Cronobacter sakazakii nucleic acid aptamer and application thereof in preparation of biosensor

Abstract

The invention relates to the technical field of biology, and particularly discloses a cronobacter sakazakii nucleic acid aptamer and application thereof in preparation of a biosensor. According to the invention, a nucleic acid aptamer with a DNA sequence as shown in SEQ ID No: 1 is designed for Cronobacter sakazakii MipA protein, and 5'terminal amino is modified. The aptamer can be used for constructing a fluorescence quenching type biosensor, and comprises a fluorescent probe (fluorescent nanoparticles synthesized by citric acid diammonium, thiourea, tetramethyl orthosilicate and cerium dioxide, and a first aptamer modified by carboxyl) and a quenching probe (citric acid reduced gold nanoparticles, a second aptamer modified by sulfydryl, SEQ ID No: 2). Compared with a traditional method, the screening efficiency is remarkably improved, and the detection time is lt; the method has the advantages of high sensitivity, high interference resistance and affinity constant of 13.28 nM, is suitable for rapid monitoring of infant food, and reduces the economic cost by at least 40%.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a Cronobacter sakazakii nucleic acid aptamer and its application in the preparation of biosensors. Background Technology

[0002] Cronobacter sakazakii ( Cronobacter sakazakii It is a Gram-negative bacillus belonging to the Enterobacteriaceae family ( Enterobacteriaceae This bacterium is known for its opportunistic pathogenicity and resilience to adverse conditions. It was first identified in 1980 by Farmer et al. from clinical isolates and was formally named in 2007. Cronobacter It is a species within the genus. Subsequently, with the advancement of genome sequencing and epidemiological studies, *Cronobacter sakazakii* was confirmed as an important foodborne pathogen, causing serious infections, especially in infants and young children and immunocompromised individuals.

[0003] The biological characteristics of *Cronobacter sakazakii* make it highly adaptable to its environment. This facultative anaerobe can grow in a temperature range of 4-45℃, with an optimum temperature of 37-43℃. It is resistant to drying, heat (D value can reach 2.5 min at 60℃), and salt (can tolerate 6% NaCl). These characteristics allow it to survive for months to years in low-moisture active foods such as powdered infant formula (PIF). Studies have shown that *Cronobacter sakazakii* can form biofilms, enhancing its resistance to disinfectants, and achieves immune evasion through its O-antigen and lipopolysaccharide (LPS) structure. Genomic analysis shows that its genome size ranges from 4.3 to 5.5 Mb, containing multiple drug resistance islands and virulence gene clusters, such as OmpA (outer membrane protein A) and MipA (membrane invasion protein A), which play key roles in bacterial attachment and infection of host cells. MipA proteins are located on the bacterial outer membrane and possess surface exposure domains that can bind to host cell receptors, promoting bacterial colonization and invasion, making them ideal detection targets. However, these very characteristics make rapid detection of Cronobacter sakazakii a major challenge in the field of food safety.

[0004] In the context of food safety, infant formula is a high-risk carrier of Cronobacter sakazakii contamination. The production process of powdered infant formula involves high-temperature spray drying, but residual moisture and cross-contamination can allow bacteria to survive. Therefore, developing rapid and sensitive detection technologies is not only necessary to protect the health of infants and young children, but also crucial to promoting the upgrading of the food safety industry.

[0005] Traditional methods for detecting *Cronobacter sakazakii* primarily rely on microbial culture. This method, based on the international standard ISO / TS 22964:2006, includes pre-enrichment (incubation at 37°C for 18-24 h in BPW or mLST medium), selective isolation (anaerobic incubation at 42°C for 24-48 h using DFI or ESI agar plates), and biochemical identification (API 20E system or VITEK 2 automated identification system). Quantification is then performed by blood agar plate counting (CFU / mL). The advantages of this method are its specificity and reliability, and its ability to distinguish between live and dead bacteria. However, it has significant drawbacks: the entire process takes 3-5 days, is cumbersome, and requires a specialized laboratory and sterile environment. Furthermore, the culture method has a low detection rate (<70%) for low concentrations of strains (<10 CFU / 100g) and is susceptible to interference from background bacteria, such as the coexistence of *Escherichia coli* or *Salmonella*. Improvements have been made by using modified selective media (such as ChromID). Cronobacter (Tablets), but still cannot shorten the time, and the false positive rate is as high as 15%-20%.

[0006] To overcome the limitations of culture methods, molecular biology methods such as polymerase chain reaction (PCR) have been widely introduced. Real-time fluorescent PCR (qPCR) is specifically designed for... gyrB , zpx or rpoB Gene-designed primers can complete detection within 2-4 hours with a sensitivity of 10. 2 -10 3 CFU / mL. Commercial kits such as Bio-Rad iQ-Check or 3M Molecular Detection System are available, based on the SYBR Green or TaqMan probe principle, enabling automation. Studies show that qPCR in PIF can shorten the detection time to 8 hours with a specificity >95%. However, PCR methods also face challenges: firstly, it cannot distinguish between live and dead bacteria (bacteria in the VBNC state may produce false positives); secondly, it is sensitive to complex matrices (such as high-fat milk powder), and inhibitors (such as fatty acids and proteins) can reduce amplification efficiency, requiring pretreatment (such as DNA extraction kits, increasing costs by 20%-50%); and the equipment is expensive (thermal cyclers cost >50,000 RMB), making it unsuitable for on-site testing. Furthermore, while multiplex PCR can detect multiple pathogens simultaneously, it has a high risk of cross-reaction and a narrow linear range (<0.98). Enzyme-linked immunosorbent assay (ELISA), as another immunological method, uses monoclonal antibodies against Cronobacter sakazakii, with a detection time <2 hours and a detection limit of 10. 4 The antibody concentration was CFU / mL, but its stability was poor (storage period <6 months) and it had low specificity for variant strains.

[0007] In recent years, nucleic acid aptamer technology has emerged as a promising alternative to traditional antibodies, offering a novel pathway for developing "chemical antibodies." Aptamers are oligonucleotide sequences (typically 20-100 nt) composed of single-stranded DNA or RNA. They are screened from random libraries using phylogenetic index enrichment (SELEX) and can bind to targets with high affinity (Kd 10-100 nM) and specificity. Compared to antibodies, aptamers offer advantages such as small molecular weight (~10 kDa), ease of chemical synthesis, high stability (heat resistant, pH 2-12 resistant), and ease of modification (e.g., 5' amino / carboxyl / thiol groups). Early SELEX studies screened DNA aptamers for whole-cell Cronobacter sakazakii, with an affinity constant of approximately 50 nM, for use in lateral flow immunochromatographic (LFS) bands, achieving a detection limit of 10. 5 CFU / mL. However, the SELEX procedure iterates 12-18 times, takes several weeks, has a success rate of <50%, and has a limited library capacity (10). 15 High-affinity sequences are easily missed. Computational-assisted SELEX (CE-SELEX) introduces molecular docking software such as AutoDock to simulate the binding free energy (ΔG) between oligonucleotides and target proteins (such as OmpA), accelerating screening, but it still relies on experimental verification and has low optimization efficiency.

[0008] Building upon aptamers, biosensor technology has further enhanced detection performance. Optical biosensors, particularly quenching sensors based on fluorescence resonance energy transfer (FRET), have become a hot topic. The FRET principle utilizes the nonradiative transfer of excitation energy from donor fluorescent molecules (such as quantum dots or silicon nanoparticles) to acceptors (such as gold nanoparticles, AuNP), achieving a fluorescence quenching rate >90% at distances <10 nm. When the aptamer binds to the target bacteria, donor-acceptor separation occurs, fluorescence is restored, and quantitative detection is achieved. Nanomaterials enhance sensor stability: gold nanoparticles (5-20 nm in size) act as quenchers, with surface plasmon resonance (LSPR) resulting in an absorption peak at 521 nm; fluorescent nanoparticles (such as carbon dots or silicon dots) emit a peak at 480 nm, and spectral overlap ensures efficient FRET. Synthetic methods include the citric acid reduction method (Turkevich method) and silane hydrolysis method, but traditional synthesis methods are prone to aggregation and poor particle polydispersity (PDI>0.2), affecting reproducibility.

[0009] The limitations of existing FRET sensors are obvious. First, the dual-aptamer sandwich design often fails: bacterial surface epitopes are limited, one aptamer is easily saturated, blocking the binding of the second aptamer, leading to incomplete quenching (efficiency <70%). Second, aptamers targeting MipA proteins are scarce; existing sensors mostly target OmpA or whole bacteria, with affinity constants >30 nM and high cross-reactivity with mutant strains (>20%). In complex samples, high protein / fat content interferes with FRET (e.g., calcium ion chelation fluorophores in milk powder), resulting in a false negative rate >15%. Furthermore, the screening algorithms are often simplistic, primarily using genetic algorithms (GA) and neglecting multi-objective optimization (e.g., binding energy and sequence diversity), leading to unstable aptamer secondary structures and actual Kd bias >2 times. Commercial sensors such as those from Romer Labs... Cronobacter While the test kit is convenient, its sensitivity is only 10. 3 CFU / mL, poor field applicability.

[0010] In summary, while existing technologies have made progress in the detection of Cronobacter sakazakii, they still suffer from problems such as long processing time (3-5 days), low specificity, complex operation, high cost, and poor resistance to interference. Traditional culture methods and PCR are not suitable for rapid screening, aptamer-SELEX is inefficient, and FRET sensors have insufficient stability. Summary of the Invention

[0011] To address the problems of low screening efficiency, insufficient specificity, slow sensor response, and susceptibility to interference in existing nucleic acid aptamer technologies, this invention provides a *Cronobacter sakazakii* nucleic acid aptamer and its application in the preparation of biosensors. This aptamer targets *Cronobacter sakazakii* (… Cronobacter sakazakii The MipA protein was designed and screened using computational bioinformatics methods. It can be used to construct a fluorescence quenching biosensor, enabling rapid and sensitive detection of this bacterium and providing an efficient and non-invasive detection solution.

[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A Cronobacter sakazakii nucleic acid aptamer, the DNA sequence of which is shown in SEQ ID No: 1, wherein the 5' end of the nucleic acid aptamer is modified with an amino group.

[0013] The method for screening Cronobacter sakazakii nucleic acid aptamers according to the present invention includes the following steps: (1) Obtain the amino acid sequence and structural information of the MipA protein of Cronobacter sakazakii; (2) The design capacity is 10 12A library of short oligoDNA fragments, wherein the length of the short oligoDNA fragments ranges from 50bp to 80bp, is used. The structural information of the MipA protein of Cronobacter sakazakii from step (1) is imported into the Autodock vina molecular simulation software to perform molecular docking tests between the short oligoDNA fragment library and the surface domains of the MipA protein, and the binding free energy between each short oligoDNA fragment and the MipA protein is obtained. The molecular docking test results are processed by a multi-objective evolutionary algorithm model, and the binding free energy of the test results is optimized to obtain the optimal nucleic acid aptamer.

[0014] The *Cronobacter sakazakii* nucleic acid aptamer described in this invention can be used to prepare biosensors.

[0015] Preferably, the biosensor includes a fluorescent probe and a quenching probe.

[0016] The specific steps are as follows: (1) Preparation of the first activation mixture: 10 mM 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide were mixed at a volume ratio of 1:1 to obtain the first activation mixture; (2) Preparation of the second activation mixture: Add pure water to 3-(2-formylethyl)phosphine hydrochloride to obtain a 3-(2-formylethyl)phosphine hydrochloride solution with a final concentration of 2.867 g / L, which is the second activation mixture; (3) Preparation of fluorescent probe: Weigh diammonium citrate, thiourea, methyl orthosilicate and deionized water in a mass ratio of 2:1:8:50, and ultrasonically disperse at 200W for 20-30 min. Then, place the mixture in a sealed container at 140-160℃ for 4-6 h to obtain a primary reaction product solution. Subsequently, weigh a 15-25% cerium dioxide solution and mix it with the above reaction product solution in a mass ratio of (3-5):1. Ultrasonically disperse the mixture at 200W for 30-50 min, and then place the mixture in a sealed container. The fluorescent solution containing fluorescent nanoparticles was obtained by sealing and reacting at 110-130℃ for 4-6 hours. After cooling to room temperature, 500 μL of the fluorescent solution and 250 μL of the first activation mixture were vortexed and incubated on a shaker at 180 rpm and room temperature for 30 min. Then, 200 μL of the first aptamer solution with a volume concentration of 10 μmol / L was added and vortexed and incubated on a shaker at 180 rpm and room temperature for 2.5 h to obtain the fluorescent probe. The probe was then wrapped in tin foil and stored at 4℃ to protect it from light. (4) Preparation of quenching probe: Add 1 mL of 1% tetrachloroauric acid solution to 100 mL of distilled water and boil; quickly add 3.5 mL of 1% trisodium citrate solution and continue boiling for 15 min, then cool naturally to room temperature to obtain a quenching solution containing gold nanoparticles; add 80 μL of 10 μM second aptamer solution to a water bath at 95 °C for 5 min, then cool at 4 °C for 5 min to obtain an annealing solution; add 15 μL of the second aptamer solution to the annealing solution. A 2.867 g / L solution of 3-(2-formylethyl)phosphonic acid hydrochloride was allowed to stand at room temperature for 30 min to obtain a reaction solution. 1 mL of a quenching solution containing gold nanoparticles was added to the reaction solution, and the mixture was incubated at 37 °C for 12 h. After centrifugation at 10000 rpm for 20 min, the supernatant was removed to obtain a precipitate. 500 μL of 0.1 M PBS solution (pH 7.4) was added to the precipitate, and the mixture was stored at 4 °C wrapped in aluminum foil to protect it from light, thus obtaining the quenching probe. (5) Preparation of biosensor: The fluorescent probe and the quenching probe are mixed at a volume ratio of 1:1 to prepare a fluorescent quenching biosensor.

[0017] Preferably, the DNA sequence of the first aptamer in the first aptamer solution is shown in SEQ ID No: 1, and the 5' end of the first aptamer is modified with a carboxyl group.

[0018] Preferably, the DNA sequence of the second aptamer in the second aptamer solution is shown in SEQ ID NO: 2, and the 5' end of the second aptamer is modified with a thiol group.

[0019] Preferably, when the fluorescence emission wavelength of the fluorescent liquid shifts from 480 nm to 483 nm, it indicates that the first aptamer in the fluorescent probe has been successfully modified into the fluorescent nanoparticles of the fluorescent liquid; when the ultraviolet absorption wavelength of the quenching liquid shifts from 521 nm to 523 nm, it indicates that the second aptamer in the quenching probe has been successfully modified into the gold nanoparticles of the quenching liquid.

[0020] Compared with the prior art, the outstanding effect of the present invention is as follows: (1) This invention develops a novel nucleic acid aptamer (SEQ ID No: 1) targeting the MipA protein of Cronobacter sakazakii. It was obtained by screening short oligoDNA libraries (50-80 bp) using Autodock Vina molecular simulation software combined with a multi-objective evolutionary algorithm (NSGA-II framework). This method simultaneously optimizes the binding free energy (minimum -14.5 kcal / mol), sequence diversity, and GC content balance, significantly improving screening efficiency and specificity. Validation results show that the aptamer has a flow cytometry binding rate of 79.93% and an affinity constant of 13.28 nM. It exhibits strong specificity for Cronobacter sakazakii, while its binding rates to other bacteria (such as Escherichia coli and Salmonella) are all below 15.41%. Compared with existing technologies, the aptamer of this invention has higher affinity (reduced by approximately 61.7%), and the screening process requires no experimental iterations, only 24 hours of computation, avoiding the time-consuming (weeks) and low success rate (<50%) of the traditional SELEX method.

[0021] (2) Existing nucleic acid aptamers are often limited by cross-reactivity. This invention ensures sequence diversity through Pareto front sequencing, which improves the recognition accuracy of complex samples (such as infant food). The correlation coefficient is as high as 0.99989 and the detection limit is as low as 0.656 CFU / mL, which is far superior to the detection limit (10-100 CFU / mL) and linear range (usually 0.95-0.98) of the traditional fluorescent polymerase chain reaction (PCR) method.

[0022] (3) This invention is the first to use a composite synthesis route of diammonium citrate, thiourea, methyl orthosilicate, and cerium dioxide to prepare fluorescent nanoparticles (mass ratio 2:1:8:50, with subsequent doping of 15-25% cerium dioxide). High-efficiency fluorescence emission is achieved through a two-step sealed reaction (140-160℃ for 4-6h and 110-130℃ for 4-6h). The amount of trisodium citrate in the gold nanoparticle quenching solution is optimized (3.5mL), and the second aptamer is activated by 3-(2-formylethyl)phosphine hydrochloride (SEQ ID No: 2, thiol modification), and the ultraviolet absorption shift (521nm→523nm) is successfully verified. The sensor is assembled at a 1:1 volume ratio to form a FRET quenching system. Compared with existing technologies (such as conventional silane reduction or single gold nanoparticle synthesis), this method avoids particle aggregation caused by high-temperature polymerization and introduces multi-objective optimization to reduce non-specific adsorption, thereby improving energy transfer efficiency (quenching rate >65%). Traditional methods often require the assistance of cationic surfactants, but these can easily damage the surface structure of bacteria, leading to aptamer inactivation. This invention does not require such additives, is simple to operate, has a high yield (>90%), and reduces costs by about 40%, making it suitable for aseptic batch preparation.

[0023] (4) The detection method of this invention based on the fluorescence quenching principle requires only 40 minutes of incubation (excitation 410 nm, emission 482 nm), and has a linear range of 10. 1 -10 7 The CFU / mL and F / F0 ratio for *Cronobacter sakazakii* were 0.3519 (compared to >0.9745 for other bacteria), demonstrating excellent specificity. In infant formula milk samples, the concentration was measured at 0.983 × 10⁻⁶. 6 CFU / mL (true 1.0×10⁻⁶) 6 The method has a CFU / mL concentration and an error of <2%, eliminating the need to re-establish a standard curve and demonstrating its versatility under high protein / fat interference. Compared to traditional bacterial culture (3-5 days, complex operation) or PCR (>1 hour, expensive equipment, high cost), this method offers faster response (<1 hour), higher sensitivity (detection limit reduced by more than 95%), and requires no large instruments, making it particularly suitable for emergency monitoring of infant food.

[0024] (5) The dual aptamer non-sandwich design of the present invention avoids the surface saturation problem of existing FRET sensors (failure rate >30%), and significantly improves the practical value in the clinical and food safety fields.

[0025] The following description, in conjunction with the accompanying drawings and specific embodiments, further illustrates the Cronobacter sakazakii nucleic acid aptamer of the present invention and its application in the preparation of biosensors. Attached Figure Description

[0026] Figure 1 This is a secondary structure diagram of the Cronobacter sakazakii nucleic acid aptamer prepared by the present invention, wherein 1, 10, 20, 30, 40, 50, 60, 70, and 79 represent the number of bases.

[0027] Figure 2 This is a three-dimensional structural diagram of the membrane protein to be molecularly docked and matched by the *Cronobacter sakazakii* nucleic acid aptamer of this invention.

[0028] Figure 3 This is a transmission electron microscope image of the fluorescent liquid containing fluorescent nanoparticles prepared according to the present invention.

[0029] Figure 4 This is a transmission electron microscope (TEM) image of the quenching solution containing gold nanoparticles prepared according to the present invention.

[0030] Figure 5 This is a diagram showing the effect of the biosensor prepared in this invention after excitation at an excitation wavelength of 410 nm. Detailed Implementation

[0031] The present invention will now be described in detail through specific embodiments. However, these illustrative embodiments are for the purpose of illustrating the invention only and do not constitute any limitation on the actual scope of protection of the invention, nor are they intended to limit the scope of protection of the invention to these embodiments. For parameter ranges not mentioned, intermediate values ​​are selected. Furthermore, for mass percentages or weight percentages not explicitly stated or mentioned, they generally refer to the final concentration after addition.

[0032] Unless otherwise specified, the raw materials used in the following examples are all conventional biochemical reagents; unless otherwise specified, the experimental methods are all conventional methods; unless otherwise specified, the quantitative tests in the following examples are all repeated three times and the results are averaged; unless otherwise specified, the percentages in the following examples are all mass percentages.

[0033] In the following examples, the synthesized aptamers were purchased from Sangon Biotech (Shanghai) Co., Ltd.; unless otherwise specified, all other raw materials used were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0034] The phosphate buffer used in this application is a 0.1M sterile PBS buffer with a pH of 7.4.

[0035] The *Listeria monocytogenes* strain is designated ATCC 43251, *Staphylococcus aureus* ATCC 29213, *Salmonella* ATCC 14028, *Escherichia coli* ATCC 25922, *Cronobacter sakazakii* ATCC 29544, and *Pseudomonas aeruginosa* ATCC 15442. Furthermore, these strains were procured through an overseas agent, Hefei Xiyue Biotechnology Co., Ltd.

[0036] All instruments, equipment, raw materials, reagents, and procedures used in this application are performed under sterile conditions. Instruments, equipment, raw materials, reagents, or procedures not mentioned in this application are conventional or well-known techniques to those skilled in the art and will not be described further in this application.

[0037] Example 1

[0038] The DNA sequence of the *Cronobacter sakazakii* aptamer of the present invention is shown in SEQ ID No: 1 (TTGTAGTCACTAAGTTGTGACTACAAACGGGCATCTTCGCGGAGATGCCCGTCATGTCGTCCAGAGTTCGGACGACATG). The secondary structure of the *Cronobacter sakazakii* aptamer is as follows: Figure 1 As shown.

[0039] The binding assay was performed using the "aptamer binding assay" and "affinity constant determination" methods described in the published literature (Lou Xiuqin, Yu Hua, Wang Haoqiu, et al. Screening and identification of Vibrio parahaemolyticus aptamers based on whole-bacterial SELEX technology [J]. Chinese Journal of Public Health, 2019, 35(12): 1718-1723). The same assay was performed on the native bacteria, and the flow cytometry binding rate was 79.93%, with an affinity constant of 13.28 nM. The flow cytometry binding rates with Listeria monocytogenes, Staphylococcus aureus, Escherichia coli, Salmonella, and Pseudomonas aeruginosa were 2.49%, 5.12%, 12.78%, 15.41%, and 8.57%, respectively. The nucleic acid aptamers screened in this invention are close to the highest level of known publications (Document DOI: 10.3168 / jds.2021-20898, A simple and sensitive aptasensor with rolling circle amplification for viable Cronobacter sakazakii detection in powdered infantformula, Liu, Ju et al. Journal of Dairy Science, Volume 104, Issue 12, 12365-12374; similar tests showed that its flow cytometry binding rate was 81.6%, and the affinity constant was 34.67 nM). This demonstrates that the nucleic acid aptamers obtained in this application are feasible and meet the application requirements.

[0040] The screening method for DNA sequences of Cronobacter sakazakii nucleic acid aptamers is as follows: (1) Obtain the amino acid sequence and structural information of the MipA protein from Cronobacter sakazakii, including the three-dimensional structure as shown in Figure 1. Figure 2 As shown.

[0041] Specifically, a three-dimensional structural model of the MipA protein is constructed using homology modeling software (such as MODELLER, SWISS-MODEL, etc.); the obtained MipA protein structure is then optimized, including hydrogenation and energy minimization, to obtain a reasonable and stable initial structure.

[0042] (2) Molecular docking test was performed on the MipA protein of Cronobacter sakazakii obtained in step (1). The initial design capacity is 10. 12A library of short oligoDNA fragments, wherein the length of the short oligoDNA fragments ranges from 50bp to 80bp, is obtained. Then, the structural information of the MipA protein of Cronobacter sakazakii from step (1) is imported into the Autodock vina molecular simulation software. Then, the molecular docking test between the short oligoDNA fragment library and the surface domain of the MipA protein is performed to obtain the binding free energy between each short oligoDNA fragment and the MipA protein.

[0043] In practice, the specific steps are as follows: First, a capacity of 10 is designed using computer simulation methods. 12 A library of short oligoDNA fragments, each ranging from 50bp to 80bp in length, was generated using a random base sequence algorithm to ensure sequence diversity (e.g., using a Python script to randomly select sequences from A, T, C, and G bases). Next, the structural information (including a PDB format 3D coordinate file) of the MipA protein from *Cronobacter sakazakii* from step (1) was imported into AutoDock Vina molecular simulation software for preprocessing, including energy minimization, addition of hydrogen atoms, and charge calculation. Subsequently, in AutoDock... In Vina, surface domains of the MipA protein are defined as docking targets (preferably exposed hydrophilic regions or potential binding sites, selected based on protein surface electrostatic potential and hydrophobicity analysis). Molecular docking simulations are performed on each short oligoDNA fragment in the library. Simulation parameters include grid box size (covering key regions of the protein surface), repulsion mode (flexible docking to account for DNA fragment conformational changes), and number of iterations (at least 10 to ensure convergence). By calculating the interaction energies such as van der Waals forces, electrostatic forces, hydrogen bonds, and solvation effects, the binding free energy (in kcal / mol) between each short oligoDNA fragment and the MipA protein is obtained, and candidate sequences with lower binding free energies are screened for subsequent optimization.

[0044] (3) The molecular docking test results obtained in step (2) are processed by a multi-objective evolutionary algorithm model to optimize the binding free energy of the test results.

[0045] The algorithm of the model is explained as follows: The essence of the multi-objective evolutionary algorithm is to simultaneously minimize several conflicting objectives, and then use Pareto ranking and crowding distance to select DNA sequences that are both low-energy and diverse. The NSGA-II framework is used as an example.

[0046] 1. Objective function For any candidate sequence set up: 1.1 Combined with free energy (primary objective, the lower the better) ; 1.2 Sequence diversity (auxiliary target, the higher the better) Take the average Hamming distance with other sequences in the library. ; 1.3 GC content balance (optional target, the less it deviates from 50%, the better) ; Typical cases only use and ; Whether to join depends on stability requirements.

[0047] 2. Paretodominance Given two individuals : ; like If it is not inferior in all objectives and is better in at least one, then Dominate B.

[0048] 3. Fastnondominated sort 3.1 Initialization: Calculate how much each individual is controlled by others. and its dominant set .

[0049] 3.2 All Placed in the first frontier .

[0050] 3.3 Layer-by-layer update

[0051] 4. Crowding distance On the same frontier Inside, for each target First press Sort in ascending order, and denote the distance between endpoints as . .

[0052] For intermediate individuals : ; Final congestion distance The larger the value, the more "isolated" the individual is, which is more conducive to maintaining diversity.

[0053] 5. Selecting Operators Using a binary tournament: comparing two individuals hour 5.1 First, look at the Pareto rank; the one with the lower rank wins. 5.2 If the ranks are the same, then compare the crowding distance. The larger one wins.

[0054] 6. Crossover and variation (for DNA sequences) 6.1 Single or two-point intersection

[0055] 6.2 Base Mutation With probability Randomly replace a base with .

[0056] When using it, input: the result obtained in step (2) Value directly assigned to Output: Take the first Pareto front. The lowest chemically synthesizable sequence was obtained, which is SEQ ID No: 1 listed in the text. The iteration parameters were set as follows: population size N=200, crossover rate... Variation rate Termination condition: Maximum generation 100 (can be completed within 24 hours).

[0057] In addition, the binding free energies of some of the selected nucleic acid aptamers (the top 20 optimized aptamers) are shown in Table 1 below.

[0058] Table 1 Binding Free Energy of Different Nucleic Acid Aptamers

[0059] Example 2

[0060] The prepared Cronobacter sakazakii nucleic acid aptamers were used to prepare biosensors, and the preparation steps are as follows: (1) Preparation of the first activation mixture: 10 mM 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide were mixed at a volume ratio of 1:1 to obtain the first activation mixture; (2) Preparation of the second activation mixture: Add pure water to 3-(2-formylethyl)phosphine hydrochloride to obtain a 3-(2-formylethyl)phosphine hydrochloride solution with a final concentration of 2.867 g / L, which is the second activation mixture; (3) Preparation of fluorescent probe: Weigh diammonium citrate, thiourea, methyl orthosilicate and deionized water in a mass ratio of 2:1:8:50, and ultrasonically disperse at 200W for 20-30 min. Then, place the mixture in a sealed container at 140-160℃ for 4-6 h to obtain a primary reaction product solution. Subsequently, weigh a 15-25% cerium dioxide solution and mix it with the above reaction product solution in a mass ratio of (3-5):1. Ultrasonically disperse the mixture at 200W for 30-50 min, and then place the mixture in a sealed container at 110-130℃ for 4-6 h to obtain a fluorescent liquid containing fluorescent nanoparticles (its transmission electron microscope image is shown in Figure 1). Figure 3 (As shown), after cooling to room temperature, 500 μL of fluorescent solution and 250 μL of first activation mixture were vortexed and incubated on a shaker at 180 rpm and room temperature for 30 min; then 200 μL of first aptamer solution with a volume concentration of 10 μmol / L was added and vortexed and incubated on a shaker at 180 rpm and room temperature for 2.5 h to obtain the fluorescent probe, which was then wrapped in tin foil and stored at 4℃ to protect it from light. The DNA sequence of the first aptamer in the first aptamer solution is shown in SEQ ID No: 1, and the 5' end of the first aptamer is modified with a carboxyl group.

[0061] (4) Preparation of quenching probe: Add 1 mL of 1% tetrachloroauric acid solution to 100 mL of distilled water and boil; quickly add 3.5 mL of 1% trisodium citrate solution and continue boiling for 15 min, then allow to cool naturally to room temperature to obtain the quenching solution containing gold nanoparticles (its transmission electron microscopy image is shown in Figure 1). Figure 4 (As shown in the figure) 80 μL of the second aptamer solution with a volume concentration of 10 μM was incubated in a water bath at 95 °C for 5 min, and then cooled at 4 °C for 5 min to obtain an annealing solution. 15 μL of 3-(2-formylethyl)phosphonic acid hydrochloride solution with a volume concentration of 2.867 g / L was added to the annealing solution, and the mixture was allowed to stand at room temperature for 30 min to obtain a reaction solution. 1 mL of quenching solution containing gold nanoparticles was added to the reaction solution, and the mixture was incubated at 37 °C for 12 h. After centrifugation at 10000 rpm for 20 min, the supernatant was removed to obtain a precipitate. 500 μL of PBS solution with a volume concentration of 0.1 M and a pH of 7.4 was added to the precipitate, and the mixture was stored at 4 °C wrapped in aluminum foil to protect it from light to obtain the quenching probe. The DNA sequence of the second aptamer in the second aptamer solution is shown in SEQ ID NO: 2, and the 5' end of the second aptamer is modified with a thiol group.

[0062] (5) Preparation of biosensor: The fluorescent probe and the quenching probe are mixed at a volume ratio of 1:1 to prepare a fluorescence-quenched biosensor, such as... Figure 5 As shown.

[0063] When the fluorescence emission wavelength of the fluorescent liquid shifts from 480 nm to 483 nm, it indicates that the first aptamer in the fluorescent probe has been successfully modified into the fluorescent nanoparticles of the fluorescent liquid. When the ultraviolet absorption wavelength of the quenching liquid shifts from 521 nm to 523 nm, it indicates that the second aptamer in the quenching probe has been successfully modified into the gold nanoparticles of the quenching liquid.

[0064] Example 3

[0065] The detection was performed using the biosensor from Example 2, and the operation steps are as follows: Linear regression equation establishment: Prepare a test solution of the test sample without bacteria as a blank control test solution, and artificially contaminate the blank control test solution with Cronobacter sakazakii to set up a test solution containing bacteria with linear gradient dilution.

[0066] The fluorescence-quenched biosensor was mixed with the blank control test solution and the bacterial test solution at a volume ratio of 1:1 and incubated for 40 min to obtain the incubation solution.

[0067] At an excitation wavelength of 410 nm, the fluorescence intensity of the incubation solution was measured at an emission wavelength of 482 nm. The fluorescence intensity of the blank control solution was denoted as F0, and the fluorescence intensity of the bacterial test solution was denoted as F. A standard curve was plotted with the fluorescence intensity ratio F / F0 as the ordinate and the logarithm of the bacterial concentration in the bacterial test solution as the abscissa. The linear regression equation was obtained, and the correlation coefficient and detection limit were obtained.

[0068] Detection of Cronobacter sakazakii in the test sample: Prepare the test solution of the test sample, mix the fluorescence quenching biosensor with the test solution at a volume ratio of 1:1, incubate for 40 min to obtain the incubation solution; measure the fluorescence intensity of the incubation solution at an emission wavelength of 482 nm at an excitation wavelength of 430 nm.

[0069] Based on the obtained fluorescence intensity ratio F1 / F0, substitute it into the linear regression equation obtained in step (2) to obtain the concentration of Cronobacter sakazakii in the sample to be tested.

[0070] In the experiment, PBS buffer was selected as the blank control solution. Meanwhile, the *Cronobacter sakazakii* bacterial culture was centrifuged, washed three times with PBS buffer, resuspended in PBS buffer, and serially diluted to prepare concentrations of 10-1. 0 CFU / mL, 10 1 CFU / mL, 10 2 CFU / mL, 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL, 10 7CFU / mL and 10 8 CFU / mL of bacterial test solution. First, 100 μL of the prepared fluorescence-quenched biosensor was incubated with 100 μL of blank control test solution and 100 μL of serially diluted bacterial test solution at 37 °C for 40 min to obtain the incubation solution. Then, the fluorescence intensity of the incubation solution at the emission wavelength of 482 nm was measured at an excitation wavelength of 410 nm. The fluorescence intensity of the blank control test solution was recorded as F0, and the fluorescence intensity of the bacterial test solution was recorded as F. A standard curve was plotted with the fluorescence intensity ratio F / F0 as the ordinate and the logarithm of the bacterial concentration of the bacterial test solution as the abscissa to obtain the linear regression equation, correlation coefficient and detection limit.

[0071] The fluorescence-quenched biosensor prepared in this invention has a fluorescent probe exhibiting a distinct fluorescence emission peak at 482 nm. Furthermore, the ratio between the fluorescence intensity value F at 482 nm and the fluorescence intensity value F0 at 482 nm shows a linear relationship with the logarithm of the *Cronobacter sakazakii* bacterial concentration. The linear regression equation was determined to be y = -0.1173x + 1.0160, and its correlation coefficient (r) is [missing value]. 2 The value was 0.99989, and the limit of detection was 0.656 CFU / mL.

[0072] Next, specificity tests were conducted: the fluorescence intensity ratios (F / F0) of the test solutions containing Listeria monocytogenes, Staphylococcus aureus, Escherichia coli, Salmonella, and Pseudomonas aeruginosa were 0.9950, 0.9912, 0.9821, 0.9745, and 0.9883, respectively. Meanwhile, under the same conditions, the fluorescence intensity ratio (F / F0) of the test solutions containing Cronobacter sakazakii was 0.3519. Furthermore, under the same conditions, the fluorescence intensity ratio (F0 / F0) of the blank control test solution was 1. This demonstrates that the fluorescence quenching biosensor prepared in this invention exhibits good specificity for Cronobacter sakazakii.

[0073] Example 4

[0074] Based on Example 3, the testing of real food samples was added, selecting infant formula milk and the *Cronobacter sakazakii* nucleic acid aptamer designed in this invention for testing: In order to verify whether the standard curve described above can be effectively applied to the determination under interference environment (prepared milk for children), this embodiment separately measured the difference between the number of bacteria detected by the probe in artificially quantitatively contaminated milk and the number of bacteria detected by the probe in prepared milk for children, so as to know that even in real samples, the detection probe established by this invention can be effectively detected under the influence of nutrients such as high protein and high fat.

[0075] The infant formula milk involved in this embodiment was purchased from a domestic supermarket, and its ingredients are shown in Table 2 below.

[0076] Table 2 Ingredients of Formula Milk for Children

[0077] In the experiment, *Cronobacter sakazakii* was artificially inoculated into 20 mL of infant formula milk, with a final concentration of 10 after inoculation. 6 The concentration of CFU / mL was centrifuged at 5000×g for 5 min, the supernatant was discarded, and the precipitate was resuspended in 1 mL of PBS buffer as the bacterial test solution. Then, 500 μL of the test solution was mixed with 500 μL of the prepared fluorescence quenching biosensor and incubated for 40 min to obtain the incubation solution. Next, the fluorescence intensity of the incubation solution at the emission wavelength of 482 nm was measured at an excitation wavelength of 425 nm. The fluorescence intensity of the blank control test solution was recorded as F0, and the fluorescence intensity of the bacterial test solution was recorded as F. Finally, the concentration of Cronobacter sakazakii in the test sample was obtained by substituting the obtained fluorescence intensity ratio F / F0 into the linear regression equation.

[0078] The experimental results showed that, after calculation, the concentration of *Cronobacter sakazakii* detected by the probe in infant formula milk with artificial inoculation was 0.983 × 10⁻⁶. 6 CFU / mL, almost identical to its actual concentration (1.0 × 10⁻⁶). 6 The CFU / mL ratio is close to that of the standard curve and linear regression equation established under the condition of infant formula milk. It can be seen that even without establishing the corresponding standard curve and linear regression equation under the condition of pure PBS sample, the standard curve and linear regression equation established under the condition of pure PBS sample still have good versatility. Therefore, the detection probe prepared by this invention has good versatility and can be quickly applied to the detection of different samples.

[0079] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A Cronobacter sakazakii nucleic acid aptamer, characterized in that: The DNA sequence of the *Cronobacter sakazakii* nucleic acid aptamer is shown in SEQ ID No: 1, and the 5' end of the nucleic acid aptamer is modified with an amino group.

2. The method for screening Cronobacter sakazakii nucleic acid aptamers according to claim 1, characterized in that... This includes the following steps: (1) Obtain the amino acid sequence and structural information of the MipA protein of Cronobacter sakazakii; (2) The design capacity is 10 12 The short-chain oligoDNA fragment library was used to import the structural information of MipA protein of Cronobacter sakazakii from step (1) into the Autodockvina molecular simulation software to perform molecular docking tests between the short-chain oligoDNA fragment library and the surface domains of MipA protein, and to obtain the binding free energy between each short-chain oligoDNA fragment and MipA protein; the molecular docking test results were processed by a multi-objective evolutionary algorithm model to optimize the binding free energy of the test results and obtain the optimal nucleic acid aptamer.

3. The method for screening Cronobacter sakazakii nucleic acid aptamers according to claim 2, characterized in that: The short oligoDNA fragments are 50bp-80bp in length.

4. The application of the Cronobacter sakazakii nucleic acid aptamer according to claim 1 in the preparation of biosensors.

5. The application of the *Cronobacter sakazakii* nucleic acid aptamer as described in claim 4 in the preparation of biosensors, characterized in that: The biosensor includes a fluorescent probe and a quenching probe.

6. The application of the *Cronobacter sakazakii* nucleic acid aptamer according to claim 4 in the preparation of biosensors, characterized in that, The preparation method includes the following steps: (1) Preparation of the first activation mixture: 10 mM 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5 mM N-hydroxysuccinimide were mixed at a volume ratio of 1:1 to obtain the first activation mixture; (2) Preparation of the second activation mixture: Add pure water to 3-(2-formylethyl)phosphine hydrochloride to obtain a 3-(2-formylethyl)phosphine hydrochloride solution with a final concentration of 2.867 g / L, which is the second activation mixture; (3) Preparation of fluorescent probe: Weigh diammonium citrate, thiourea, methyl orthosilicate and deionized water in a mass ratio of 2:1:8:50, and ultrasonically disperse at 200W for 20-30 min. Then, place the mixture in a sealed container at 140-160℃ for 4-6 h to obtain a primary reaction product solution. Subsequently, weigh a 15-25% cerium dioxide solution and mix it with the above reaction product solution in a mass ratio of 3:1 to 5:

1. Ultrasonically disperse the mixture at 200W for 30-50 min, and then place the mixture in a sealed container at 140-160℃ for 4-6 h to obtain a primary reaction product solution. The fluorescent solution containing fluorescent nanoparticles was obtained by sealing and reacting at 110-130℃ for 4-6 hours. After cooling to room temperature, 500 μL of the fluorescent solution and 250 μL of the first activation mixture were vortexed and incubated on a shaker at 180 rpm and room temperature for 30 min. Then, 200 μL of the first aptamer solution with a volume concentration of 10 μmol / L was added and vortexed and incubated on a shaker at 180 rpm and room temperature for 2.5 h to obtain the fluorescent probe. The probe was then wrapped in tin foil and stored at 4℃ to protect it from light. (4) Preparation of quenching probe: Add 1 mL of 1% tetrachloroauric acid solution to 100 mL of distilled water and boil; quickly add 3.5 mL of 1% trisodium citrate solution and continue boiling for 15 min, then cool naturally to room temperature to obtain a quenching solution containing gold nanoparticles; add 80 μL of 10 μM second aptamer solution to a water bath at 95 °C for 5 min, then cool at 4 °C for 5 min to obtain an annealing solution; add 15 μL of the second aptamer solution to the annealing solution. A 2.867 g / L solution of 3-(2-formylethyl)phosphonic acid hydrochloride was allowed to stand at room temperature for 30 min to obtain a reaction solution. 1 mL of a quenching solution containing gold nanoparticles was added to the reaction solution, and the mixture was incubated at 37 °C for 12 h. After centrifugation at 10000 rpm for 20 min, the supernatant was removed to obtain a precipitate. 500 μL of 0.1 M PBS solution (pH 7.4) was added to the precipitate, and the mixture was stored at 4 °C wrapped in aluminum foil to protect it from light, thus obtaining the quenching probe. (5) Preparation of biosensor: The fluorescent probe and the quenching probe are mixed at a volume ratio of 1:1 to prepare a fluorescent quenching biosensor.

7. The application of the *Cronobacter sakazakii* nucleic acid aptamer according to claim 6 in the preparation of biosensors, characterized in that: The DNA sequence of the first aptamer in the first aptamer solution is shown in SEQ ID No: 1, and the 5' end of the first aptamer is modified with a carboxyl group.

8. The application of the *Cronobacter sakazakii* nucleic acid aptamer according to claim 6 in the preparation of biosensors, characterized in that: The DNA sequence of the second aptamer in the second aptamer solution is shown in SEQ ID NO: 2, and the 5' end of the second aptamer is modified with a thiol group.

9. The application of the *Cronobacter sakazakii* nucleic acid aptamer according to claim 6 in the preparation of biosensors, characterized in that: When the fluorescence emission wavelength of the fluorescent liquid shifts from 480 nm to 483 nm, it indicates that the first aptamer in the fluorescent probe has been successfully modified into the fluorescent nanoparticles of the fluorescent liquid.

10. The application of the *Cronobacter sakazakii* nucleic acid aptamer according to claim 6 in the preparation of biosensors, characterized in that: When the ultraviolet absorption wavelength of the quenching liquid shifts from 521 nm to 523 nm, it indicates that the second aptamer in the quenching probe has been successfully modified onto the gold nanoparticles in the quenching liquid.

Images