Application of GSE3.1 protein and its coding gene in regulating grain length, grain width and grain weight of rice

Abstract

The application relates to the field of rice genetic engineering, and discloses application of GSE3.1 protein and a coding gene thereof in regulating rice seed length, width and weight. Based on CRISPR / Cas9 technology, the GSE3.1 gene is edited, and a knocking-out mutant is obtained by using an agrobacterium-mediated method and being introduced into japonica rice variety Zhonghua 11 (ZH11). Homozygous knocking-out mutation of the GSE3.1 gene in the application leads to decrease of rice seed width and length and decrease of 1000-grain weight. By expressing a constructed plant overexpression vector ProActin:GSE3.1 in wild type ZH11, the seed length and width of the transgenic plant are significantly increased compared with those of the wild type plant, and the 1000-grain weight is significantly increased. Therefore, the GSE3.1 gene and the coding protein thereof in the application can regulate rice seed size and weight, and have important significance for cultivating high-yield rice varieties.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and genetic breeding, and relates to the application of GSE3.1 protein and its encoding gene in regulating rice seed grain length, grain width and grain weight. Background Technology

[0002] Rice is one of the world's most important food crops, providing staple food for more than half of the global population, and is also an important model plant for functional gene research. With decreasing arable land and rapid population growth, increasing rice yield is of paramount importance to ensuring my country's food security. Currently, increased rice production still relies on limited rice germplasm resources, and the advantages of traditional hybrid breeding are gradually weakening. However, transgenic rice technology has the potential to unlock further yield-increasing potential.

[0003] Rice yield is determined by the number of effective tillers, the number of grains per panicle, and seed size. Rice grain shape includes seed length, width, and thickness. Increasing the length and width of rice seeds can effectively increase rice yield. Several genes related to seed size have been identified in rice, such as GS3, GW2, GW5, GS5, and GW8. Therefore, studying the mechanisms by which rice regulates seed size has become one of the important strategies for improving crop yield.

[0004] GSE3.1 / LOC_Os03g30530 is a homologous gene of the rice grain shape QTL GL7 / GW7 / SLG7. GL7 / GW7 / SLG7 has been reported to positively regulate rice grain length and negatively regulate grain width, making them important regulatory genes for rice grain shape and quality. The gene described in this invention... GSE3.1 This gene can simultaneously positively regulate rice grain length, grain width, and thousand-grain weight, making it an important regulatory gene for rice grain weight. Therefore, GSE3.1 Genes, as an important locus, are of great significance for breeding high-yield rice varieties. Summary of the Invention

[0005] The purpose of this invention is to provide the application of GSE3.1, a protein related to the regulation of rice seed grain shape and weight, and its encoding gene. GSE3.1 The genome sequence of the gene is shown in SEQ ID NO.1. GSE3.1 The cDNA sequence of the gene is shown in SEQ ID NO. 2, and the amino acid sequence of the protein encoded by the GSE3.1 gene is shown in SEQ ID NO. 3. This invention significantly reduces the grain length, width, and weight of rice by mutating the gene encoding the GSE3.1 protein. Overexpression of the constructed plant overexpression vector ProActin:GSE3.1 in wild-type ZH11 resulted in transgenic plants with significantly larger and heavier seeds compared to wild-type plants. Therefore, the rice described in this invention… GSE3.1Genes are a potential target for genetic engineering to improve rice yield and have important application value.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] The first aspect of this invention provides the application of a gene overexpressing the rice GSE3.1 protein, wherein the application is any of the following:

[0008] A1) Application in increasing rice grain length, and / or grain width, and / or grain weight;

[0009] A2) Application in the cultivation of rice with increased grain length, and / or grain width, and / or grain weight.

[0010] A second aspect of the invention provides the application of biomaterials related to the GSE3.1 protein, wherein the application is any of the following:

[0011] B1) Application in increasing rice grain length, and / or grain width, and / or grain weight;

[0012] B2) Application in the cultivation of rice with increased grain length, and / or grain width, and / or grain weight;

[0013] The biomaterial is any one of the following C1) to C3):

[0014] C1) An expression cassette containing a nucleic acid molecule encoding the GSE3.1 protein;

[0015] C2) A recombinant vector containing a nucleic acid molecule encoding the GSE3.1 protein;

[0016] C3) A recombinant microorganism containing a nucleic acid molecule encoding the GSE3.1 protein, or a recombinant microorganism containing the expression cassette described in C1), or a recombinant microorganism containing the recombinant vector described in C2), wherein the microorganism is Agrobacterium;

[0017] A third aspect of the present invention provides a method for cultivating rice with increased grain length, and / or grain width, and / or grain weight, the method comprising overexpressing a gene for the GSE3.1 protein in rice to obtain rice with increased grain length, and / or grain width, and / or grain weight.

[0018] Specifically, the following steps are included:

[0019] Step 1: Constructing the overexpression vector: Using cDNA from the wild-type rice material ZH11 as a template, the vector was obtained by PCR amplification. GSE3.1The cDNA fragment of the gene (SEQ ID NO.2) was ligated with an overexpression vector (preferably pIPKB003, but other suitable overexpression vectors may also be used) after enzyme digestion to construct a ProActin:GSE3.1 recombinant expression vector driven by the Actin promoter;

[0020] Step 2, Genetic Transformation: The above overexpression vector is introduced into rice cells via Agrobacterium-mediated transformation. The preferred Agrobacterium strain is GV3101. The preferred rice recipient cells are seed-induced callus, which also includes other rice tissue-induced callus that can be cultured into complete plants.

[0021] Step 3: Plant Cultivation and Screening: The transformed callus tissue is induced, screened, differentiated, and rooted to obtain transgenic plants; positive plants are confirmed by PCR identification (such as hygromycin resistance gene detection), and finally, transgenic plants are obtained. GSE3.1 Transgenic rice with overexpressed genes.

[0022] The beneficial effects of this invention are:

[0023] (1) The regulatory effect is clear: GSE3.1 The gene can simultaneously regulate three major yield-related traits: grain length, grain width, and thousand-grain weight, with high regulatory efficiency and strong targeting.

[0024] (2) Mature technical solution: The genetic transformation method mediated by Agrobacterium and combined with CRISPR / Cas9 gene editing technology is simple to operate, has good reproducibility, and is suitable for large-scale breeding applications;

[0025] (3) Significant application value: In response to the pressure on food security brought about by the reduction of global arable land area and population growth, this invention provides new breeding targets and technical paths for high-yield rice, which can effectively tap the potential for increased rice production and is of great significance to ensuring food security. Attached Figure Description

[0026] Figure 1 For rice GSE3.1 Gene knockout mutant gse3.1#1 , gse3.1#2 Seed phenotype comparison with wild type (ZH11). (A) and (B) show wild type and knockout mutant, respectively. gse3.1#1 , gse3.1#2 Comparison of seed length and width, (C) to (E) represent wild type and knockout mutant, respectively. gse3.1#1 , gse3.1#2 A statistical chart showing the measurement results of seed length (C), seed width (D), and thousand-seed weight (E).

[0027] Figure 2The diagram shows the structure of the GSE3.1 gene and its encoded protein. (A) is a diagram of the GSE3.1 gene structure, showing the knockout mutant. gse3.1#1 and gse3.1#2 The mutation location in the GSE3.1 gene. (B) shows the knockout mutant. gse3.1#1 and gse3.1#2 Mutation types in GSE3.1. (C) is a structural diagram of the protein encoded by GSE3.1, showing... gse3.1#1 and gse3.1#2 Mutations in the GSE3.1 gene result in changes to the corresponding amino acid sequence.

[0028] Figure 3 The expression pattern of the GSE3.1 gene and the subcellular localization of its encoded protein are shown. (A) The expression profile of GSE3.1 in different tissues of rice is shown. (B) The expression pattern of GSE3.1 protein is shown to co-localize with the cytoskeletal protein TON1.

[0029] Figure 4 Seed size and weight analysis of GSE3.1 gene overexpression lines. (A) shows mature seeds of wild-type ZH11 and overexpression lines ProActin:GSE3.1#1 to ProActin:GSE3.1#4, from top to bottom. (CD) Statistical graphs of seed length, seed width, and thousand-seed weight of wild-type ZH11 and overexpression lines ProActin:GSE3.1#1 to ProActin:GSE3.1#4. ** represents p < 0.01, and * represents p < 0.05. Detailed Implementation

[0030] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0031] Knockout mutant gse3.1#1 and gse3.1#2 The GSE3.1 gene knockout mutant was obtained by knocking out the GSE3.1 gene in the wild-type rice variety ZH11 using the CRISPR / Cas9 system, and the mutant was obtained in the T2 generation. Wild-type rice variety ZH11, knockout mutant gse3.1#1 and gse3.1#2 Collected and preserved for our laboratory. Among them, ZH11 has the genotype GSE3.1 / GSE3.1, a mutant. gse3.1#1 The genotype is gse3.1#1 / gse3.1#1mutant gse3.1#2 The genotype is gse3.1#2 / gse3.1#2 The seed phenotypes of rice GSE3.1 gene knockout mutants gse3.1#1 and gse3.1#2 compared with the wild type (ZH11) are shown below. Figure 1 As shown. Knockout mutant gse3.1#1 and gse3.1#2 The mutation location and mutation type in the GSE3.1 gene are as follows: Figure 2 As shown. Example 1

[0032] one, GSE3.1 Construction of gene overexpression vectors

[0033] Design for GSE3.1 Specific primers for the gene's cDNA sequence. The specific sequence is:

[0034] P1-F: 5'- ggctgcaggaattcaagctt ATGCCGTCCCGGATGATGCA -3';

[0035] P1-R: 5'-atccagtcactatggtcgac CTATATGCTGATGAAAGACAGCT-3'.

[0036] In this diagram, the lowercase letters represent the homologous recombination arms required for ligation with the vector. The uppercase letters of P1-F (SEQ ID NO. 4) represent the first 20 bases shown in SEQ ID NO. 2, and the uppercase letters of P1-R (SEQ ID NO. 5) represent the reverse complementary sequence of the last 23 bases shown in SEQ ID NO. 2. Using cDNA from the wild-type rice material ZH11 as a template, PCR amplification was performed using primer pair P1-F / P1-R. The obtained PCR products were detected by 1.0% agarose gel electrophoresis and then recovered for sequencing. Sequence 2 was ligated into the pIPKB003 vector, which had been recovered after digestion with Sal I and Hind III. After enzyme digestion and sequencing, the Actin promoter-driven ProActin:GSE3.1 expression vector was constructed.

[0037] Structural description of the recombinant ProActin:GSE3.1 vector: The recombinant plasmid was obtained by replacing the small fragment between the restriction sites Sal I and HindIII of the pIPKB003 vector with the cDNA fragment shown in SEQ ID NO. 2 in the sequence listing.

[0038] II. Subcellular localization of GSE3.1 protein

[0039] Design for GSE3.1Protein subcellular localization-specific primers for the gene cDNA sequence. The specific sequence is:

[0040] P2-F: 5'-gatgaactatacaaaggcgcgcca ATGCCGTCCCGGATGATGCA -3';

[0041] P2-R: 5'- cgatcggggaaattcgagctc CTATATGCTGATGAAAGACAGCT -3'.

[0042] In this diagram, the lowercase letters represent the homologous recombination arms required for ligation with the vector. The uppercase letters of P2-F (SEQ ID NO. 6) represent the first 20 bases of SEQ ID NO. 2, and the uppercase letters of P2-R (SEQ ID NO. 7) represent the reverse complementary sequence of the last 23 bases of SEQ ID NO. 2. Using cDNA from the wild-type rice material ZH11 as a template, PCR amplification was performed using primer pair P2-F / P2-R. The obtained PCR product was detected by 1.0% agarose gel electrophoresis and then recovered for sequencing. Sequence 2 was ligated into the pMDC43 vector, which had been recovered after digestion with Asc I and Sac I. After enzyme digestion and sequencing, a 35S promoter-driven 35S:GFP-GSE3.1 expression vector was constructed.

[0043] 2.1 Preparation of Agrobacterium infection solution and tobacco infection: First, the vectors 35s:GFP, 35s:GFP-GSE3.1 and 35s:mCherry-TON1 were transformed into Agrobacterium GV3101 by Agrobacterium electroporation transformation; then, the bacterial solutions of the control group (35s:GFP and 35s:mCherry-TON1) and the experimental group (35s:GFP-GSE3.1 and 35s:mCherry-TON1) were transformed into tobacco leaves by Agrobacterium infection.

[0044] 2.2 Protein Expression and Laser Confocal Fluorescence Microscopy Observation: Forty-eight hours after protein expression in tobacco leaves, the green fluorescent protein (GFP) and red fluorescent protein (RBF) signals of the control group (35S:GFP and 35S:mCherry-TON1) and the experimental group (35S:GFP-GSE3.1 and 35S:mCherry-TON1) were observed under a laser confocal fluorescence microscope. The results are as follows: Figure 3 B shows that the green fluorescent protein signal of GFP-GSE3.1 protein overlaps with the red fluorescent protein signal of mCherry-TON1 protein (TON1 is a microtubule-binding protein located in the cytoplasm), indicating that GSE3.1 can co-localize with TON1. Figure 3 ).

[0045] III. Rice Genetic Transformation Experiment

[0046] First, the ProActin:GSE3.1 vector was transformed into Agrobacterium GV3101 using the Agrobacterium electroporation transformation method. Then, GV3101-ProActin:GSE3.1 was transformed into wild-type ZH11 to obtain the corresponding transgenic plants. The specific operation is as follows:

[0047] 3.1. Induction and Culture of Rice Mature Embryo Callus: Dehulled mature rice seeds were first soaked in 70% ethanol for 1-2 minutes, then in 30% sodium hypochlorite for 30 minutes for surface sterilization. After rinsing 3-4 times with sterile water, the seeds were blotted dry on sterile filter paper and placed on mature embryo callus induction medium for incubation at 26°C in the dark. After approximately 10-15 days, callus tissue growing from the mature embryo scutellum was peeled off and transferred to mature embryo subculture medium for subculture under the same conditions. Subculture was then performed every two weeks. Callus tissue with a pale yellow color after 5-7 days of subculture was selected for co-culture.

[0048] 3.2. Culture of Agrobacterium

[0049] GV3101-ProActin:GSE3.1 was streaked onto LB agar plates containing 50 mg / L spectinomycin and incubated in the dark at 28°C for 3 days.

[0050] Agrobacterium cells were collected using a metal spoon and suspended in co-culture CM liquid medium. The cell concentration was adjusted to an OD600 of 0.3-0.5. Acetyleugenone was added to bring the final concentration of acetylsuccinone to 100 mM, which is the Agrobacterium suspension used for co-culture transformation of rice.

[0051] 3.3. Co-culture of rice callus and Agrobacterium

[0052] Select callus tissue in good condition (subcultured for 5-7 days, pale yellow in color) and place it in a 100ml sterile Erlenmeyer flask. Add an appropriate amount of Agrobacterium suspension (ensure sufficient contact between the bacterial suspension and the material). Incubate at room temperature for 20 minutes, shaking occasionally. Discard the bacterial suspension, place the callus tissue on sterile filter paper to absorb excess suspension, and then transfer it to a solid co-culture medium lined with sterile filter paper. Incubate at 26℃ in the dark for 2-3 days.

[0053] 3.4. Screening of resistant callus tissue

[0054] The co-cultured callus tissues were placed on selection medium containing 50 mg / L hygromycin and incubated in the dark at 26°C for 14 days. They were then transferred to freshly prepared selection medium and selection continued for another 14 days. Most callus tissues browned approximately 10 days after selection, and then milky-white resistant callus tissue regrowth from the edges of the browned tissues.

[0055] 3.5. Differentiation of resistant callus: From the resistant callus that grew after two rounds of screening, the dense, milky-yellow resistant callus was selected and transferred to a differentiation medium containing 50 mg / L hygromycin. It was first cultured in the dark for 3 days, and then cultured under 15 h / d light conditions. Generally, after about 15-25 days, green spots appeared, and seedlings were further differentiated after 30-40 days.

[0056] 3.6 Rooting, Seedling Strengthening and Transplanting

[0057] When the buds differentiated from the resistant callus tissue grew to about 2 cm, the seedlings were transferred to rooting medium and cultured for about two weeks. Seedlings about 10 cm tall with well-developed root systems were selected, the medium was washed off, and they were transplanted to the field. 35 T0 generation transgenic plants were obtained.

[0058] The culture medium formula used is as follows:

[0059] Induction medium: N6 macroelements + MS-Fe salt + B5 microelements + B5 organic + 2,4-D 2.5 mg / L, proline 500 mg / L, glutamine 500 mg / L, CH 300 mg / L, maltose / sucrose 30 g / L, gelrite 2.6 mg / L, pH 5.8.

[0060] Subculture medium: Same as induction medium, but 2,4-D is changed to 2.0 mg / L.

[0061] Co-culture (solid) medium: N6 macroelements, MS-Fe salts, B5 microelements, B5 organics, 2,4-D 2.0 mg / L, CH 500 mg / L, inositol 2000 mg / L, AS 100 μM, maltose / sucrose 30 g / L, Gelrite 2.6 mg / L, pH 5.5. (Liquid selective medium is gelrite-free).

[0062] Screening medium: N6 macroelements, MS-Fe salt + B5 microelements, B5 organic, 2,4-D 2.0 mg / L, proline 500 mg / L, glutamine 500 mg / L, CH 300 mg / L, maltose / sucrose 30 g / L, gelrite 2.6 mg / L, cef 250 mg / L, hyg 50 mg / L, pH 5.8.

[0063] Differentiation medium: N6 macroelements, MS-Fe salts, B5 microelements, B5 organics, NAA 0.1 mg / L, KT 4 mg / L, proline 500 mg / L, glutamine 500 mg / L, CH 300 mg / L, maltose / sucrose 30 g / L, gelrite 2.6 mg / L, cef. 250 mg / L, Hyg 50 mg / L, pH 5.8.

[0064] Rooting medium: 1 / 2 N6 macroelements, MS-Fe salt, B5 microelements, sucrose 30g / L, Agar 0.8%, pH 5.8.

[0065] 3.7. Identification of transgenic plants

[0066] The T0 generation transgenic plants obtained in step 3.6 were further identified by PCR. Using genomic DNA from fresh transgenic plant leaves as a template, HYG-F / HYG-R was amplified by hygromycin primers. A 324 bp band was amplified from the transgenic plants.

[0067] HYG-F: GTCCATCACAGTTTGCCAGT (SEQ ID NO.8);

[0068] HYG-R: AGATCGTTATGTTTATCGGCACT (SEQ ID NO. 9).

[0069] All T0 generation transgenic plants could amplify a 500bp band. ZH11, as the transgenic recipient, could not amplify a band because it did not have the sequence of the vector pIPKB003.

[0070] IV. Functional Verification of Genetically Modified Offspring

[0071] The T0 generation transgenic plants obtained in step two, along with the corresponding control varieties, were grown under natural field conditions. After maturity, the seeds were harvested, and the seeds were scanned using a ScanMarker i560 scanner. Seed length and width were measured using SC-G software, with at least 100 seeds from each material measured. The weight of 200 seeds from each material was then calculated using an analytical balance (Mettler, AL104) and converted to a thousand-seed weight.

[0072] like Figure 4 As shown, compared with the wild-type control (ZH11), transgenic rice plants overexpressing the GSE3.1 gene showed a significant increase in the three key yield traits of grain length, grain width, and thousand-grain weight.

Claims

1. The application of a gene overexpressing rice GSE3.1 protein, characterized in that, The application is any one of the following: A1) Application in simultaneously increasing rice grain length, grain width, and grain weight; A2) Application in cultivating rice with simultaneously increased grain length, grain width, and grain weight; The amino acid sequence of the GSE3.1 protein is shown in SEQ ID NO. 3; The nucleotide sequence of the gene encoding the GSE3.1 protein is shown in SEQ ID NO.

2.

2. Application of gene-related biomaterials overexpressing GSE3.1 protein, characterized in that, The application is any one of the following: B1) Application in simultaneously increasing rice grain length, grain width, and grain weight; B2) Application in cultivating rice with simultaneous increases in grain length, grain width, and grain weight; The biomaterial is any one of the following C1) to C3): C1) An expression cassette containing a nucleic acid molecule encoding the GSE3.1 protein; C2) A recombinant vector containing a nucleic acid molecule encoding the GSE3.1 protein; C3) A recombinant microorganism containing a nucleic acid molecule encoding the GSE3.1 protein, or a recombinant microorganism containing the expression cassette described in C1), or a recombinant microorganism containing the recombinant vector described in C2), wherein the microorganism is Agrobacterium; The amino acid sequence of the GSE3.1 protein is shown in SEQ ID NO. 3; The nucleotide sequence of the gene encoding the GSE3.1 protein is shown in SEQ ID NO.

2.

3. A method for cultivating rice with simultaneously increased grain length, grain width, and grain weight, characterized in that, The method involves overexpressing the gene for the GSE3.1 protein in rice to obtain rice with simultaneously increased grain length, grain width, and grain weight. The amino acid sequence of the GSE3.1 protein is shown in SEQ ID NO. 3, and the nucleotide sequence of the gene encoding the GSE3.1 protein is shown in SEQ ID NO.

2.

4. The method according to claim 3, characterized in that, The gene that overexpresses GSE3.1 protein in rice is obtained by using transgenic technology to increase the expression level of the gene encoding the GSE3.1 protein.

5. The method according to claim 4, characterized in that, The expression level of the gene encoding the GSE3.1 protein was increased by introducing a plant expression vector containing the nucleic acid molecule shown in SEQ ID NO. 2 into rice using transgenic technology.

Images