction system

[0104] (1) Verification of TdT enzyme activity

[0105] After cleaning and assembling the gel preparation equipment and checking for leaks, prepare a 12% PAGE gel. Take a clean 20mL centrifuge tube, add 6mL of 30% N,N'-methylenebisacrylamide (Acr-Bis), 5.9mL of ultrapure water, 3mL of 5×TBE buffer, and 110μL of 10% ammonium persulfate (APS), and vortex to mix. Add 10μL of TEMED, gently invert to mix, and quickly add the gel solution to the assembled gel preparation glass plate. Insert a comb and let it stand until the gel solidifies.

[0106] Pour an appropriate amount of 1×TBE buffer solution into the solidified gel vertical electrophoresis tank. The sample loading groups include a DNA marker (25-500bp), a control group, and an experimental group. The control group does not contain TdT enzyme, while the experimental group does contain TdT enzyme. Both the control and experimental groups require the addition of TdT buffer and dATP. Before loading, add an additional 2μL of 6×DNA loading buffer and 2μL of SYBR Green I (100×) nucleic acid dye, mix, and then load the samples. Set the voltage to 80V and the time to 90min. After completion, observe and save the experimental results using a gel imaging system.

[0107] After Aβ42 was enriched with magnetic beads and digested with HaeIII enzyme, the gel electrophoresis results after adding TdT enzyme are as follows: Figure 5 As shown, lane 1 is the result without TdT enzyme, and lane 2 is the result with TdT enzyme. It can be seen from the figure that nucleic acid can only be extended when TdT enzyme is present.

[0108] (2) Fluorescence verification

[0109] The product of the TdT-Cas12a reaction system was validated using 2 μL of a 5 μM fluorescent reporter probe, and the results are as follows: Figure 6 As shown. The control group was in the absence of TdT enzyme, while the experimental group was in the presence of TdT enzyme. Both the control and experimental groups contained TdT buffer, dATP, H2O, Cas12a, CrRNA, NE B buffer, and a fluorescent reporter probe with the sequence BHQ-TCTCTGAA-FAM. The fluorescent reporter probe contains both a fluorophore and a quencher group. Fluorescence recovery and detection of fluorescence intensity only occur when the probe is cleaved and the two groups physically separate. Therefore, strong fluorescence intensity (experimental group) is only produced when Cas12a exhibits trans-cleavage activity and the probe is cleaved. The control group also produced fluorescence intensity even without protein cleavage, possibly due to the higher concentration of components in the system leading to non-specific cleavage and fluorescence intensity. However, the difference is significant compared to the high-intensity fluorescence of the experimental group, and its impact is negligible.

[0110] II. Validation of Electrochemical Biosensors

[0111] Electrochemical biosensors detect the CV, EIS, and ECL of Aβ42, such as Figure 7As shown, after adding SAV and ruthenium pyridine, the redox peak of curve b decreased, the Ret value increased, and the ECL value increased compared to curve a of the bare electrode, indicating that ruthenium pyridine was successfully modified on the GE surface, which is consistent with the expected results. After adding BSA, the redox peak current value of curve c decreased, the Ret value increased, and the ECL value decreased, indicating that BSA successfully blocked the non-specific active sites on the electrode surface. After adding probe P, the redox peak current value of curve d decreased, the Ret value increased, and the ECL value decreased, indicating that the probe was successfully immobilized on the electrode surface. When the TdT-Cas12a reaction system was added, the redox peak current value of curve e increased, the Ret value decreased, and the ECL value increased, indicating that probe P was cleaved and shortened.

[0112] III. Sensitivity Testing

[0113] Under optimal experimental conditions, Aβ42 concentrations ranging from 0.000005 ng / ml to 50 ng / ml were enriched with magnetic beads, cleaved by HaeIII, extended and activated by a TdT-Cas12a reaction system, and finally cleaved on the electrode surface for measurement, following the steps described above. Measurements were performed under the same conditions as described above. At least three repeated measurements were performed for each group, and the electrochemiluminescence intensity of different concentrations of Aβ42 was recorded to establish a standard curve.

[0114] The detection results of the electrochemiluminescence biosensor constructed in this invention for different concentrations of Aβ42 are as follows: Figure 8 As shown, the Aβ42 concentrations from bottom to top are 0 ng / mL (curve i), 0.000005 ng / mL (curve h), 0.00005 ng / mL (curve g), 0.00001 ng / mL (curve f), 0.001 ng / mL (curve e), 0.05 ng / mL (curve d), 0.1 ng / mL (curve c), 5 ng / mL (curve b), and 50 ng / mL (curve a). With the continuous increase of Aβ42 concentration, the electrochemiluminescence signal of the sensor also continuously increases, showing the same trend. After fitting the logarithm of different Aβ42 concentrations, the results are as follows... Figure 9 As shown, the linear regression equation is Y = 9488.8 + 1240.47lgC Aβ42 (Y represents peak intensity and C) Aβ42 (where R is the concentration of β-amyloid protein) 2 =0.9949.

[0115] IV. Specific Detection

[0116] To evaluate the specificity of this electrochemiluminescence biosensor for β-amyloid protein determination, this embodiment also tested various proteins: group a with bovine serum albumin (BSA), group b with human serum albumin (HSA), group c with both BSA and HSA, group d with both BSA and Aβ42, group e with both HSA and Aβ42, and group f with Aβ42. Under optimal experimental conditions, the assay involved magnetic bead enrichment, HaeIII cleavage, TdT-Cas12a reaction system extension and activation, and finally, electrode surface cleavage measurement. The detection results were determined based on the peak values ​​and compared with the scanning results for β-amyloid protein detection.

[0117] ECL detection results of the electrochemiluminescence biosensor are as follows Figure 10 As shown, only β-amyloid protein (100 pg / mL) could induce a significant electrochemiluminescence signal, while other interfering proteins (10 ng / mL) showed almost no electrochemiluminescence signal, demonstrating the sensor's significant specificity.

Claims

1. An electrochemical biosensor based on the TdT-Cas12a reaction system and HaeIII enzyme, characterized in that, The reaction system includes a TdT reaction system and a Cas12a reaction system. The TdT reaction system includes TdT enzyme, TdT buffer, deoxyadenine triphosphate, and biomarker nucleic acid conversion product. The reaction yields TdT extension product. The preparation method of biomarker nucleic acid conversion product is as follows: Alzheimer's biomarker is captured by enriching magnetic beads modified with biomarker primary antibody. Then, a gold nanoparticle complex containing biomarker secondary antibody and probe group is added. Finally, HaeIII enzyme is added, and the reaction is carried out. After removing the magnetic beads, the biomarker nucleic acid conversion product is obtained. The Cas12a reaction system includes a reaction buffer, Cas12a protein, crRNA and TdT extension product, and the Cas12a system product is obtained after incubation. The construction method of electrochemical biosensors is as follows: The bioprobe P is bound to the surface of the gold electrode to complete the electrode surface modification; Adding the Cas12a system product to the surface of a gold electrode and continuing incubation yields an electrochemical biosensor for detecting Alzheimer's biomarkers.

2. The electrochemical biosensor based on the TdT-Cas12a reaction system and HaeIII enzyme according to claim 1, characterized in that, The specific Alzheimer's biomarker mentioned is biomarker Aβ42.

3. The electrochemical biosensor based on the TdT-Cas12a reaction system and HaeIII enzyme according to claim 1, characterized in that, The sequence of the biological probe P is: Biotin-TGGAGCTTTT TTTTTTTTACGCCATCAGCTCCA-Ferrocene; The crRNA sequence is: UAAUUUCUACUAAGUGUAGAUU ...

4. The electrochemical biosensor based on the TdT-Cas12a reaction system and HaeIII enzyme according to claim 1, characterized in that, The probe set includes: Probe 1, its sequence is: Biotin-ATGCGGCCATGATGGAATGACGGT; Probe 2, its sequence is: ACCGTCATTCCATCATGGCCGCAT.

5. The electrochemical biosensor based on the TdT-Cas12a reaction system and HaeIII enzyme according to claim 1, characterized in that, The preparation method of the biomarker nucleic acid transformation product specifically includes the following steps: Add 0.1% Triton's reagent to neuronal exosomes and incubate in a 37°C water bath for 10 min to completely lyse them and release Alzheimer's biomarkers; Carboxylated magnetic beads were activated using 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide. A primary antibody was added to conjugate the primary antibody to the magnetic beads. BSA blocking solution was then added to block the magnetic beads modified with the primary antibody. Alzheimer's biomarkers released from solution were captured by magnetic beads modified with primary antibodies, and then magnetically separated. The separated mixture of magnetic beads was then washed. At 37°C, a gold nanocomposite containing a marker secondary antibody and a probe group was added to a mixture of magnetic beads. After the reaction, the supernatant was removed by magnetic separation to obtain a magnetic nanomaterial composite. Finally, HaeIII enzyme was added to the obtained magnetic nanomaterial composite. HaeIII enzyme cut the DNA sequence in the composite. The supernatant was obtained by centrifugation, which is the marker nucleic acid conversion product.

6. The electrochemical biosensor based on the TdT-Cas12a reaction system and HaeIII enzyme according to claim 5, characterized in that, The preparation method of the gold nanocomposite combining the marker secondary antibody and the probe group is as follows: Add 50 mL of ultrapure water and 0.5 mL of 0.05 M HAuCl4·3H2O solution to a 100 mL conical flask; heat the mixture until boiling while stirring continuously; then, while stirring vigorously at the boiling temperature, quickly add 0.75 mL of 1% sodium citrate solution to the above solution. When the solution turns wine red, heat the solution and stir for another 15 minutes to obtain the AuNPs solution. Take 1 mL of AuNPs solution, add 10 μL of 0.1 M K2CO3 and 4 μL of 2 μg / mL marker secondary antibody, incubate at 37 °C for 1 h, then add 5 μL of 1 mg / mL streptavidin, incubate at 37 °C for 1 h, and the nano-gold secondary antibody complex is obtained. Probe 1 and Probe 2 were reacted at 90℃ for 5 min and then at 70℃ for 30 min to form a probe group, wherein the concentration of Probe 1 and Probe 2 was 1 μM. Finally, the probe group was added to the gold nanoparticle secondary antibody complex and incubated at 37°C for 1 hour to obtain the gold nanoparticle complex.

7. The electrochemical biosensor based on the TdT-Cas12a reaction system and HaeIII enzyme according to claim 1, characterized in that, The specific process by which the biological probe P binds to the gold electrode surface is as follows: The surface of the gold electrode is cleaned and activated. A mixed solution containing streptavidin, ruthenium pyridine and chitosan solution was added to the surface of the gold electrode and incubated at 37°C. The non-specific active sites of the gold electrode were then blocked with BSA blocking solution at 37°C. The surface of the gold electrode was then repeatedly rinsed with ultrapure water and dried with nitrogen. Next, biotin-modified bioprobe P was added. Through the specific binding of biotin and streptavidin, bioprobe P was bound to the surface of the gold electrode. Then, the surface of the gold electrode was repeatedly rinsed with ultrapure water and dried with nitrogen to complete the surface modification of the electrode.

8. The electrochemical biosensor based on the TdT-Cas12a reaction system and HaeIII enzyme according to claim 1, characterized in that, The electrochemical detection conditions of the electrochemical biosensor are as follows: At 5mM [Fe(CN)6] 3- / 4- Cyclic voltammetry scans were performed in the solution from -0.2V to 0.6V at a scan rate of 50mV / s. In 1mM [Fe(CN)6] 3- / 4- Electrochemical impedance spectroscopy was performed in the solution at a frequency of 0.1 Hz to 10 kHz at 0.2 V. The electrochemiluminescence signal was detected in a solution containing 0.1 M PBS, 10 mM K2S2O8, and pH 7.

4. The scan potential range was -1.6 V to 0 V, and the voltage was set to 600 V.

9. A method for detecting Alzheimer's biomarkers, characterized in that, Includes the following steps: S1. Prepare Alzheimer's biomarker solutions of various standard concentrations; S2, Alzheimer's biomarker solution was enriched with magnetic beads and cleaved by HaeIII to prepare the corresponding biomarker nucleic acid conversion products; S3. The TdT extended product is prepared by reacting the biomarker nucleic acid conversion product with the TdT reaction system. S4. The TdT extension product was reacted with the Cas12a reaction system to prepare the Cas12a system product. S5. The probe P bound to the gold electrode is cut by the product of the Cas12a system to obtain any of the electrochemical biosensors for detecting Alzheimer's biomarkers according to claims 1-8. Electrochemical detection is performed, and a standard curve is constructed that is related to the concentration of the electrochemical signal and the concentration of Alzheimer's biomarkers. S6. Extract the sample containing the unknown concentration of Alzheimer's biomarker and perform electrochemiluminescence detection using the same processing method as steps S2-S5. Substitute the detected electrochemiluminescence signal into the standard curve to obtain the concentration of Alzheimer's biomarker in the sample.

Images