High-pathogenicity mycoplasma bovis and application thereof

Abstract

The invention discloses high-pathogenicity mycoplasma bovis and application thereof, and belongs to the technical field of microorganisms. The mycoplasma bovis is mycoplasma bovis, the number of the mycoplasma bovis is MbST201NMG1, and the mycoplasma bovis is registered in the China General Microbiological Culture Collection Center (CGMCC), and the registration number of the mycoplasma bovis is CGMCC No: 45661. The mycoplasma bovis provided by the invention is high in minimum inhibition concentration to antibiotics, low in adhesion rate to Mac-T cells but high in invasion rate, and can be used for establishing a more typical animal clinical lesion model of the mycoplasma bovis compared with other mycoplasma bovis, so that a certain support is provided for subsequent research and development of vaccines.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a bovine mycoplasma and its applications, and more particularly to a highly pathogenic bovine mycoplasma and its applications. Background Technology

[0002] Mycoplasma are the smallest known self-replicating prokaryotic microorganisms in nature. Bovine Mycoplasma is a branch of Mycoplasma, first isolated from cases of bovine mastitis. Due to its biochemical characteristics similar to *Mycoplasma agalactiae*, it was previously named *Mycoplasma agalactiae* bovine variant and was considered one of the pathogens causing bovine mastitis. Subsequently, this pathogen was isolated from bovine lungs by many researchers, and experimental verification showed that it could cause pneumonia in cattle, leading to its formal name *Mycoplasma bovineis*. Mycoplasma bovis As research into this pathogen has increased, it has been discovered that bovine mycoplasma, in addition to causing mastitis and pneumonia, can also cause otitis media, conjunctivitis, keratitis, and arthritis. These diseases caused by bovine mycoplasma have severely impacted the development of animal husbandry, resulting in significant economic losses.

[0003] The development of vaccines against Bovine Mycoplasma faces a dual challenge: on the one hand, the types of available vaccines are limited and their immunization efficacy is unsatisfactory; on the other hand, in evaluating vaccine efficacy, existing challenge models struggle to consistently induce typical clinical symptoms in cattle, resulting in a lack of reliable standards for protective assessment. Therefore, there is an urgent need to develop or screen highly pathogenic Bovine Mycoplasma strains and establish a standardized challenge experimental system to accurately simulate the natural infection process. This would provide crucial technical support for elucidating the pathogen's pathogenesis, evaluating vaccine efficacy, and advancing the development of novel vaccines. Summary of the Invention

[0004] The technical problem to be solved by this invention is to provide a highly pathogenic bovine mycoplasma. The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0005] To solve the above-mentioned technical problems, the present invention provides the following technical solutions: This invention provides a mycoplasma, wherein the mycoplasma is Bovine Mycoplasma (… Mycoplasma bovis The bovine mycoplasma, designated MbST201NMG1, is registered with the China General Microbiological Culture Collection Center (CGMCC) under registration number CGMCC No: 45661.

[0006] The present invention also provides a culture, said culture being prepared by incorporating the aforementioned bovine mycoplasma ( Mycoplasma bovis Substances obtained by culturing in microbial culture media.

[0007] In the above-mentioned cultures, the microbial culture medium can be a solid culture medium or a liquid culture medium.

[0008] The term "culture" refers to a liquid or solid product (all substances within the culture container) containing Bovine Mycoplasma after artificial inoculation and cultivation. It is a product obtained by growing and / or amplifying Bovine Mycoplasma, which can be a biologically pure culture of Bovine Mycoplasma or contain a certain amount of culture medium, metabolites, and / or other components produced during the cultivation process. The term "culture" also includes passaged cultures obtained by subculturing Bovine Mycoplasma, which can be a single-generation culture or a mixture of several generations.

[0009] The present invention also provides the application of the aforementioned bovine mycoplasma or the aforementioned culture in the preparation of animal models of bovine mycoplasma infection.

[0010] In the above-mentioned application of preparing animal models of bovine mycoplasma infection, the animal model is a mastitis animal model, a pneumonia animal model, an otitis media animal model, a conjunctivitis animal model, a keratitis animal model, and / or an arthritis animal model.

[0011] The present invention also provides the use of the aforementioned bovine mycoplasma or the aforementioned culture in the preparation of medicaments for the prevention and / or treatment of bovine mycoplasma infection.

[0012] In the application of the above-mentioned preparation of drugs for the prevention and / or treatment of bovine mycoplasma infection, the animal model is a mastitis animal model, a pneumonia animal model, an otitis media animal model, a conjunctivitis animal model, a keratitis animal model, and / or an arthritis animal model.

[0013] In the above-described preparation of a medicament for the prevention and / or treatment of bovine mycoplasma infection, the medicament may be a vaccine. The vaccine may contain inactivated bovine mycoplasma (…). Mycoplasma bovis CGMCC No: 45661. The inactivated bovine mycoplasma ( Mycoplasma bovis CGMCC No.: 45661 Bovine mycoplasma can be inactivated using conventional methods. Mycoplasma bovis CGMCC No: 45661 was obtained, and formaldehyde can be used to inactivate it.

[0014] In the application of the above-mentioned preparation of a drug for the prevention and / or treatment of bovine mycoplasma infection, the drug, in addition to the aforementioned bovine mycoplasma or the aforementioned culture, also includes an adjuvant.

[0015] "Adjuvant" herein may include aluminum hydroxide and aluminum phosphate, saponins such as QuilA, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsions, oil-in-water emulsions, and water-in-oil-in-water emulsions. The emulsions may be particularly based on light liquid paraffin oil (European Pharmacopeia type); isoprenoid oils such as squalane or squalene; oils resulting from the oligomerization of alkenes, particularly isobutene or decene; esters of acids or alcohols containing linear alkyl groups, more particularly vegetable oils, ethyl oleate, propylene glycol di-(octanoate / decanoate), glyceryl tri-(octanoate / decanoate), or propylene glycol dioleate; esters of branched-chain fatty acids or alcohols, particularly isostearates. Oils are used in combination with emulsifiers to form emulsions. Preferred emulsifiers are nonionic surfactants, especially sorbitan esters, dimannitol esters (such as anhydromannitol oleate), ethylene glycol esters, polyglycerol esters, propylene glycol esters, and oleate esters, isostearate esters, ricinoleic esters, or hydroxystearate esters (all of which may be ethoxylated), and polyoxypropylene-polyoxyethylene block copolymers.

[0016] The present invention also provides the application of the aforementioned bovine mycoplasma or the aforementioned culture in the preparation of diagnostic reagents or kits for bovine mycoplasma infection.

[0017] The diagnostic reagent or kit for bovine mycoplasma infection may contain inactivated bovine mycoplasma (…). Mycoplasma bovis Mycoplasma bovis CGMCC No: 45661. The diagnostic reagent or kit for bovine mycoplasma infection described herein can inactivate bovine mycoplasma (…). Mycoplasma bovis CGMCC No. 45661 is the coating antigen, and the presence of anti-Bovine Mycoplasma is detected in animal serum by ELISA. Mycoplasma bovis Antibodies from CGMCC No: 45661 were used to diagnose bovine mycoplasma infection.

[0018] The present invention also provides the use of bovine mycoplasma or the aforementioned cultures in the preparation of bovine mycoplasma antibody detection reagents or kits.

[0019] The bovine mycoplasma antibody detection reagent or kit may contain inactivated bovine mycoplasma ( Mycoplasma bovis Mycoplasma bovis CGMCC No: 45661. Bovine mycoplasma antibody detection reagents or kits can inactivate bovine mycoplasma (…). Mycoplasma bovis CGMCC No. 45661 is the coating antigen, and the presence of anti-Bovine Mycoplasma is detected in animal serum by ELISA. Mycoplasma bovis Antibodies from CGMCC No: 45661 were used to diagnose bovine mycoplasma infection.

[0020] The bovine mycoplasma isolated and identified in this invention, relative to bovine mycoplasma Mycoplasma bovis Compared to the reference strain PG45 (ATCC_25523), this strain exhibits higher minimum inhibitory concentrations (MICs) against tylosin, tilmicosin, enrofloxacin, taurine, gatifloxacin, and mapofaxin, especially tylosin and tilmicosin. Furthermore, the adhesion rate of this bovine mycoplasma strain to Mac-T cells is significantly lower than that of bovine mycoplasma. Mycoplasma bovis Reference strain PG45 (ATCC_25523) had a significantly higher invasion rate than Mycoplasma bovis. Mycoplasma bovis Reference strain PG45 (ATCC_25523). Therefore, the bovine mycoplasma isolated in this invention exhibits high pathogenicity and can be used to establish more typical animal clinical lesion models of bovine mycoplasma, providing support for subsequent vaccine development.

[0021] Preservation Instructions Chinese name of the strain: Bovine Mycoplasma Latin scientific name: Mycoplasma bovis Classification and nomenclature: Bovine mycoplasma Mycoplasma bovis Number: MbST201NMG1 Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee Abbreviation of depositary institution: CGMCC Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing Date of preservation: July 7, 2023 Registered with the China National Collection Center (CGMCC) No. 45661. Attached Figure Description

[0022] Mycoplasma bovis Purification of cultured bovine mycoplasma Mycoplasma bovis ST201 NMG1.

[0023] Figure 1 Mycoplasma bovis Mycoplasma bovis Results of ST201 NMG1 virulence gene analysis.

[0024] Figure 2 for Mycoplasma bovis ST201 NMG1 drug resistance gene annotation.

[0025] Figure 3 for Mycoplasma bovis ST201 NMG1 adhesion and invasion gene annotation.

[0026] Figure 4 for Mycoplasma bovis Adhesion and invasion rate of ST201 NMG1. Detailed Implementation

[0027] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0029] Table 1. Reagents used in the following examples

[0030] Table 2. Instruments used in the following examples

[0031] The bovine mycoplasma used in the following examples Figure 5 The reference strain PG45 (ATCC_25523) is a product of ABI Pharmaceuticals, Inc.

[0032] The following examples used GraphPad Prism 8 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 (*) indicates that there is a significant difference.

[0033] Example 1: Isolation and Identification of Bovine Mycoplasma 1. Sampling and Transportation The type of mastitis in dairy cows was determined by combining clinical symptoms with CMT somatic cell count detection. Milk samples from clinical and subclinical mastitis were aseptically collected in 50 mL centrifuge tubes (samples were collected on July 11, 2022, in Bayannur City, Inner Mongolia Autonomous Region). After collection, the samples were placed in foam boxes with ice packs and transported to the Dairy Cow Mastitis Detection Laboratory of the College of Veterinary Medicine, China Agricultural University, within 48 hours for testing.

[0034] 2. Bovine mycoplasma culture (1) Preparation of bovine mycoplasma liquid culture medium (i.e., PPLO liquid culture medium): Weigh 21 g PPLO broth powder and 2.5 g yeast extract, dissolve in 700 mL deionized water, and inactivate at 121 ℃ for 30 minutes; cool to room temperature (23 ± 2 ℃) to obtain the basic culture medium; add 200 mL of inactivated horse serum; add 2 mL of filtered and sterilized 0.5 g / mL glucose, 0.5 mL of 200,000 units of penicillin and 10.0 mL of 0.5% phenol red, and make up to 1000 mL with sterile deionized water, adjust the pH to 7.4-7.6, filter and sterilize through a 0.22 μm filter membrane, dispense, and store at 2-8 ℃ for later use to obtain bovine mycoplasma liquid culture medium.

[0035] (2) Preparation of Bovine Mycoplasma Agar Plates (i.e., PPLO solid medium): Weigh 21 g of PPLO broth powder and 2.5 g of yeast extract, dissolve them in 700 mL of deionized water, add agar to make the agar content 0.7% (7 g / L), inactivate at 121 ℃ for 30 min, cool to 56-60 ℃, add 200 mL of inactivated horse serum; add 2 mL of filtered sterilized 0.5 g / mL glucose and 0.5 mL of 200,000 units of penicillin, and make up to 1000 mL with sterile deionized water. Pour the Bovine Mycoplasma Agar medium for subsequent culture into 90 mm Petri dishes, 20 mL / dish. Cool and solidify at room temperature (23 ± 2 ℃), then store at 2-8 ℃.

[0036] (3) Sample culture: Aseptic operation was maintained throughout the process. 10 mL of the milk sample collected in “1.1 Sampling and Transportation” was placed in a 15 mL centrifuge tube and centrifuged at 8000 r / min for 5 min. The supernatant was discarded, and the precipitate at the bottom of the tube was fully resuspended with 1 mL of sterile PBS (0.01 mol / L, pH 7.4). 100 μL of the resuspended precipitate was pipetted onto a bovine mycoplasma agar plate, and the milk sample was evenly spread using a triangular spreader. The plate was incubated in a biochemical incubator containing 5% CO2 at 37 ℃. Starting from the second day of incubation, the colony growth on the plate was observed daily under a regular optical microscope at 100x magnification. If typical “fried egg”-like colonies of bovine mycoplasma appeared, the result was considered positive.

[0037] (4) Preservation of Bovine Mycoplasma: Aseptically pick colonies from Bovine Mycoplasma agar plates and inoculate them into 3 mL of Bovine Mycoplasma liquid culture medium. Incubate at 37 ℃ in a biochemical incubator containing 5% CO2. Set up a blank control. Observe the color of the culture medium daily. When the color of the culture medium changes from red to orange-yellow or yellow, aliquot the culture into equal volumes (200 μL / tube), label with the strain number, date, and other information, to obtain the culture. Mycoplasma bovis Store the isolated strains at -80 ℃.

[0038] 3. Mycoplasma bovis PCR identification (1) DNA extraction Will Mycoplasma bovis The isolates were inoculated into fresh PPLO liquid medium and cultured in a biochemical incubator containing 5% CO2 at 37 ℃, with a blank control included. The medium color was observed daily; when the color changed from red to orange-yellow or yellow, bovine mycoplasma genomic DNA was extracted using a bacterial DNA extraction kit following the product instructions. The obtained... Mycoplasma bovis Genomic DNA of the isolates was stored at 2-8 ℃.

[0039] (2) PCR identification The PCR reaction system is shown in Table 3, and the PCR primers are shown in Table 4. The PCR reaction conditions were: 95 ℃ for 5 min, with cycles of 95 ℃ for 30 s, 52 ℃ for 30 s, and 72 ℃ for 120 s, for a total of 30 cycles, followed by an extension at 72 ℃ for 10 min. Electrophoresis was performed on a 0.8% agarose gel in TAE buffer containing dye, and the results were observed using an electrophoresis gel imaging system.

[0040] Table 3 Mycoplasma bovis Specific PCR reaction system

[0041] Table 4 Mycoplasma bovis Housekeeping gene primers and identification primers

[0042] PCR detection of the SxP-specific gene of Mycoplasma bovis revealed that the isolated strain purified from milk samples inoculated onto PPLO solid medium amplified a 1.9 kb target band. 50 μL of the amplified bacterial culture was inoculated onto PPLO solid medium and incubated at 37°C with 5% CO2 for 72 h. Pinpoint-sized white colonies were observed with the naked eye, and a "fried egg" morphology was observed under low magnification. Representative colony morphology photographs are shown below. Mycoplasma bovis(Eyepiece 10×, Objective lens 4×, 40x microscope) confirmed that the isolated pathogen was Mycoplasma bovis. One strain of Mycoplasma bovis, designated NMG1 (hereinafter referred to as Mycoplasma bovis NMG1), was subjected to MLST analysis and preservation as described in Example 2.

[0043] Example 2, MLST Analysis and Preservation 1. MLST genotype choose Mycoplasma bovis , Figure 1 , dnaA , gltX , gpsA , gyrB and pta-2 A total of 7 housekeeping genes were identified, and their primer sequences are shown in Table 4. Genomic DNA from *Mycoplasma bovis* ST201 NMG1 was used as a template for PCR amplification, yielding DNA fragments of 7 conserved genes from the isolate. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequencing results showed that *Mycoplasma bovis* NMG1... tbk The gene has a DNA segment whose nucleotide sequence is sequence 1, and is the bovine mycoplasma NMG1. tkt The gene has a DNA segment whose nucleotide sequence is sequence 2, and is the bovine mycoplasma NMG1. dnaA The gene has a DNA segment whose nucleotide sequence is sequence 3, and is the bovine mycoplasma NMG1. gltX The gene has a DNA segment with a nucleotide sequence that is sequence 4, belonging to bovine mycoplasma NMG1. gpsA The gene has a DNA segment with a nucleotide sequence that is sequence 5, and is the bovine mycoplasma NMG1. gyrB The gene has a DNA segment with a nucleotide sequence that is sequence 6, and is the bovine mycoplasma NMG1. pta-2 The gene has a nucleotide sequence that is the DNA segment of sequence 7.

[0044] Sequence 1: 5'-TGTAATATGTGGGGGGGTGGGTCAACTAAACATTTGATAATTATGTGGAAGGCAACTTTAATAAAGAAGTCATCAGAATAGCAAAATTAATTGTAGATGGTGAAGAAGACTATAATCCAATATTTATTTACGGCAAATCCGGAATAGGTAAAACACACTTACTCAACGCCATATGTAATGAGTTTCTTAAAAAAGATGTTTCAGTTAAATACATAAATGCTAATTCTTTTACAAGGGATATATCATACTTTCTACAAGAAAATGATCAACGAAAGTTAAAACAAATAAGAAATCATTTTGACAATGCCGATATCGTTATGTTTGATGACTTTCAAAGTTACGGAATAGGCAATAAAAAAGCAACAATTGAACTAATTTTTAATATTTTAGACAGCAGAATAAATCAGAAAAGAACCACAATAATTTGTTCCGACCGGCCTATATATTCATTACAAAATTCATTTGATGCTAGATTGATAAGCCGTCTTTCAATGGGGTTACAGCTTTCAATTGATGAACCACAAAAAGCAGACTTGCTGAAAATATTAGATTATATGATTGACATAAACAAGATGACGCCTGAACTATGAGAAGACGACGCAAAAAATTTTATTGTTAAAAACCATGCAAGCAGTATAAGAAGTTTAATTGGCGCTATAAATCGTCTAAGGTTCTATAATTCTGAAATTGTCAAAACAAATTCAAGATATACGCTTGCTATAGTTAATTCAATTCTTAAAGACATTCAGCAAGTAAAAGAAAAAGTTACGCCGGATGTTATTATTGAATACGTTGCTAAATATTACAAGCTTTCGCGTTCTGAAATACTAGGCAAAAGTAGAAGAAAAGATGTAGTTTTAGCTAGACATATAGCTATTTGAATTGTTAAAAGCATTAGACTATTGCGAGACAATTTTGGGAAAGA-3'.

[0045] Sequence 2: 5'-TTGGTGAGTAACAATAAGGTTTTGTATGCCTAAGGATACCACTTATGAATGAGATGATATTGTTAGGGGCAAAATTAGTTTTAACTCAAATGATATTGGAGACTGAGTTATTCAAAAATCTGATGGCTATCCAACATATAATTTTGCAGTTGTAGTAGATGATCATGATATGGAAATTACTCACGTATTAAGAGGCGAAGAACACATTACAAATACACCTAGACAACTCTCGATTTATAATGCTCTTGGGTGAAAATCTCCTGAATTTGGCCATCTAACTGTTATTACAAATATGGAAGGCAAAAAGCTTTCGAAAAGAGATACATCATTAAAACAATTTATTGAAGATTACAAAAATGATGGTTATGATCCAAATGCTATCTTTAACTTTCTATCACTTTTAGGTTGAACTAGTGCTGATAATTCGGAACTAATGAGCCATAATGAAATAATTACAAAGTTTGATCCTGCTAGATTAAGTAAGTCTCCTTCAAAATTTGACATTAAAAAAATGCAATGTTCTCAAAAACAAT-3'.

[0046] Sequence 3: 5'-TCTAAATATTTTGGCAATAGAAGGTTTAACAATCCTGAAAATATTAAAGCCACGTTAGACTTAAAAGATGCATTAAGCGAACTTGATTTAATGATACTTGCTGTTCCATCAAGCGCTATTGATAGTGTTTTAGGTCAAATTAGAGACGTGTTAGGAACACAAAAAATCAAAGTCATAAATGTTGCTAAGGGAATTGATTCAAAGACTAAAAAATTCTTTTCTGATGTCTTGGTTGAGAAATTTTCTAGCAATATTGAGCACTACTGCTCAATATTGGGCCCATCTTTTGCTACTGAAGTATTTGAAAATGCACTAACAATGATTAATGTTGTAGGGCCAAATGAGCAATTTTTAACTGAAGTTTCTCAAACGTTTAATAACAAATATTTTAGATTAATTGTTAATCCTGATGAA-3'.

[0047] Sequence 4: 5'-AAAACACAGCAAAAATGCTGAAATCTGCGAGTTATACATCGTTGAGGGTAATTCAGCTGGCGGTTCAGCAAAAATGGGAAGGGACAGAAATGTTCAAGCCATTCTGCCACTAAGGGGTAAGGTTATTAATGCTGAAAAGGTTTCGCCTGAAAGAGTTCTTTCTAATGCAGAAATAATCTCGCTTATAACCGCTTTGGGTACAGGACTAAACGAAACATTTGTCATCAACAAACTTAGATACCATAAGGTAATTATTATGACTGATGCTGATGTCGATGGAGCCCACATTAGAACCCTTTTATTAACCTTTTTCTACCGTTATTTTAGAAAACTAATTGAATATGGCTTTATTTATATTGCTCAACCTCCGCTTTATAAAATTCAACAAAATAAATATATTGCCTATGCATACAATGACTCTCAAAAGGATTCTATTCTTCAAGAATTAAATCAGGATTCTAAAATAACAATTCAACGTTACAAAGGTTTGGGAGAAATGGATCCTGAGCAGTTGTGAGAAACTACAATGAATCCTGAAAATAGAAAAATGTATCAAGTTCAAATTGATGATGCAGCCAAGGCTGACTGAGTGTTTACGACTTTAATGGGTGACGATGTTTTGCCAAGAAGAGAATTCATTGAAAAAAATGCAAAATG-3'.

[0048] Sequence 5: 5'-TAATTTGTAAAGGCAAAGAAGACTATGAAACTTGCTTAAAAAATATGCACACCAGACCTTACTATGGCGCTATGATGATCAAATTAAAGGATGTTGATAGTGCTGTTGGTGGCTTAATTTATTCAACTGCCGATATCTTACGTGCTGCTTTTAAATGCATCGGTGCAAAACCAGGAATTAAAACTATTTCTAGCGTTATAGTTATGCACAAAGATGATGAGCAAATTATTTTTACAGATCCATCAACAGTGCAAAAACCTAGTGCAGAACAATTAGTTGACATTGCTGCCAATGCAATTAGTTTTGCTAATATGATGAATATGAATAGTCTAGGGGCTTTTTTGACTTATTCGACCAATAACTCAGGCAAAGGTGAAAATCCTGACTTAGTTAGAGAAGCTGTAAAAATAGCCACTGAAAGAGGTTTAAATGTAATTAATGGTGAAATGCAATTTGATTCAGCCTATGACCTAAATGTAAGAAAAGTAAAGACG-3'.

[0049] Sequence 6: 5'-AAAAATGGATTAGGTCAATTAGAGGTTATAACTGGACCAATGTTTTCCGGAAAAACTGAGGAGCTATTAAAAAGAATAAACATACTTAAAATTGCAGGAATAAATTCTTTAGTTATAAAACCTAAATTTGACACAAGATTTTCTGAAGATGAAATAGTTAGTAGAACTGGTGCTAGACACAAAGCAATTAATGTTGCCAATTCTAAAGAAATTTTAAAATACTGAAATCCAGATTATATGTGTGTAGCAATTGACGAAGTCAATTTTATGGATGATGATATACTAACTGTAATTGATGAGTTAATTGTTAAGGGTGTAAGAGTAATTTGCTCAGGCCTAGATATGGACTTTAAAAGAAGACCATTTGATGTGATGGCTAGAGTTTTAGCTTCCGCTGATAACATTTTAAAGCTTAAAGCTGTTTGTTTAGAATGCAAATCTGATGCAGGATTTTCTTTTAGAAAAGTTAAGAGCGATGAGCTTAATTTATTAGGCGATTCTGAATATGAAGCTAGATGCAGAGTTTGTCACATCAAAGGCGAAGCTAAAAAAGTATATTTGAATATAAAA-3'.

[0050] Sequence 7: 5'--3'.

[0051] 2. Comparison of housekeeping genes and sequence types The obtained sequence is tbk The sequences of the seven housekeeping genes in the MLST database (http: / / pubmLst.org / mbovis / ) were compared with the corresponding housekeeping gene sequences to determine the sequence type (ST) of each isolate. If the housekeeping gene sequence of an isolate was not found in the database, a new ST type was requested. The results showed that the sequence numbers of the seven housekeeping genes in *Mycoplasma bovis* NMG1 were all consistent with the sequence type of the isolate. tkt The difference from ATCC_25523 indicates that Bovine Mycoplasma NMG1 is a new genotype isolate with the sequence type ST201. After verification by the MLST website administrator, a genotype ID was assigned to Bovine Mycoplasma NMG1. The housekeeping gene number for Bovine Mycoplasma NMG1 is shown in Table 5.

[0052] Table 5. Genotyping of Bovine Mycoplasma subtype isolates

[0053] 3. Preservation Mycoplasma bovis NMG1 was deposited on July 7, 2023, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing), with accession number CGMCC No. 45661. (Hereinafter referred to as...) Mycoplasma bovis ST201 NMG1 or Mycoplasma bovis ST201 NMG1 isolate.

[0054] Example 3: Gene Function Analysis 1. Virulence gene annotation The Virulence Factors of Pathogenic Bacteria (VFDB) database is specifically designed for studying the virulence factors of pathogenic bacteria, chlamydia, and mycoplasma. Based on the core dataset of the VFDB, virulence-related genes in the isolate genomes were identified through alignment. Gene annotation primarily involved using blastp to align the amino acid sequences of predicted gene translations with proteins in the database to obtain corresponding functional annotation information. Selection was based on the following criteria: Bitscore ≥ 80, E-value ≤ 1E-50. Based on the annotation results, non-functional "pseudogenes" were excluded from the virulence gene pool. A heatmap of virulence genes in the isolate genomes was generated using R v.12.0.

[0055] Based on previously reported invasion gene MnuA and adhesion gene Mycoplasma bovis , Mycoplasma bovis , Mbov-0503 , a-Enolase , MilA , FBA , P27 , MbfN , NOX as well as TrmFO Reference strain PG45 VpmaX Gene pair Mycoplasma bovis vsp The ST201 NMG1 was compared with the amino acid sequences of all proteins from NCBI, with the highest matching score hit rate of at least 80% and the query coverage greater than 60%.

[0056] VFDB full dataset annotation Mycoplasma bovis The genomes of the isolates and 42 virulence-related genes in the PG45 reference strain (ATCC_25523) are as follows: Mycoplasma bovisAs shown, the inferred virulence genes are divided into 13 functional gene classes: Stress survival, Disassembly ATPase ClpV, Nutritious / Metabolic factor, Regulation, Magnesium uptake, Exotoxin, Immune modulation, Adherence, Exoenzyme, Invasion, Immune, Effector delivery system, and Motility. Figure 2 ST201 NMG1 was matched to a highly abundant virulence gene, among which Mycoplasma bovis , clpV , tuf The abundance of isovirulence genes was higher than that of the ATCC_25523 reference strain.

[0057] 2. Annotation of drug resistance genes The Comprehensive Antibiotic Resistance Database (CARD) contains high-quality molecular basis reference data on bacterial resistance (AMR), focusing on genes, proteins, and mutations. Resistance genes were obtained by aligning the genomes of isolates in CARD. The alignment matrix was filtered according to the following criteria: Bitscore ≥ 80, E-value ≤ 1E-30, Pident ≥ 30. Based on the annotation results, non-functional "pseudogenes" were excluded from the resistance gene pool. Heatmaps of resistance genes in the isolate genomes were generated using R v.12.0.

[0058] dnaK The distribution diagram of AMR gene information identified from the genomes of ST201 NMG1 isolate and PG45 reference strain (ATCC_25523) is shown below. Mycoplasma bovis As shown, a total of 18 AMR genes were identified. These 18 AMR genes belong to 9 classes of antibiotics (Rifamycin, Nitroimidazole, Macrolide, Lincosamide, Aminocoumarin, Fluoroquinolone, Tetracycline, Glycopeptide, and Mupirocin-like). Figure 3 Mycoplasma bovis ST201 NMG1 carries a high abundance erfA (Rifamycin) msbA (Nitroimidazole) and tet (Tetracycline) resistance gene.

[0059] 3. Annotation of adhesion and invasion genes Download reference strains from NCBI Mycoplasma bovis A database was established using 14 Vsp (surface protein) gene sequences and 10 reported adhesion or invasion genes from the PG45 reference strain (ATCC_25523). Annotation analysis of adhesion, invasion, and Vsp genes in the isolates was performed. The results are as follows: Figure 4 As shown, the ST201 genotype isolate had a higher abundance of adhesion and invasion genes than the PG45 reference isolate. Mbov-0503 , a-Enolasc , FBA , MbfN , MilA and NOX Quite significant.

[0060] Example 4: Drug Resistance Detection I. Detection Methods 1. Resuscitation of isolates Will Mycoplasma bovis ST201 NMG1 was inoculated into fresh bovine mycoplasma liquid medium (PPLO liquid medium) and cultured in a biochemical incubator containing 5% CO2 at 37 ℃, with a blank control included. The color of the medium was observed daily; when the color changed from red to orange-yellow or yellow, it was transferred to 2-8 ℃ for storage, yielding the desired product. Mycoplasma bovis Mycoplasma bovis ST201 NMG1 culture.

[0061] 2. Cadaveric mycoplasma CCU assay Step 1 Mycoplasma bovis ST201 NMG1 culture was serially diluted 10-fold using bovine mycoplasma liquid medium. The diluted culture was then... Mycoplasma bovis ST201 NMG1 was cultured in a biochemical incubator containing 5% CO2 at 37 ℃, with a blank control included. The color of the culture medium was observed daily until day 7. When the color of the culture medium changed from red to orange-yellow or yellow, it was considered positive for bovine mycoplasma. On day 7, the highest dilution factor used to determine the positive bovine mycoplasma was taken as the CCU (Color Change Unit) content of the culture.

[0062] 3. Adding samples The cultures of each isolate were diluted to 10 μL using bovine mycoplasma liquid culture medium. 5 CCU / mL. Take Mycoplasma bovis Mycoplasma bovisUsing strain PG45 as a control, parallel experiments were conducted. Bovine mycoplasma liquid culture medium, 100 μL / well, was added to wells 1-11 of a 96-well plate. Antibiotic solutions, 100 μL / well, were added to wells 1. Working isolate solution, 200 μL / well, was added to wells 12. A blank control (containing neither bovine mycoplasma nor antibiotics) was set up. The bovine mycoplasma working solution was serially diluted 10-fold with bovine mycoplasma liquid culture medium, and 10 μL of each solution was used. -1 10 -2 10 -3 10 -4 10 -5 and 10 -6 The dilution was added to the empty wells of the reaction plate as a validation of the working solution. Each reaction plate was incubated in a biochemical incubator containing 5% CO2 at 37 °C, and observed daily until day 7.

[0063] 4. Judgment The maximum dilution factor at which the color changes from red to orange or yellow is taken as the minimum inhibitory concentration (MIC) of the isolate against the antibiotic.

[0064] II. Test Results right Mycoplasma bovis ST201 NMG1 isolate and Mycoplasma bovis The PG45 reference strain (ATCC_25523) was subjected to susceptibility testing for eight antibiotics, including quinolones (enrofloxacin and gatifloxacin), fluoroquinolones (marbofloxacin), macrolides (tylosin and tilmicosin), chloramphenicol (florfenicol), tetracyclines (doxycycline), and diterpenoids (tiamulin). The results showed... Mycoplasma bovis The MICs of the ST201 NMG1 isolate against six antibiotics (tylosin, tilmicosin, enrofloxacin, tiamulin, gatifloxacin, and mabofloxacin) were all higher than those against the ATCC_25523 standard strain. The MICs of the isolates are shown in Table 6.

[0065] Table 6. MIC of bovine mycoplasma ST201 isolate and PG45 reference strain

[0066] Example 5: Detection of bacterial adhesion and invasion rate I. Methods for detecting bacterial adhesion 1. Cell Culture Bovine mammary epithelial cell Mac-T cell line was passaged using standard methods and cultured in DMEM medium containing 10% FBS at a concentration of 2 × 10⁻⁶ cells / mL. 5 Seeds were inoculated at a density of 25 cm⁻¹ cells / mL. 2 Cell culture flasks, 4 mL / flask. Seed the cultured cells into 24-well cell culture plates and incubate at 37 ℃ in a CO2 incubator until 70-90% confluence.

[0067] 2. Infection use Mycoplasma bovis ST201 NMG1 and PG45 reference strains (ATCC_25523) were used to infect Mac-T cells. The old culture medium in the cell wells was discarded, and the cells were washed twice with sterile PBS (10 mM, pH 7.4). The culture was then diluted with DMEM medium. Mycoplasma bovis ST201 NMG1, infected at MOI = 1:1000.

[0068] 3. Sampling Samples were taken at 1, 3, and 6 h after infection for testing. The infection solution in the wells was discarded, and the cells were washed three times with sterile PBS (10 mM, pH 7.4), 700 μL / well. Then, 500 μL of sterile PBS (10 mM, pH 7.4) was added to each well, and the cells, along with any adhering cells, were scraped off using a cell scraper. Mycoplasma bovis Scrape off ST201 NMG1, resuspend, and mix thoroughly. Repeatedly pipette the cells using a 23G syringe needle. ​ ST201 NMG1 suspension.

[0069] 4. Bovine mycoplasma content count The gradient dilution method was used to detect the content of the sample. Mycoplasma bovis ST201 NMG1 content. The samples were serially diluted 10-fold with sterile PBS (10 mM, pH 7.4), and then evenly spread on bovine mycoplasma PPLO solid medium plates. The plates were incubated at 37 ℃ in a biochemical incubator containing 5% CO2, and observed daily until day 7. Each well was counted three times, with three replicates for each treatment, and each independent experiment was repeated three times. Mycoplasma bovis ST201 NMG1 adhesion rate to Mac-T cells = in the sample at hour N Mycoplasma bovis ST201 NMG1 content / Used in infection at hour 0 Mycoplasma bovis ST201 Total NMG1 content × 100%, N is 1, 3, 6 (i.e. Figure 5 (1dpi, 3dpi, 6dpi).

[0070] II. Adhesion Invasion Rate Detection Method 1. Cell Culture Bovine mammary epithelial cell Mac-T cell line was passaged using standard methods and cultured in DMEM medium containing 10% FBS at a concentration of 2 × 10⁻⁶ cells / mL. 5 Seeds were inoculated at a density of 25 cm⁻¹ cells / mL. 2 Cell culture flasks, 4 mL / flask. Seed the cultured cells into 24-well cell culture plates and incubate at 37 °C in a CO2 incubator until 70-90% confluence.

[0071] 2. Infection use Mycoplasma bovis ST201 NMG1 and PG45 reference strains (ATCC_25523) were used to infect Mac-T cells. The old culture medium in the wells was discarded, and 600 μL / well of 0.1% BSA in PBS (10 mM, pH 7.4) was added, with the cells blocked at 37 °C for 15 min. The liquid in the wells was discarded, and the cells were washed twice with sterile PBS (10 mM, pH 7.4). The solution was then diluted with DMEM medium. Mycoplasma bovis ST201 NMG1, infected at MOI = 1:1000.

[0072] 3. Gentamicin treatment Samples were taken at 1, 3, and 6 h after infection for testing. The infection solution in the wells was discarded, and the cells were washed once with sterile PBS (10 mM, pH 7.4), 700 μL / well. Then, 500 μL / well of PBS containing 400 μg / mL gentamicin was added, and the cells were incubated at 37 ℃ with 5% CO2 for 3 h. The cells were washed three times with sterile PBS (10 mM, pH 7.4). The cells were scraped off with a cell scraper. Mycoplasma bovis Scrape off ST201 NMG1, resuspend, and mix thoroughly. Repeatedly pipette the cells using a 23G syringe needle. Mycoplasma bovis ST201 NMG1 suspension. A cell-free gentamicin control was also set up to detect the effect of gentamicin on killing infected cells. Mycoplasma bovis The effect of ST201 NMG1.

[0073] 4. Bovine mycoplasma content count The gradient dilution method was used to detect the content of the sample. Mycoplasma bovis ST201 NMG1 content. The samples were serially diluted 10-fold with sterile PBS (10mM, pH 7.4), and then evenly spread on bovine mycoplasma PPLO solid medium plates. The plates were incubated at 37 ℃ in a biochemical incubator containing 5% CO2, and observed daily until day 7. Each well was counted three times, with three replicates for each treatment, and each independent experiment was repeated three times. Mycoplasmabovis ST201 NMG1 invasion rate against Mac-T cells = in the sample at hour N Mycoplasma bovis ST201 NMG1 content / Used in infection at hour 0 Mycoplasma bovis ST201 NMG1 content × 100%, N is 1, 3, 6 (i.e. Figure 5 (1dpi, 3dpi, 6dpi).

[0074] III. Test Results By comparison Mycoplasma bovis Adhesion rate of ST201 NMG1 to Mac-T cells ( Figure 5 (middle left figure) and invasion rate ( Figure 5 (Middle right figure) to determine the effect of the new ST classification on Mac-T adhesion and invasion. Mycoplasma bovis The invasion rate of ST201NMG1 was significantly higher than that of the reference strain at all time points, with nearly 60% of bovine mycoplasma entering the cells. Mycoplasma bovis The ST201 NMG1 strain showed a significant advantage in infection rate, indicating that... Mycoplasma bovis The ST201NMG1 strain exhibits strong invasive characteristics.

[0075] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Mycoplasma, characterized in that, The mycoplasma is Mycoplasma bovis ( ) Mycoplasma bovis The bovine mycoplasma, designated MbST201NMG1, is registered with the China General Microbiological Culture Collection Center (CGMCC) under registration number CGMCC No: 45661.

2. A culture, characterized in that, The culture is the bovine mycoplasma described in claim 1 ( Mycoplasma bovis Substances obtained by culturing in microbial culture media.

3. The use of the bovine mycoplasma as described in claim 1 or the culture as described in claim 2 in the preparation of animal models of bovine mycoplasma infection.

4. The application according to claim 3, characterized in that, The animal models are mastitis animal models, pneumonia animal models, otitis media animal models, conjunctivitis animal models, keratitis animal models, and / or arthritis animal models.

5. The use of the bovine mycoplasma as described in claim 1 in the preparation of a medicament for the prevention and / or treatment of bovine mycoplasma infection.

6. The application according to claim 5, characterized in that, The bovine mycoplasma infection is characterized by mastitis, pneumonia, otitis media, conjunctivitis, keratitis, and / or arthritis.

7. The use of the bovine mycoplasma as described in claim 1 or the culture as described in claim 2 in the preparation of diagnostic reagents or kits for bovine mycoplasma infection.

8. The application according to claim 7, characterized in that, The types of diseases caused by bovine mycoplasma infection include mastitis, pneumonia, otitis media, conjunctivitis, keratitis, and / or arthritis.

9. The use of the bovine mycoplasma as described in claim 1 or the culture as described in claim 2 in the preparation of bovine mycoplasma antibody detection reagents or kits.

Images