Nucleic acid aptamer combined with CD81 protein
By improving screening conditions and designing nucleic acid aptamer conjugates, the problem of insufficient binding affinity of CD81 protein in existing technologies has been solved, enabling the application of nucleic acid aptamers with high affinity and specificity in detection and treatment.
Patent Information
- Application Number
- CN202511701389.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-19
- Publication Date
- 2026-02-06
AI Technical Summary
Existing technologies lack nucleic acid aptamers that can bind to CD81 protein with high affinity and high specificity, making it difficult to meet the needs of detection, diagnosis, and treatment.
By improving the screening conditions of SELEX technology and combining magnetic bead method and serum blocking steps, nucleic acid aptamers with small molecular weight, stable chemical properties, and easy storage and labeling were screened out. Nucleic acid aptamer conjugates or derivatives were designed to improve binding affinity and specificity.
A nucleic acid aptamer capable of binding to CD81 protein with high affinity and high specificity has been obtained, which is suitable for detection, diagnosis, imaging and treatment, and has broad application prospects.
Smart Images

Figure CN121472234A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of targeted drugs, and particularly relates to a nucleic acid aptamer binding to CD81 protein. BACKGROUND
[0002] CD81 protein is a cell surface protein belonging to the tetraspan superfamily (TM4SF), with a molecular weight of about 25 kDa. It is widely expressed in various cell types, including B cells, T cells, natural killer (NK) cells, monocytes and endothelial cells, etc. CD81 plays an important role in the immune system, can regulate the proliferation and antibody production of B cells, and plays a key role in the activation and function of T cells. CD81 forms a complex with CD21 and CD19, reduces the activation threshold of B cells, and thus promotes the production of autoantibodies.
[0003] In the field of oncology and virology, abnormal expression and function of CD81 are associated with a variety of diseases. Studies have shown that CD81 acts as a receptor in hepatitis C virus (HCV) infection, participating in the invasion process of the virus. The E2 protein of HCV first binds to CD81, and then promotes the entry of the virus into the host cell through a cell signal transduction mechanism. In addition, abnormal expression of CD81 is also associated with the occurrence and development of some autoimmune diseases and tumors.
[0004] Nucleic acid aptamer is a DNA or RNA molecule selected by SELEX technology, which can bind to protein, metal ion, small molecule and other targets with high affinity and specificity. Compared with antibodies, nucleic acid aptamer has the advantages of small molecular weight, good stability, easy modification, no immunogenicity, short production cycle, etc. This makes nucleic acid aptamer show broad prospects in the fields of biochemical analysis, environmental monitoring, basic medicine and new drug synthesis, etc.
[0005] Given the key role of CD81 in immune cell function and viral infection, it is particularly important to find a nucleic acid aptamer with high affinity and high specificity to CD81 protein. Such a nucleic acid aptamer will help to achieve high sensitivity and high specificity detection of CD81 protein, promote the development of drugs targeting CD81 protein, and provide new strategies for the treatment of related diseases. Therefore, it is urgent to find a nucleic acid aptamer against CD81 protein, which should have high binding affinity, high specificity, easy modification and artificial synthesis, good stability, and convenient use. SUMMARY
[0006] The technical problem solved by the present application is to provide a nucleic acid aptamer binding to CD81 protein, which is small in molecular weight, stable in chemical properties, easy to preserve and label, and capable of binding to CD81 protein with high affinity, and can maintain high affinity and high specific binding to CD81 protein, and can be used for detection, diagnosis, imaging and treatment, and has a wide application prospect.
[0007] In one aspect, the present application provides a nucleic acid aptamer binding to CD81 protein, which has a nucleotide sequence as shown in SEQ ID NO. 1, or a nucleotide sequence having at least 30% homology with SEQ ID NO. 1 and binding to CD81 protein, or an RNA sequence transcribed from the nucleotide sequence as shown in SEQ ID NO. 1.
[0008] The present application is based on SELEX technology, and a random single-stranded DNA library and corresponding primers are designed and synthesized for screening a nucleic acid aptamer capable of binding to CD81 protein with high affinity, which is small in molecular weight, stable in chemical properties, easy to preserve and label, and thus two nucleic acid aptamers with high affinity to CD81 protein are screened, named OY-01 (SEQ ID NO. 1), which has high affinity to CD81 protein and high specificity.
[0009] It can be understood that the nucleotide sequence having at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% homology with the nucleic acid aptamer provided by the present application and binding to CD81 protein, for example, the nucleotide sequence shown in any of the above nucleic acid aptamers can be deleted or added with partial sequences, still has high affinity to CD81 protein, and is still within the protection scope of the present application.
[0010] In some modes, as an improvement to the above technical solutions, a certain position on the nucleotide sequence of the above nucleic acid aptamer can be modified, for example, phosphorylation, methylation, amination, sulfhydrylation, substitution of oxygen with sulfur, substitution of oxygen with selenium or isotopic modification, etc., provided that the nucleic acid aptamer sequence obtained after such modification has desirable properties, for example, can have equal or higher affinity to CD81 protein than the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved but has higher stability.
[0011] Therefore, in some embodiments, the nucleotide sequence of the aptamer is modified by at least one modification selected from the group consisting of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopic substitution, and the modified aptamer specifically binds to CD81 protein, which is still within the scope of the present application.
[0012] In another aspect, the present application provides a conjugate or derivative of the aptamer, wherein the aptamer has the nucleotide sequence as shown in SEQ ID NO. 1; the conjugate of the aptamer comprises a fluorescent label; and the derivative of the aptamer comprises a phosphorothioate backbone or a peptide nucleic acid for binding to CD81 protein, which is constructed from the backbone of the nucleotide sequence of the aptamer or the conjugate of the aptamer.
[0013] The conjugate of the aptamer of the present application refers to the connection of other groups to the aptamer, such as the connection of a fluorescent label having a labeling effect, for example, FAM, a radioactive substance, a therapeutic substance, biotin, digoxin, a nanoluminescent material, a small peptide, siRNA, or an enzyme label, etc., so that the sequence of the modified aptamer has desirable properties, for example, it can have an affinity for binding to CD81 protein that is equal to or higher than that of the parent aptamer sequence before modification, or it has higher stability although the affinity is not significantly improved.
[0014] In other words, the above-mentioned aptamer, whether partially substituted or modified, has a molecular structure, physicochemical properties, and functions that are basically the same as or similar to those of the original aptamer, and can be applied to the binding to CD81 protein.
[0015] In addition, the present application also provides a derivative of the aptamer, which is a phosphorothioate backbone for binding to CD81 protein, which is constructed from the backbone of the nucleotide sequence of the aptamer, or a peptide nucleic acid for binding to CD81 protein, which is constructed from the aptamer or the conjugate of the aptamer. The derivative has a molecular structure, physicochemical properties, and functions that are basically the same as or similar to those of the original aptamer, and binds to CD81 protein.
[0016] The term "phosphorothioate backbone" used in the present application has the meaning generally understood by those skilled in the art, which refers to the non-bridge oxygen atoms of the phosphodiester backbone of RNA and DNA aptamers can be replaced by one or two sulfur atoms, respectively, to produce a phosphorothioate backbone with phosphorothioate or dithiophosphate bonds. It is known that such phosphorothioate backbone has increased binding affinity to its target, and enhanced resistance to nuclease degradation.
[0017] The term "peptide nucleic acid" used in the present application has the meaning commonly understood by one of ordinary skill in the art, which refers to an artificial synthetic DNA molecule analogue first reported by Nielsen et al. in 1991. The oligonucleotide mimics connected by peptide bonds are synthesized by replacing the sugar-phosphate backbone with N-2-(aminoethyl)-glycine (N-(2-aminoethyl)-glycine) units as repeating structural units, which are called peptide nucleic acids. Since the peptide nucleic acid (PNA) does not have a phosphate group on the DNA or RNA, there is no electric repulsion between PNA and DNA, so the binding strength between them is greater than that between DNA and DNA.
[0018] In another aspect, the present application provides a product for purifying or detecting CD81 protein, wherein the product comprises the aptamer or the conjugate or derivative of the aptamer as described above; and the product comprises any one or more of a kit, a detection chip, and a chromatographic detection device.
[0019] In another aspect, the present application provides a method for screening an aptamer binding to CD81 protein, comprising the following steps: Synthesizing a random single-stranded DNA library and primers; Magnetic bead screening: performing at least 5 rounds of counter-screening and screening, and adding serum in the 4th to 5th round.
[0020] Further, the specific process of adding serum in the 4th to 5th round in step (2) is adding 1% serum in the 4th and 5th round, and the serum is human serum (normal human serum, purchased from Beijing Solabio Technology Co., Ltd., item number: SL010).
[0021] The method for screening an aptamer binding to CD81 protein provided in the present application is based on the SELEX screening method, and the specificity and stability of the aptamer are further improved by adding serum for blocking in the magnetic bead screening step from the 4th round.
[0022] The conventional condition for screening an aptamer is performed in an ionic buffer, and a certain concentration of serum is gradually added under the screening condition. On the one hand, because the serum contains rich proteins, it can compete with the proteins on the surface of the magnetic beads to bind to the library, thereby removing those sequences with weak binding ability to the target CD81 protein or only adsorbed. On the other hand, the aptamer binds to the target in the serum environment, which can better meet the actual detection environment of the application developed based on the aptamer in the later stage.
[0023] Studies have shown that in the subsequent rounds of screening, using high-concentration serum can screen aptamers with higher affinity and better specificity.
[0024] In another aspect, the present application provides use of the aptamer as described above, or the conjugate or derivative of the aptamer as described above for preparing a reagent for detecting or purifying CD81 protein.
[0025] In another aspect, the present application provides use of the aptamer as described above, or the conjugate or derivative of the aptamer as described above for preparing a drug targeting to CD81 protein.
[0026] In some ways, the present application provides use of the aptamer, the conjugate or the derivative thereof as described above in any one of the group consisting of: 1) quantitatively or qualitatively detecting CD81 protein; 2) purifying CD81 protein; 3) imaging CD81 protein; 4) preparing a drug targeting to CD81 protein; 5) preparing a reagent or drug for diagnosing and treating CD81 expression abnormality.
[0027] Advantages (1) The present application screens a nucleic acid aptamer capable of binding to CD81 protein with high affinity and high specificity, which is stable in chemical property, easy to preserve and label, by improving screening conditions; the structure of the nucleic acid aptamer is relatively stable, simple, easy to modify, and can be artificially synthesized in a short time, which is stable in chemical property, easy to preserve and label.
[0028] (2) The nucleic acid aptamer of the present application can be used in detection, diagnosis, imaging and treatment, etc., such as being used for purifying or high-sensitivity detecting CD81 protein, being used for preparing a drug targeting to CD81 protein, being used for a reagent or drug for diagnosing and treating CD81 expression abnormality, etc., and has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0029] Figure 1 Figure 1 is a schematic diagram of the retention rate of several rounds of enriched libraries obtained by the first to fifth rounds of screening in Example 1 to the target protein.
[0030] Figure 2 Figure 3 is a schematic diagram of the affinity detection result of the aptamer OY-01 to CD81 protein in Example 3.
[0031] Figure 3 Figure 4 is a schematic diagram of the specificity research result of the aptamer OY-01 in Example 3.
[0032] Figure 4This is a schematic diagram of the results of the dot blot hybridization experiment of the nucleic acid aptamer OY-01-Biotin in Example 4 to detect CD81 protein.
[0033] Figure 5 The image shows the color development of nucleic acid aptamer OY-01 with different concentrations of CD81 protein in Example 4. Detailed Implementation
[0034] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.
[0035] Example 1 Screening of ssDNA aptamers binding to CD81 protein The method for screening ssDNA aptamers that bind to CD81 protein in this embodiment includes the following steps: 1. Synthesize the random single-stranded DNA library and primers shown in the following sequences: Random single-stranded DNA library: 5'-ATTGGCACTCCACGCATAGG-36N-CCTATGCGTGCTACCGTGAA-3' (SEQ ID NO. 2); "36N" indicates a sequence consisting of 36 arbitrary nucleotide bases linked together. This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0036] Primer information is shown in Table 1, synthesized by Nanjing GenScript Biotech Co., Ltd.
[0037] Table 1. Primers and their sequences Primer name Sequence (5'-3') Lib10S1 ATTGGCACTCCACGCATAGG (SEQ ID NO. 3) Lib10-FAM-S1 FAM-ATTGGCACTCCACGCATAGG (SEQ ID NO. 4) Lib10-Biotin-A2 Biotin-TTCACGGTAGCACGCATAGG (SEQ ID NO. 5) Lib10A2 TTCACGGTAGCACGCATAGG (SEQ ID NO. 6) In the primer names, S represents the forward primer and A represents the reverse primer.
[0038] The primers were prepared into 100 μM stock solutions using ddH2O and stored at -20℃ for later use.
[0039] 2. Magnetic bead screening method The magnetic bead method was used for screening, with a total of 5 rounds of screening. The screening process for each round is shown in Table 2.
[0040] Table 2. Screening process for CD81 protein aptamers Round Counter-panning Positive panning Buffer solution First round Coupled His magnetic beads Coupled CD81 protein DPBS buffer solution Second round Coupled His magnetic beads Coupled CD81 protein DPBS buffer solution Third round Coupled His magnetic beads Coupled CD81 protein DPBS buffer solution Fourth round Coupled His magnetic beads Coupled CD81 protein DPBS buffer solution containing 1% serum Fifth round Coupled His magnetic beads Coupled CD81 protein DPBS buffer solution containing 1% serum The specific screening process is as follows: 1) Immobilization of CD81 protein with non-covalent magnetic beads Take 300 μl of non-covalent magnetic beads (Hangzhou Luomi Medical Technology Co., Ltd., catalog number: PN003-1), wash the beads three times with 600 μl of DPBS containing 0.02% Tween 20, and remove the supernatant. Add 400 μl of CD81 protein (100 μg / ml), incubate at 25°C on a vertical mixer for 60 minutes. After coupling, store the protein-coupled magnetic beads at 4°C for later use. Label the coupled magnetic beads as MB-CD81.
[0041] 2) Reverse screening and screening Preparation of reverse screening magnetic beads: The His peptide, synthesized by Genscript Biotech, was coupled to magnetic beads. The His peptide consisted of nine consecutive histidine residues. The coupling steps for the His protein were the same as those for the CD81 protein. The coupled magnetic beads were labeled MB-His.
[0042] Library dissolution and renaturation: Take 1 OD of random single-stranded nucleotide library, centrifuge at 14000 rpm for 5 minutes, and centrifuge to the bottom of the tube. Dissolve in DPBS buffer to 10 μM, mix well, and aliquot into PCR tubes for renaturation. The process is as follows: Set the PCR instrument program to 95℃ for 10 minutes to unfold the strands, then incubate at 4℃ for 5 minutes, and then equilibrate to room temperature. Add the treated library to 50 μl of MB-His magnetic beads, mix well, and incubate at room temperature for a period of time on a vertical mixer. Place on a magnetic rack, collect the supernatant, and label it pool-. The supernatant is used as the single-stranded nucleic acid library for positive screening with MB-CD81 magnetic beads. In each round of magnetic bead screening, before performing positive screening targeting CD81 protein, perform reverse screening with MB-His. The supernatant from the reverse screening is used as the single-stranded nucleotide library for positive screening with MB-CD81 magnetic beads. Specifically, the back-screened library pool- was added to 50 μl of MB-CD81 magnetic beads and incubated at 25°C for 1 hour on a vertical mixer. The mixture was then placed on a magnetic rack, the supernatant was discarded, and the magnetic beads were retained. The beads were washed four times with 200 μl of DPBS. Finally, 100 μl of ddH2O was added to the washed magnetic beads, and the mixture was incubated in a boiling water bath for 10 minutes. The supernatant was collected and labeled elution-CD81.
[0043] Using the nucleic acid molecules in elution-CD81 as templates, amplification was performed using conventional PCR. The method is as follows: All elution-CD81 template was added to 1 ml of PCR mix and mixed thoroughly. The template and PCR mix mixture was then divided into 50 μl portions and added to PCR tubes. The amplification conditions were as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, and 72℃ extension for 30 seconds, for a total of 21 cycles. The tubes were stored at 4℃. The PCR raw materials were prepared using dNTPs (P031-02) purchased from Novizan and rtaq enzyme (R500Z) purchased from Takara Bio.
[0044] The amplification products were purified using commercially available Tiandiren SA magnetic beads (SM017100) to prepare a secondary library for the next round of screening. 1 / 5 volume of 4M sodium chloride was added to 1 mL of PCR product, followed by 80 μL of SA magnetic beads that had been washed with DPBS and had their supernatant removed. The mixture was incubated on a shaker at room temperature for 30 min, after which the PCR supernatant was removed. The magnetic beads were then washed three times with DPBS containing 0.02% Tween 20, and after removing the supernatant, 100 μL of 40 mM sodium hydroxide solution was added. After incubation for three minutes, the magnetic beads were magnetically removed. 4 μL of 1M hydrochloric acid was added to the supernatant to neutralize the single strands, followed by 104 μL of 2*DPBS for salt dilution and neutralization. Finally, 208 μL of the secondary library dissolved in 1*DPBS was obtained, which can be used as the library for the next round of screening.
[0045] Five rounds of magnetic bead screening were performed. Each operation used a secondary library obtained from the previous operation as the starting nucleic acid library. After renaturation treatment, the library was incubated with MB-CD81 magnetic beads. During the screening process, a chemiluminescence immunoassay was used to detect changes in the recognition ability of the DNA single-stranded library for CD81 protein using a microplate reader. When the recognition ability of the DNA single-stranded library for CD81 protein met the requirements, i.e., the enrichment of the target protein in the screened DNA single-stranded library was higher than that of the initial library used in the screening (…),… Figure 1 ),from Figure 1 As can be seen, the retention rate increased significantly from the second round of screening, reaching a peak in the fifth round, indicating that the binding affinity between the aptamer and the target was significantly improved with the increase of screening rounds. The obtained libraries were then analyzed using high-throughput sequencing to meet sequencing requirements.
[0046] 3. Analysis and identification of the nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the enriched library products, several sequences were selected and synthesized by Genewiz Biotechnology (Jiangsu) Co., Ltd., and their affinity was tested.
[0047] In subsequent testing, a nucleic acid aptamer with a strong binding ability and a nucleotide sequence as shown in SEQ ID NO.1 was identified and named OY-01.
[0048] Example 2 Surface plasmon resonance (SPR) assay for the affinity of CD81 protein aptamer OY-01 to CD81 protein. The nucleic acid aptamer OY-01 (SEQ ID NO.1) was synthesized by Suzhou Genewiz Biotechnology Co., Ltd. and diluted with DPBS buffer to prepare 12.5 nM, 25 nM, 50 nM, 100 nM and 200 nM for later use.
[0049] 1. The CD81 protein was coupled to channel 1 of the CM5 chip surface using the following method: Activate the chip by injecting 50 μL of a mixture of equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) at a flow rate of 5 μL / min. Dilute the CD81 protein to a final concentration of 50 μg / mL with 10 mM sodium acetate at pH 5.5 and inject 50 μL at a flow rate of 5 μL / min. The CD81 protein coupling amount was 6896 RU. After injection, block the chip with 1 M ethanolamine at a flow rate of 5 μL / min, injecting 50 μL. Channel 1 was treated similarly to the His peptide coupling method, with identical activation and blocking steps, serving as a control channel.
[0050] 2. Detection: Using a surface plasmon resonance spectrometer (GE Healthcare, model: Biacore 8K), the detection parameters were set. The diluted aptamer sample was flowed through channel 1. The aptamer program was as follows: injection 20 μL / min, time 2 min; dissociation 20 μL / min, time 2 min; regeneration 1.5M NaCl 30 μL / min, time 30 s. The diluted OY-01 nucleic acid aptamer was then injected.
[0051] Affinity assay data for nucleic acid aptamer OY-01 and CD81 protein are shown in [link to data]. Figure 2 The KD values are shown in Table 3 below.
[0052] Table 3. Affinity of nucleic acid aptamers to CD81 protein Aptamer Length Affinity KD (nM) to CD81 protein SEQ ID NO. 1 (OY-01): 76 18 As shown in Table 3, OY-01 has a very good affinity for CD81 (the smaller the KD value, the greater the affinity).
[0053] Example 3 Specificity study of nucleic acid aptamer OY-01 In this embodiment, CFH protein, KRT19 protein, and MPN-372 protein were used instead of CD81 protein, following the same method as in Example 3 where CD81 protein was immobilized onto the SPR chip for testing. CFH protein, KRT19 protein, and MPN-372 protein were coupled to channels 1, 2, and 3 of the three channels on the CM5 chip surface, with coupling amounts of 973.9 RU, 1206.2 RU, and 4076.7 RU, respectively. The diluted OY-01 nucleic acid aptamer was then injected sequentially.
[0054] Affinity assay data for nucleic acid aptamer OY-01 with CFH protein, KRT19 protein, and MPN-372 protein are shown in [link to relevant data]. Figure 3 .Depend on Figure 3 It can be seen that the nucleic acid aptamer OY-01 cannot bind to CFH protein, KRT19 protein, or MPN-372 protein, demonstrating its excellent specificity.
[0055] Example 4 Detection of CD81 protein using dot blot hybridization assay based on nucleic acid aptamer OY-01 The dot blot hybridization experiment performed in this embodiment follows these steps: 1. Take two 8cm×2cm nitrocellulose membranes (purchased from Millipore), and dilute CD81 protein, control protein TROP2, HIS small peptide, FAP protein, EGFR protein, and NECTIN4 protein with DPBS to 0.5mg / ml. Spot 2ul of each sample onto the nitrocellulose membrane and air dry for 30 minutes.
[0056] Meanwhile, CD81 protein was diluted with DPBS to 0.500 mg / ml, 0.250 mg / ml, 0.125 mg / ml, 0.063 mg / ml, 0.032 mg / ml, and 0.016 mg / ml, respectively. 2 μL of each sample was spotted onto a nitrocellulose membrane and allowed to air dry for 40 minutes.
[0057] 2. After drying, block with 10% bovine serum at room temperature for 1 hour. After blocking, wash 3 times with DPBS-T (DPBS contains 0.02% Tween20) and aspirate clean.
[0058] 3. Use biotin-modified OY-01 nucleic acid aptamers containing 5mM Mg 2+ The diluted DPBS was diluted to 500 nM, and then the diluted nucleic acid aptamers and proteins on the nitrocellulose membrane were placed on a shaker and incubated at room temperature for 30 minutes.
[0059] 5. After incubation, use a solution containing 5mM Mg 2+Wash three times with DPBS-T, placing the container on a shaker for 5 minutes each time.
[0060] 6. Add 5mM Mg 2+ The DPBS was diluted 1:2000 with HRP-Streptavidin (purchased from Beyotime, catalog number A0303) and incubated on a shaker at room temperature for 30 minutes.
[0061] 7. Contains 5mM Mg 2+ Wash the DPBS-T solution three times, placing it on a shaker for two minutes each time.
[0062] 8. Add the colorimetric reagent (BeyoECL Star Ultrasensitive ECL Chemiluminescence Reagent Kit, purchased from Beyotime, catalog number P0018A, solutions A and B are the solutions provided with the kit) at a ratio of A:B = 1:1 (v / v) and develop the color at room temperature in the dark for 5 minutes.
[0063] 9. Imaging system observation and photography: The instrument used was the ImageQuant™ LAS 4000 digital imaging system from GE Healthcare Life Sciences.
[0064] The results are as follows Figure 4 As shown, compared with the spots of control proteins TROP2, HIS peptide, FAP protein, EGFR protein, and NECTIN4 protein, CD81 protein showed obvious color development. This indicates that biotin-modified OY-01 can be used for the detection of CD81 protein in membrane hybridization, and does not bind to control proteins TROP2, HIS peptide, FAP protein, EGFR protein, and NECTIN4 protein.
[0065] from Figure 4 It can also be seen that the OY-01 provided by the present invention can only bind to the CD81 protein and cannot bind to other proteins such as BSA, HIS small peptide, and A6NJ protein, which has high specificity.
[0066] like Figure 5 As shown, after diluting CD81 protein to 1.000 mg / ml, 0.500 mg / ml, 0.250 mg / ml, 0.125 mg / ml, and 0.063 mg / ml, the CD81 protein showed obvious color development, indicating that the biotin-modified OY-01 can be used for the detection of CD81 protein in membrane hybridization. It also demonstrates that OY-01 can accurately detect CD81 protein at concentrations of 125 μg / ml.
[0067] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A nucleic acid aptamer that binds to the CD81 protein, characterized in that, Having a nucleotide sequence as shown in SEQ ID NO.1; or a nucleotide sequence having at least 30% homology with SEQ ID NO.1 and binding to the CD81 protein; or an RNA sequence transcribed from a nucleotide sequence as shown in SEQ ID NO.
1.
2. A conjugate or derivative of the nucleic acid aptamer as described in claim 1, characterized in that, The conjugate includes a fluorescent label; the derivative includes a phosphate thioester backbone or peptide nucleic acid that binds to CD81 protein, modified from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.
3. A product for detecting CD81 protein, characterized in that, Includes the nucleic acid aptamer as described in claim 1, or a conjugate or derivative of the nucleic acid aptamer as described in claim 2.
4. A product for purifying CD81 protein, characterized in that, Includes the nucleic acid aptamer as described in claim 1, or a conjugate or derivative of the nucleic acid aptamer as described in claim 2.
5. The product as described in claim 3 or 4, characterized in that, The product includes one or more of the following: reagent kit, detection chip, and chromatography detection device.
6. A method for screening nucleic acid aptamers that bind to the CD81 protein, comprising the following steps: (1) Synthesize random single-stranded DNA libraries and primers; (2) Magnetic bead screening: Perform at least 5 rounds of reverse screening and screening, and add serum in the 4th to 5th round until the nucleic acid aptamer as described in claim 1 is obtained.
7. The screening method as described in claim 6, characterized in that, The specific process of adding serum in the 4th and 5th rounds in step (2) is as follows: 1% serum is added in the 4th and 5th rounds.
8. The screening method as described in claim 6 or 7, characterized in that, The serum in question is human serum.
9. Use of the nucleic acid aptamer of claim 1, or a conjugate or derivative of the nucleic acid aptamer of claim 2, for the preparation of reagents for the detection or purification of CD81 protein.
10. Use of the nucleic acid aptamer of claim 1, or a conjugate or derivative of the nucleic acid aptamer of claim 2, for the preparation of a medicament targeting the CD81 protein.