Indel molecular marker related to browning character of towel gourd pulp, detection primer and application of Indel molecular marker

Abstract

The invention discloses an Indel molecular marker related to the browning character of towel gourd pulp, a detection primer and application of the Indel molecular marker and the detection primer, and belongs to the field of molecular assisted genetic breeding. The Indel molecular marker is located at the 8045208 site of the No. 5 chromosome of a luffa cylindrica reference genome, the site has a 15bp insertion / deletion variation, and the genotype (homozygous insertion type / heterozygous vs. Homozygous deletion type) is highly consistent with the browning-resistant phenotype. A detection primer pair developed on the basis of the marker can accurately predict the browning characteristic of the fruit of the towel gourd through DNA detection in the early growth stage of the towel gourd, and transformation from phenotype selection to genotype selection is achieved. The invention provides a brand-new, accurate and reliable molecular tool for browning-resistant breeding of towel gourds.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular assisted genetic breeding, in particular to an Indel molecular marker related to the flesh browning trait of Lagenaria siceraria, a detection primer and an application thereof. BACKGROUND

[0002] As a widely cultivated vegetable crop, Lagenaria siceraria is prone to enzymatic browning of the pericarp and flesh during postharvest storage, transportation and processing. Browning not only seriously affects the appearance color, flavor, taste and nutritional quality of Lagenaria siceraria, but also significantly shortens its shelf life and reduces its commercial value, which restricts the healthy development of the Lagenaria siceraria industry. At present, physical treatment (such as low-temperature storage and modified atmosphere packaging) or chemical reagents (such as browning inhibitors) are mainly used to delay the browning process in production, but these methods have limited effect, high cost and food safety hazards, and cannot fundamentally solve the problem. Therefore, from the perspective of genetic improvement, breeding new varieties of Lagenaria siceraria with natural browning resistance is the fundamental way for sustainable development of the industry.

[0003] In breeding practice, the fruit browning phenotype of Lagenaria siceraria is regulated by multiple genes and is easily affected by the environment and harvest maturity. Traditional phenotype selection methods have long cycle, low efficiency and poor accuracy, which seriously restricts the breeding process of browning-resistant varieties. Molecular marker-assisted selection (MAS) can achieve early, accurate and efficient trait selection, which can greatly improve breeding efficiency. However, the current research on the genetic mechanism of Lagenaria siceraria browning resistance is not deep, there is no public report on the positioning and cloning of key genes of Lagenaria siceraria browning resistance by map-based cloning technology, and there is a lack of molecular markers that are closely linked to the browning-resistant trait and suitable for large-scale breeding populations. This situation has led to the long-term reliance on phenotype selection for Lagenaria siceraria browning resistance breeding, making it difficult to achieve precise selection and aggregation of target genotypes, limiting the breeding efficiency and variety improvement speed.

[0004] In recent years, the strategy of combining BSA-seq (Bulked Segregant Analysis sequencing) with QTL mapping based on sequencing has become an effective method for quickly locating important trait genes in crops. However, in the study of Lagenaria siceraria browning resistance, there are still the following technical difficulties: first, there is a lack of parent materials with significant trait differences and stable heredity, and suitable segregation populations; second, the browning resistance gene may be located in a genomic region with low recombination rate or complex structure, making fine mapping difficult; third, even if a candidate interval is located, it is still challenging to develop molecular markers that are suitable for different genetic backgrounds, simple to detect, low in cost and high in accuracy. Therefore, establishing a complete technical system from gene positioning to marker development is of great significance for promoting Lagenaria siceraria browning resistance molecular breeding. SUMMARY

[0005] The present application aims to provide an Indel molecular marker related to the flesh browning trait of Luffa aegyptiaca, a detection primer and an application thereof, so as to solve the problems in the prior art. The Indel molecular marker Lcfbr and the detection primer thereof provided by the present application can accurately and early identify the flesh browning trait of Luffa aegyptiaca. The marker changes the traditional phenotype-dependent breeding into genotype selection, solves the problems of long breeding cycle and low efficiency, and provides key technical support for rapid breeding of high-quality browning-resistant Luffa aegyptiaca varieties.

[0006] To achieve the above-mentioned purpose, the present application provides the following solutions.

[0007] The present application provides a primer pair for detecting an Indel molecular marker related to the flesh browning trait of Luffa aegyptiaca, wherein the primer pair comprises a forward primer Lcfbr-F with a nucleotide sequence as shown in SEQ ID NO. 1 and a reverse primer Lcfbr-R with a nucleotide sequence as shown in SEQ ID NO. 2.

[0008] The Indel molecular marker is located at position 8045208 of chromosome 5 of Luffa cylindrica cv. P93075 reference genome, and a mutation formed by insertion or deletion of a sequence as shown in SEQ ID NO. 5 exists at the site.

[0009] The present application also provides a kit for detecting an Indel molecular marker related to the flesh browning trait of Luffa aegyptiaca, comprising the primer pair.

[0010] Further, at least one of a buffer solution, a DNA polymerase and dNTPs required for PCR amplification reaction is further included.

[0011] The present application also provides an application of the primer pair or the kit in any one of the following aspects:

[0012] (a) detecting the genotype of the Indel molecular marker in a Luffa aegyptiaca sample to be tested;

[0013] (b) identifying or predicting the flesh browning trait of Luffa aegyptiaca;

[0014] (c) screening of Luffa aegyptiaca browning-resistant germplasm;

[0015] (d) molecular marker-assisted breeding of Luffa aegyptiaca browning-resistant trait improvement.

[0016] Further, when the genotype of the site where the Indel molecular marker is located is homozygous insertion type or heterozygous type containing the sequence as shown in SEQ ID NO. 5, the Luffa aegyptiaca is browning-resistant; when the genotype of the site where the Indel molecular marker is located is homozygous deletion type not containing the sequence as shown in SEQ ID NO. 5, the Luffa aegyptiaca is not browning-resistant.

[0017] This invention also provides a method for identifying browning characteristics of loofah pulp, comprising the following steps:

[0018] (1) Extract genomic DNA from the loofah sample to be tested;

[0019] (2) Using the DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described above;

[0020] (3) Detect the PCR amplification product of step (2) and determine the genotype of the Indel molecular marker according to the size of the amplified fragment; when the length of the amplified fragment is 195 bp, the genotype is determined to be homozygous insertion type; when the length of the amplified fragment is 180 bp, the genotype is determined to be homozygous deletion type; when two bands of 195 bp and 180 bp appear at the same time, the genotype is determined to be heterozygous type.

[0021] The flesh of loofah with a homozygous insert genotype is resistant to browning;

[0022] The flesh of loofah with homozygous deletion or heterozygous genotypes is not resistant to browning.

[0023] Furthermore, the PCR amplification reaction system is as follows: 1 μL DNA template, 0.5 μL each of 10 μM upstream and downstream primers, 5 μL 2× Es Taq Master Mix, and 3 μL ddH2O.

[0024] Furthermore, the PCR amplification reaction procedure is as follows: pre-denaturation at 95℃ for 5 min; then 30 cycles, each cycle consisting of 95℃ for 30 s, 53℃ for 30 s, and 72℃ for 30 s; and finally extension at 72℃ for 5 min.

[0025] This invention also provides a method for breeding brown-resistant loofah germplasm, comprising the following steps:

[0026] (1) Extract genomic DNA from the loofah sample to be tested;

[0027] (2) Using the DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described above;

[0028] The PCR amplification product of step (2) is detected, and the genotype of the Indel molecular marker is determined according to the size of the amplified fragment. When the length of the amplified fragment is 195 bp, the genotype is determined to be homozygous insertion type. When the length of the amplified fragment is 180 bp, the genotype is determined to be homozygous deletion type. When two bands of 195 bp and 180 bp appear at the same time, the genotype is determined to be heterozygous type.

[0029] The flesh of loofah with a homozygous insert genotype is resistant to browning;

[0030] The flesh of loofah with a homozygous deletion genotype or heterozygous genotype is not resistant to browning.

[0031] Select germplasm with homozygous insertion type genotype for subsequent breeding and propagation.

[0032] Furthermore, the PCR amplification reaction system is as follows: 1 μL DNA template, 0.5 μL each of 10 μM upstream and downstream primers, 5 μL 2× Es Taq Master Mix, and 3 μL ddH2O.

[0033] Furthermore, the PCR amplification reaction procedure is as follows: pre-denaturation at 95℃ for 5 min; then 30 cycles, each cycle consisting of 95℃ for 30 s, 53℃ for 30 s, and 72℃ for 30 s; and finally extension at 72℃ for 5 min.

[0034] The present invention discloses the following technical effects:

[0035] This invention marks the first time that an Indel molecular marker (Lcfbr) closely linked to the browning trait in sponge gourd flesh has been located and identified, and provides its specific detection primer pair. This marker directly corresponds to a 15 bp insertion / deletion variant in the sponge gourd genome, and the genotype (homozygous insertion / heterozygous vs. homozygous deletion) is highly consistent with the browning-resistant phenotype, providing a novel, precise, and reliable molecular tool for breeding browning-resistant sponge gourd.

[0036] The detection method and kit developed based on this marker are simple to operate and low in cost. They can accurately predict the browning characteristics of loofah fruit through DNA detection in the early stages of loofah growth, realizing the transformation from "phenotypic selection" to "genotypic selection". This effectively overcomes the problems of long cycle, low efficiency and poor accuracy caused by the reliance on late-stage phenotypic identification and susceptibility to environmental influences in traditional breeding methods. It significantly improves the efficiency and accuracy of breeding selection and can accelerate the breeding process of high-quality browning-resistant loofah varieties. Attached Figure Description

[0037] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0038] Figure 1 Sequence differences at Lcfbr marker sites in parental materials (2D-2 and 35D-7);

[0039] Figure 2A plot showing the differences in bands between intermediate breeding materials labeled with Lcfbr. Detailed Implementation

[0040] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0041] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0042] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0043] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0044] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0045] Example 1: Obtaining molecular markers associated with browning of loofah fruit

[0046] 1. Location of loci associated with browning in loofah fruit

[0047] The short-stemmed, fleshy loofah variety '35D-7', which is prone to browning, and the early-maturing loofah variety '2D-2', which is resistant to browning, were used as parent materials for hybridization to obtain F1 seeds. All F1 plants were self-pollinated to obtain the F2 segregating population. This population was used for subsequent genetic analysis and gene mapping.

[0048] Browning phenotype identification was performed on the F2 population fruits at commercial maturity (Table 3). Based on the phenotypic identification results, extreme browning and extreme non-browning plants were selected from the F2 population, and genomic DNA was extracted from their young leaves. After detecting the DNA concentration and purity using NanoDrop, the DNA from each type of plant was mixed in equal amounts to construct a browning pool and a non-browning pool. DNA was also extracted from the two parental lines '35D-7' and '2D-2' as controls.

[0049] Whole-genome resequencing was performed on two parents and two extreme pools (Illumina Nova Seq platform, PE150). After quality control, the sequencing data were aligned to the Luffa cylindricacv. P93075 using BWA software. SNP / InDel variant detection and screening were performed using SAMtools and BCFtools.

[0050] The ΔSNP-index (the difference between the SNP-index of the browning pool and the non-browning pool) at various locations in the genome was calculated for the two extreme pools, and their distribution across the entire genome was plotted. A 99% confidence interval was set as the threshold to screen genomic regions where the ΔSNP-index significantly deviated from 0. The analysis identified a significant candidate region on chromosome 5, with a physical location of 3.57 Mb – 9.48 Mb.

[0051] Further analysis of sequence polymorphism between parents within the candidate region revealed a stable insertion / deletion (InDel) variant, named Lcfbr. This variant is located at position 8045208 on chromosome 5, and in the reference genome, it is an insertion sequence “TAGTTTACTATTTTC” (15 bp, SEQ ID NO. 5). Parental genotypic analysis showed that the browning-resistant parent '2D-2' had a homozygous insertion genotype at this locus, i.e., the 15 bp sequence was present (denoted as allele 1, genotype 1 / 1); the browning-prone parent '35D-7' had a homozygous deletion genotype at this locus (denoted as allele 2, genotype 2 / 2). Figure 1 As shown.

[0052] 2. Design of primers for amplifying InDel variant sites

[0053] Based on the InDel variant sites identified above, a set of specific primers was designed as follows:

[0054] Lcfbr-F: TGATTCTGTCCCAAAAAGATGG, SEQ ID NO.1;

[0055] Lcfbr-R: TCTCGTCCCACGCATTAGAA, SEQ ID NO. 2.

[0056] 3. Molecular marker verification

[0057] DNA was extracted from leaf samples using parental lines '35D-7' and '2D-2' as testing materials, following these steps:

[0058] (1) Take loofah leaves into a centrifuge tube, add 2 2mm steel balls, grind in liquid nitrogen, grind at 35HZ for 40 s;

[0059] (2) Add 800 μL of CTAB extraction buffer to the centrifuge tube, invert and mix well, incubate at 65℃ for 30 min, inverting and mixing once every 10 min during the incubation period.

[0060] (3) In a fume hood, add an equal volume of chloroform:isoamyl alcohol (24:1) mixture to each sample, mix by inverting the tube, and centrifuge at 12,000 rpm for 10 min. Take 700 μL of the supernatant and add it to a 1.5 mL centrifuge tube containing 700 μL of isopropanol. Mix gently and place in a -20℃ freezer for precipitation for at least 20 min.

[0061] (5) Centrifuge at 10,000 rpm for 8 min, discard the supernatant, and add 200 μL of 70% ethanol to each sample to wash the precipitate. Centrifuge at 10,000 rpm for 5 min, discard the supernatant, invert the centrifuge tube on absorbent paper to remove excess liquid, and place it in a fume hood to dry for more than 1 hour.

[0062] (6) Add 100-200 μL of sterile water to each sample and place at 4℃ for 1 day or heat at 65℃ for 15 min before use.

[0063] Using the genomic DNA of the loofah to be tested as a template, PCR amplification was performed using Lcfbr-F and Lcfbr-R primers; the PCR amplification system is shown in Table 1:

[0064] Table 1 PCR amplification system

[0065]

[0066] The PCR amplification procedure is shown in Table 2:

[0067] Table 2 PCR amplification program

[0068]

[0069] The PCR amplification products were detected by polyacrylamide gel electrophoresis, as follows:

[0070] (1) Gel preparation: Prepare a 7% polyacrylamide gel solution. The prepared polyacrylamide gel needs to be placed on a magnetic stirrer and stirred continuously to prevent solidification. Place a pair of glass plates used to prepare the polyacrylamide gel horizontally on the table, fix the two ends of the glass plates with clamps, slowly pour the prepared polyacrylamide gel along one side, try to avoid generating air bubbles, insert a comb, and let it stand for about 30 minutes until the gel turns white and solidifies.

[0071] (2) Sample loading: Place the glass plate correctly in the electrophoresis tank with the long side facing outwards and the short side facing inwards, and fix both ends with clamps. Add 1×TBE solution to the electrophoresis tank until it covers the short side of the glass plate, and slowly remove the comb. Add 0.5 μL of 10×loading buffer to the PCR amplification product, and use a pipette to load 1.3 μL of sample into the sample well. Connect the electrophoresis tank and electrophoresis apparatus correctly, and perform electrophoresis at 160V for 1 hour and 40 minutes.

[0072] (3) Staining and development: After electrophoresis, remove the glass plate, mark the edge of the gel with a pipette tip, place the gel in deionized water, and then transfer it to the staining solution (1 g silver nitrate, 1 L deionized water) for staining for 5 min. After staining, rinse with deionized water. Then transfer it to the developing solution (10 g sodium hydroxide, 2 mL formaldehyde, 1 L deionized water) for development until the bands are clear. After rinsing with deionized water, lay it flat on a gel lamp to observe the band pattern and take pictures for recording.

[0073] (4) Reading bands: The non-browning parent '2D-2' amplified a 195bp band (SEQ ID NO.3), and the browning parent '35D-7' amplified a 180bp band (SEQ ID NO.4).

[0074] SEQ ID NO.3:

[0075]

[0076] SEQ ID NO.4:

[0077]

[0078] Example 2: Validation of molecular markers associated with browning of loofah fruit in the 2D-2×35D-7 F2 population.

[0079] Using parental lines '35D-7' and '2D-2', as well as the constructed 2D-2×35D-7 F2 population, as test materials, leaf genomic DNA was used as a template, and PCR amplification was performed using Lcfbr-F and Lcfbr-R primers. The amplification products were detected by polyacrylamide gel electrophoresis, following the same procedure as in Example 1. Genotypes were statistically analyzed based on the detected bands. The genotype of parental line 2D-2 was recorded as 1, and the genotype of parental line 35D-7 was recorded as 2. In the 2D-2×35D-7 F2 population, the genotype consistent with the banding pattern of the non-browning material 2D-2 was recorded as 1, the genotype consistent with the banding pattern of the browning material 35D-7 was recorded as 2, and the heterozygous genotype was recorded as 12. When calculating the browning phenotype, the phenotype of materials with completely non-browning fruits was considered as non-browning, and the phenotype of materials with browning fruits was uniformly considered as browning. The genotype and phenotype detection results of the tested materials are shown in Table 3.

[0080] Table 3. Genotypic and phenotypic results of the 2D-2×35D-7 F2 population.

[0081]

[0082] Example 3: Validation of molecular markers associated with browning of loofah fruit in the 2D-2×35D-7 BC1 population.

[0083] Using parental lines '35D-7' and '2D-2', as well as the constructed 2D-2×35D-7 BC1 population, as test materials, leaf genomic DNA was used as a template, and PCR amplification was performed using Lcfbr-F and Lcfbr-R primers. The amplification products were detected by polyacrylamide gel electrophoresis, following the same procedure as in Example 1. Genotypes were statistically analyzed based on the detected bands. The genotype of parental line 2D-2 was recorded as 1, and the genotype of parental line 35D-7 was recorded as 2. In the 2D-2×35D-7 BC1 population, the genotype consistent with the banding pattern of the non-browning material 2D-2 was recorded as 1, the genotype consistent with the banding pattern of the browning material 35D-7 was recorded as 2, and the heterozygous genotype was recorded as 12. When statistically analyzing the browning phenotype, the phenotype of materials with completely non-browning fruits was considered as non-browning, and the phenotype of materials with browning fruits was uniformly considered as browning. The genotype and phenotype detection results of the tested materials are shown in Table 4.

[0084] Table 4. Genotypic and phenotypic results of the 2D-2×35D-7 BC1 population

[0085]

[0086] Example 4: Validation of molecular markers associated with browning of loofah fruit in intermediate breeding materials

[0087] Using parental lines '35D-7' and '2D-2', as well as intermediate breeding materials, as test materials, leaf genomic DNA was used as a template, and PCR amplification was performed using Lcfbr-F and Lcfbr-R primers. The amplification products were detected by polyacrylamide gel electrophoresis, following the same procedure as in Example 1. Genotypes were statistically analyzed based on the detected bands. The genotype of parental line 2D-2 was recorded as 1, the genotype of parental line 35D-7 as 2, and among the intermediate breeding materials, the genotypes with the same band pattern as the non-browning material 2D-2 were recorded as 1, the genotypes with the same band pattern as the browning material 35D-7 as 2, and heterozygous genotypes as 12. For browning phenotype analysis, the phenotype of materials with completely non-browning fruits was considered as non-browning, and the phenotype of materials with browning fruits was uniformly considered as browning. The genotype and phenotype detection results of the tested materials are shown in Table 5. Polyacrylamide gel electrophoresis images of some tested materials are shown below. Figure 2 As shown.

[0088] The intermediate breeding materials are as follows: LOD series is a high-generation inbred line separated from black-seeded loofah after 5 generations of self-pollination; LOR series is a high-generation inbred line separated from round loofah after 5 generations of self-pollination; LCX series is an inbred line separated from Tongan loofah after 3 generations of self-pollination; LZB series is an inbred line separated from Changsha loofah after 2 generations of self-pollination; LZL series is an inbred line separated from fat-head loofah after 2 generations of self-pollination; LOB series is an inbred line separated from round loofah and Changsha loofah after 4 generations of self-pollination; LOC series is an inbred line separated from Zhuzhou loofah and Nantong loofah after 5 generations of self-pollination; LOL series is a high-generation inbred line separated from long loofah after 5 generations of self-pollination; LY series is a high-generation inbred line separated from summer loofah after 6 generations of self-pollination; LJ series is a high-generation inbred line separated from short loofah after 5 generations of self-pollination; and 9D1-27-9-14 is an inbred line separated from fragrant loofah after 4 generations of self-pollination. All the above materials are from the seed bank of Jiangsu Academy of Agricultural Sciences.

[0089] Table 5. Results of genotypic and phenotypic detection of intermediate breeding materials

[0090]

[0091] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer pair for detecting Indel molecular markers associated with browning traits in loofah flesh, characterized in that, The primer pair includes a forward primer Lcfbr-F with a nucleotide sequence as shown in SEQ ID NO.1 and a reverse primer Lcfbr-R with a nucleotide sequence as shown in SEQ ID NO.2; The Indel molecular marker is located at position 8045208 on chromosome 5 of the Luffa cylindrica cv. P93075 reference genome, at which there is a mutation formed by the insertion or deletion of the sequence shown in SEQ ID NO.

5.

2. A kit for detecting Indel molecular markers associated with browning traits in loofah pulp, characterized in that, It includes the primer pair as described in claim 1.

3. The reagent kit according to claim 2, characterized in that, It also contains at least one of the following: buffer, DNA polymerase, and dNTPs required for PCR amplification.

4. The use of the primer pair of claim 1 or the kit of any one of claims 2-3 in any of the following: (a) Detecting the genotype of the Indel molecular marker in the loofah sample to be tested; (b) Identify or predict the browning trait of loofah flesh; (c) Screening of browning-tolerant germplasm resources of loofah; (d) Molecular marker-assisted breeding for improving the browning tolerance trait of loofah.

5. The application according to claim 4, characterized in that, When the genotype at the site where the Indel molecular marker is located is a homozygous insertion or heterozygous type containing the sequence shown in SEQ ID NO.5, the loofah is resistant to browning; when the genotype at the site where the Indel molecular marker is located is a homozygous deletion type not containing the sequence shown in SEQ ID NO.5, the loofah is not resistant to browning.

6. A method for identifying the browning trait of loofah flesh, characterized in that, Includes the following steps: (1) Extract genomic DNA from the loofah sample to be tested; (2) Using the DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 1; (3) Detect the PCR amplification product of step (2) and determine the genotype of the Indel molecular marker according to the size of the amplified fragment; when the length of the amplified fragment is 195 bp, the genotype is determined to be homozygous insertion type; when the length of the amplified fragment is 180 bp, the genotype is determined to be homozygous deletion type; when two bands of 195 bp and 180 bp appear at the same time, the genotype is determined to be heterozygous type. The flesh of loofah with a homozygous insert genotype is resistant to browning; The flesh of loofah with homozygous deletion or heterozygous genotypes is not resistant to browning.

7. The method according to claim 6, characterized in that, The PCR amplification reaction system consisted of: 1 μL DNA template, 0.5 μL each of 10 μM upstream and downstream primers, 5 μL 2 × Es Taq Master Mix, and 3 μL ddH2O.

8. The method according to claim 6, characterized in that, The PCR amplification reaction procedure is as follows: pre-denaturation at 95℃ for 5 min; then 30 cycles, each cycle consisting of 95℃ for 30 s, 53℃ for 30 s, and 72℃ for 30 s; and finally extension at 72℃ for 5 min.

9. A method for breeding brown-change-resistant loofah germplasm, characterized in that, Includes the following steps: (1) Extract genomic DNA from the loofah sample to be tested; (2) Using the DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 1; The PCR amplification product of step (2) is detected, and the genotype of the Indel molecular marker is determined according to the size of the amplified fragment; when the length of the amplified fragment is 195 bp, the genotype is determined to be homozygous insertion; when the length of the amplified fragment is 180 bp, the genotype is determined to be homozygous deletion; when two bands of 195 bp and 180 bp appear at the same time, the genotype is determined to be heterozygous. The flesh of loofah with a homozygous insert genotype is resistant to browning; The flesh of loofah with a homozygous deletion genotype or heterozygous genotype is not resistant to browning. Select germplasm with homozygous insertion type genotype for subsequent breeding and propagation.

10. The method according to claim 9, characterized in that, The PCR amplification reaction system consisted of: 1 μL DNA template, 0.5 μL each of 10 μM upstream and downstream primers, 5 μL 2 × Es Taq Master Mix, and 3 μL ddH2O. The PCR amplification reaction program was as follows: pre-denaturation at 95℃ for 5 min; followed by 30 cycles, each cycle consisting of 95℃ for 30 s, 53℃ for 30 s, and 72℃ for 30 s; and finally extension at 72℃ for 5 min.

Images