Ankle striatus and application and method thereof in plant disease control and plant growth promotion

By isolating and fermenting ZDXH-8, a fungal agent obtained from Andrographis paniculata leaves, can effectively prevent and control a variety of plant diseases and promote rice growth. This solves the problems of single function and unstable efficacy in existing technologies and achieves the effects of preventing and controlling rice blast and promoting growth.

CN121495718APending Publication Date: 2026-02-10XIANGHU LABORATORY
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202610031903.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-12
Publication Date
2026-02-10

AI Technical Summary

Technical Problem

Current technologies have not yet provided in-depth research on the functions of *Hylocereus*, especially *Hylocereus stripe*, in controlling various plant diseases and promoting plant growth. Furthermore, biocontrol strains have limited functionality and unstable efficacy.

Method used

A strain of *Talaromyces striatoconidius* ZDXH-8 was isolated from the leaves of *Andrographis paniculata*. A microbial agent was obtained through fermentation culture and applied to inhibit plant pathogens and promote plant growth. Specific methods include spraying or root drenching.

Benefits of technology

It significantly inhibits plant pathogens such as rice blast fungus and Fusarium graminearum, effectively preventing and controlling diseases such as rice blast, while promoting rice plant growth and increasing plant height and root length.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121495718A_ABST
    Figure CN121495718A_ABST
Patent Text Reader

Abstract

The invention discloses a strain of malleolus striatus as well as application and a method of the malleolus striatus in plant disease control and plant growth promotion. According to the invention, a strain of malleolabrax striata ZDXH-8 is separated from leaves of andrographis paniculata, and tests prove that the strain can significantly inhibit pyricularia oryzae, fusarium graminearum and fusarium oxysporum tomato specialized types, and can promote the growth of rice plants at the same time. The strain is wide in application range, can be used for preventing and treating plant diseases, particularly rice blast, wheat scab and tomato fusarium wilt, can also be used for promoting the growth of rice plants, and has good application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a striped ankle fungus and its application and methods in plant disease control and plant growth promotion. Background Technology

[0002] *Talaromyces* is a widely distributed filamentous fungus commonly found in soil, plant roots, and decaying organic matter. Recent studies have revealed that some strains of this genus can produce various bioactive secondary metabolites, such as antibiotics and enzymes, showing potential applications in agriculture and medicine. In agriculture, reports have indicated that certain *Talaromyces* species exhibit antagonistic effects against certain plant pathogens. However, current research on *Talaromyces*, particularly *Talaromyces streakedatum*, remains limited. Talaromyces striatoconidius Research on the biocontrol function of ) is not yet in-depth, and its dual function in actual agricultural production, especially in the prevention and control of various plant diseases and the promotion of plant growth, has not yet been systematically reported or clearly confirmed. Summary of the Invention

[0003] Based on the aforementioned prior art, this invention provides a striped ankle fungus and its application and method in plant disease control and plant growth promotion. Specifically, this invention isolates a striped ankle fungus (…) from the leaves of *Andrographis paniculata*. T. striatoconidius ZDXH-8, through experimental verification, has been shown to have a strong ability to inhibit the growth of plant pathogens such as rice blast fungus, Fusarium graminearum, and Fusarium oxysporum tomato-specific strain, and can effectively promote rice growth. Based on the above research results, this invention was completed.

[0004] This invention provides a novel strain of *Strombus striata* (Sterculiae striatae). T. striatoconidius This strain not only exhibits significant and stable antagonistic effects against various plant pathogenic fungi, effectively controlling plant diseases caused by these pathogens, but also demonstrates excellent plant growth-promoting capabilities, achieving a dual effect of "disease prevention" and "growth promotion." The purpose of this invention is to overcome the shortcomings of existing biocontrol strains, such as limited functionality and unstable efficacy, and to provide a multifunctional, highly efficient, and environmentally friendly microbial resource, laying the foundation for the development of novel microbial fertilizers and biopesticides.

[0005] To achieve the above-mentioned technical objectives, the present invention relates to the following technical solutions: 1. A strain of *Arthropoda stylosa*, named *Arthropoda stylosa*. Talaromyces striatoconidius ZDXH-8, abbreviated as T. striatoconidiusIt was isolated from the leaves of Andrographis paniculata and deposited at the China General Microbiological Culture Collection Center (address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, China) on September 28, 2025, with accession number CGMCC No. 42229.

[0006] II. A fermentation production method for *Arthropoda stylosa*, the fermentation production method comprising: inoculating the *Arthropoda stylosa* into a fermentation medium for fermentation culture.

[0007] III. A microbial agent, said microbial agent containing *Mallotus stripe* (…). T. striatoconidius ZDXH-8 or the fermentation product obtained by the method.

[0008] IV. Application of microbial agents, specifically in any one of the following (a)-(c): (a) Inhibit plant pathogens; (b) Prevention and control of plant diseases; (c) Promote plant growth.

[0009] The plants mentioned are mainly agricultural crops.

[0010] The plant pathogens are rice blast fungus, Fusarium graminearum, and Fusarium oxysporum tomato-specific strain; the plant diseases are rice blast, wheat scab, and tomato wilt.

[0011] The promotion of plant growth specifically manifests as increasing plant height and root length.

[0012] The plant in question is primarily rice.

[0013] V. A method for preventing and controlling rice blast and promoting rice plant growth, the method comprising spraying or drenching rice plants with fungal agents such as *Strombus striata*.

[0014] The concentration of the inoculant during spraying or root drenching was 6.7% and 13.3%, respectively.

[0015] This invention isolates a striped ankle fungus ZDXH-8 from the leaves of Andrographis paniculata. Experiments have shown that this strain can significantly inhibit rice blast fungus, Fusarium graminearum, and Fusarium oxysporum tomato-specific strain, while promoting rice plant growth.

[0016] The strains involved in this invention have a wide range of applications. They can be used to control plant diseases, especially rice blast, wheat scab, and tomato wilt, and can also be used to promote rice plant growth, thus having good application value.

[0017] Beneficial technical effects of the present invention: The above technical solution isolated a striped ankle fungus from the leaves of Andrographis paniculata (Andrographis paniculata). T. striatoconidiusZDXH-8 has been proven through experiments to significantly inhibit rice blast fungus, effectively prevent and control rice blast disease, and promote rice plant growth.

[0018] In summary, this strain has a wide range of applications. It can be used for the prevention and control of plant diseases, especially rice blast, and for promoting rice plant growth, thus effectively expanding its application areas and demonstrating good practical application value. Attached Figure Description

[0019] Figure 1 This is a colony morphology diagram of strain ZDXH-8 in an embodiment of the present invention.

[0020] Figure 2 In this embodiment of the invention, the Neighbour-Joining method was used to construct a phylogenetic tree of ZDXH-8 and other standard species of the genus Basilaria.

[0021] Figure 3 This invention demonstrates the antibacterial effect of strain ZDXH-8 against rice blast fungus, Fusarium graminearum, and Fusarium oxysporum in tomato.

[0022] Figure 4 This invention demonstrates the specialized antibacterial effect of the crude extract of strain ZDXH-8 fermentation on tomato-specific fungi such as rice blast fungus, Fusarium graminearum, and Fusarium oxysporum.

[0023] Figure 5 This invention demonstrates the inhibitory effect of the crude extract of strain ZDXH-8 fermentation on rice blast on detached barley leaves in this embodiment of the invention.

[0024] Figure 6 The results of strain ZDXH-8 promoting rice plant growth in the embodiments of the present invention are shown. A represents the growth status of the control group, the 6.7% fermentation broth treatment group, and the 13.3% fermentation broth treatment group on the 10th and 21st days. B represents the statistical analysis results of plant height of the control group and the treatment group on the 21st day. C represents the statistical analysis results of root length of the control group and the treatment group on the 21st day. Detailed Implementation

[0025] In a typical embodiment of the present invention, a strain of *Arthropoda stylosa* is provided. T. striatoconidius ZDXH-8, this strain was deposited on September 28, 2025 at the China General Microbiological Culture Collection Center (address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, China), with the biological accession number CGMCC No. 42229.

[0026] In another specific embodiment of the present invention, the above-mentioned striped anklebacterium is provided ( T. striatoconidiusThe fermentation production method of ZDXH-8 includes: fermenting the striped anklebacterium (ZDXH-8) into a solution of ZDXH-8. T. striatoconidius ZDXH-8 was inoculated into the fermentation medium for fermentation culture.

[0027] The fermentation medium can be any culture medium for culturing fungi. In one specific embodiment of the present invention, the culture medium is either MMYC medium or rice medium.

[0028] In another specific embodiment of the present invention, a bacterial agent is provided, the bacterial agent containing *Ankylostella striata* (…). T. striatoconidius ZDXH-8 or its fermentation products.

[0029] In this invention, the term "fermentation product" is used to refer to fermentation products. The corresponding fermentation product may be derived from the fermentation culture of *Strombus striatum* (…). T. striatoconidius The liquid obtained from the ZDXH-8 process, therefore, can also be called fermentation broth. The liquid may contain fungi (cells) and bacteria derived from *Strombus amygdalinus* (…). T. striatoconidius Metabolites produced by ZDXH-8.

[0030] In embodiments of the present invention, the fermentation broth or culture medium containing bacterial cells is centrifuged, filtered, or otherwise known in the art to separate the bacterial cells growing in the fermentation broth or culture medium from the liquid. The liquid remaining after removing the bacterial cells is called the "supernatant." In the present invention, the supernatant contains *Strombus striatum* (a type of bacteria). T. striatoconidius The extracellular metabolites of ZDXH-8. In embodiments of the present invention, the bacterial agent may also contain this supernatant.

[0031] Furthermore, in embodiments of the present invention, the fermentation broth or culture medium containing bacterial cells is centrifuged, filtered, or otherwise known in the art to separate the bacterial cells growing in the fermentation broth or culture medium from the liquid to obtain bacterial cells. The bacterial cells can be broken up to obtain bacterial fragments. The breaking method can be ultrasound (e.g., ice bath ultrasound to break up cells) or other methods known in the art. Alternatively, further, the bacterial fragments are centrifuged to collect the supernatant, which is referred to as the cell-free extract. In the present invention, the bacterial fragments or cell-free extract contain *Strombus striatum* (a type of bacteria). T. striatoconidius The intracellular metabolites of ZDXH-8. In embodiments of the present invention, the bacterial agent may also contain fragments of the bacterial cells or cell-free extracts.

[0032] Furthermore, in embodiments of the present invention, for ease of storage and transportation, and to improve the survival rate of the strains, the inoculum can also be a solid (such as a powder), and more specifically, a lyophilized powder. That is, for the aforementioned *Ankylostella striata* (… T. striatoconidius ZDXH-8 or its fermentation product is further freeze-dried. The freeze-drying technology (including vacuum freeze-drying technology) can be carried out by conventional methods, which will not be described in detail here.

[0033] In another specific embodiment of the present invention, the microbial agent may further include excipients acceptable in the field of microbial agents.

[0034] In another specific embodiment of the present invention, the excipients are selected from one or more of dispersants, wetting agents, disintegrants, binders, defoamers, thickeners, fillers, and solvents. The present invention does not impose any special restrictions on the sources of acceptable excipients for the bacterial agent; generally, commercially available products are sufficient.

[0035] The dispersant is an anionic or nonionic dispersant, and may be selected from one or more of sodium lignosulfonate, sodium naphthalenesulfonate formaldehyde condensate, sodium methylene bisnaphthalenesulfonate, formaldehyde condensate sulfate, polycarboxylate, alkylphenol polyoxyethylene phosphate, and fatty acid polyoxyethylene ester.

[0036] The wetting agent may be selected from one or more of sodium dodecyl sulfate, sodium dodecylbenzene sulfonate, soapberry powder, tea seed cake powder, and splitting powder BX.

[0037] The disintegrant may be selected from one or more of bentonite, aluminum chloride, magnesium chloride, and glucose.

[0038] The binder may be selected from one or more of starch, diatomaceous earth, cyclodextrin, rosin, carboxymethyl cellulose, and carboxymethyl cellulose salts.

[0039] The defoamer may be selected from one or more of C8-C20 fatty alcohol compounds, epoxidized soybean oil, ethanol, silicone compounds, and organosilicon oils.

[0040] The thickener may be selected from one or more of xanthan gum, polyethylene glycol, and polyvinyl alcohol.

[0041] The filler may be selected from one or more of light calcium carbonate, diatomaceous earth, attapulgite, and silica.

[0042] The solvent may be water or methyl oleate.

[0043] In another specific embodiment of the present invention, the above-mentioned striped anklebacterium is provided ( T. striatoconidius The application of ZDXH-8 or the microbial agent in any one or more of the following (a)-(c): (a) Inhibit plant pathogens; (b) Suppressing plant diseases; (c) Promote plant growth.

[0044] The plant pathogens mentioned can be rice blast fungus, Fusarium graminearum, or Fusarium oxysporum tomato-specific strain. The plant diseases mentioned can be rice blast, wheat scab, and tomato wilt.

[0045] The promotion of plant growth specifically manifests as increasing plant height and root length.

[0046] The plant in question is primarily rice.

[0047] In another specific embodiment of the present invention, a method for preventing and controlling rice blast and promoting rice plant growth is provided, the method comprising applying the above-mentioned *Strombus striatum* (a type of fungus) to rice plants. T. striatoconidius Apply ZDXH-8 or the above-mentioned microbial agents by spraying or drenching.

[0048] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention.

[0049] Example 1: A strain of *Arthrobacter striata* ( T. striatoconidius Isolation, purification and identification of ZDXH-8 1.1 Materials Experimental sample: Andrographis paniculata leaf sample from Xishuangbanna, Yunnan Province.

[0050] Required culture media: MMYC medium, rice medium, PDA medium.

[0051] Required rice variety: Nipponbare.

[0052] 1.2 Isolation and Culture of Strains The collected Andrographis paniculata plant tissue samples were placed in 75% ethanol and sterile water in sequence. The surface water was wiped dry with sterile filter paper, and the leaves were cut into small pieces and inserted into PDA medium. Based on the growth characteristics of the colonies, such as color, size, degree of elevation, and whether the edges are regular, single colonies were picked and streaked on PDA medium. The purification was repeated three times to obtain pure culture strains.

[0053] ZDXH-8 was inoculated onto PDA medium and cultured at 28 ℃ for 3-5 days. Single colonies of this strain showed white mycelium at the edge and yellow or light green in the center. Figure 1 ).

[0054] 1.3 Identification of strains ① Streak the strain onto fresh PDA medium and incubate at 28°C for 4-6 days. Scrape off the hyphae, grind them in liquid nitrogen, and extract the fungal DNA using the Tiangen Plant Genome Extraction Kit.

[0055] ② Using genomic DNA as a template, the ITS sequence of the strain was amplified using universal primers for fungal ITS sequencing (ITS1: TCCGTAGGTGAACCTGCGG; ITS4: TCCTCGCTTATTGATATGC, SEQ ID No. 2 and SEQ ID No. 3, respectively). The PCR system volume was 12.5 mL. μ L I-5 TM 2×High-Fidelity Master Mix; 1 μ L primer F;1 μ Lprimer R;1 μ L template; 9.5 μ L dd H2O. The reaction conditions were: pre-denaturation 98 ℃, 2 min; 98 ℃, 10 s, 59 ℃, 10 s, 72 ℃, 15 s, 30 cycles; extension 72 ℃, 2 min. The PCR products were analyzed by agarose gel electrophoresis, and the obtained fragments were sequenced.

[0056] ③ The sequences obtained from sequencing were aligned on the NCBI website, and a phylogenetic tree was constructed using MEGA 11 software. The taxonomic position of the strain was finally determined based on the similarity and position in the phylogenetic tree.

[0057] ITS gene sequencing yielded a 568 bp sequence. The ITS gene sequence of strain ZDXH-8 is SEQ ID No. 1.

[0058] The obtained sequence was compared with the NCBI database, and it was found that ZDXH-8 was associated with *Arthropoda stylosa* (…). Talaromyces striatoconidius The highest similarity (99.12%) was found in CBS 550.89. A phylogenetic tree was constructed by comparing ZDXH-8 with the ITS sequences of other standard fungi in the genus *Hylocereus* and family *Hylocereus*. Figure 2 It was discovered that ZDXH-8 and *Arthrozoa stylosa* clustered together, and ZDXH-8 was ultimately identified as *Arthrozoa stylosa*.

[0059] 1.4 Preservation of microbial strains The purified strain was cut into strips from the PDA plate and added to a 2 mL cryovial containing 1.6 mL of sterile glycerol preservation solution (20% glycerol). The strain was stored at -80°C and sent to the China General Microbiological Culture Collection Center (CGMCC) with preservation number CGMCC No. 42229.

[0060] Example 2: Determination of the antibacterial activity of *Strombus striata* ZDXH-8 and its fermentation products against several plant pathogens. 2.1 Test strains Rice blast fungus ( Magnaporthe oryzae Fusarium graminearum ( ), Fusarium graminearum Fusarium graminearum Fusarium oxysporum tomato-specific strain ( Fusarium oxysporum f.sp. lycopersici (Provided by the Fungal Molecular Biology Research Group, Institute of Biotechnology, College of Agriculture, Zhejiang University).

[0061] 2.2 Determination of the antibacterial activity of *Arthrobacter stripes* on ZDXH-8 plates Styrax striata ( T. striatoconidius ZDXH-8, *Magnaporthe oryzae*, *Fusarium graminearum*, and *Fusarium oxysporum* were inoculated into PDA medium (12 g / L potato extract; 20 g / L glucose; 15 g / L agar; natural pH; autoclaved at 115 ℃ for 15 min) and incubated at 28 ℃ for 5 days. 6 mm round bacterial blocks were then placed in the center of new PDA medium (9 cm round petri dish). *Stripetramonium streaks* (…) T. striatoconidius Place the ZDXH-8 bacterial blocks on both sides, transfer the petri dish to a 28℃ constant temperature incubator, invert and incubate for 3-7 days, then measure the size of the inhibition zone and calculate the antibacterial ability of the strain.

[0062] The plate inhibition ability of strain ZDXH-8 was determined, and the results showed that strain ZDXH-8 had significant antagonistic effects against rice blast fungus, Fusarium graminearum, and Fusarium oxysporum. Figure 3 The antibacterial rates were 66.67%, 48.85%, and 62.70%, respectively.

[0063] 2.3 Determination of the plate antibacterial activity of fermentation products of *Arthrobacter strobilus* ZDXH-8 Styrax striata ( T. striatoconidiusZDXH-8 was inoculated into 300 mL of MMYC medium (20 g maltose, 20 g mannitol, 10 g glucose, 10 g monosodium glutamate, 3 g yeast extract, 1 g corn steep liquor, 0.5 g KH2PO4, 0.3 g MgSO4·7H2O, 1 L H2O) and 100 mL of rice medium (70 g rice, 0.1 g corn steep liquor, 0.3 g peptone, 100 mL H2O), and incubated statically at 28 ℃ for 30 days. The fermentation product was extracted with an equal volume of ethyl acetate and concentrated to obtain a fermentation product extract. The fermentation product extract was dissolved in 2 mL of methanol, and 5 g of the extract was taken. μ Drop L onto a sterile 6mm circular filter paper. Place the pathogenic bacterial block in the center of a new PDA medium (9cm circular petri dish). Place the solvent-evaporated filter paper on both sides. Transfer the petri dish to a 28℃ constant temperature incubator and incubate upside down for 3-7 days. Measure the size of the inhibition zone and calculate the antibacterial ability of the strain's fermentation product.

[0064] The fermentation extract of the strain also showed significant inhibitory effects on *Magnaporthe oryzae*, *Fusarium graminearum*, and *Fusarium oxysporum*, as shown in the results. Figure 4 As shown, the inhibition rates of the rice culture medium fermentation extract of strain ZDXH-8 were 15.45%, 38.36%, and 11.19%, respectively, while the inhibition rates of the MMYC culture medium fermentation extract were 21.21%, 36.32%, and 16.08%, respectively. The inhibition rates of the positive controls (Amphotericin B for blast fungus and Fusarium graminearum, and Carbendazim for Fusarium oxysporum) were 51.52%, 51.41%, and 41.96%, respectively.

[0065] Example 3: Test on the efficacy of ZDXH-8 fermentation product of *Arthrobacter striata* in controlling rice blast on detached barley leaves. Sow barley seeds into the soil substrate. Around 7 days after seedling emergence, harvest the first fully unfolded true leaf from the barley plant. Inoculate *Bacillus oryzae* onto CM solid medium and incubate at 28°C for 7-10 days until the mycelium completely colonizes the plate and produces numerous conidia. Add 5-10 mL of sterile water to the plate. Gently scrape the spores from the mycelium surface using a sterile spreader. Filter the spore solution through a funnel lined with 2-3 layers of sterile lens paper to remove the mycelium and collect the spore suspension. Adjust the spore concentration to 1 × 10⁻⁶ using a hemocytometer. 5 Approximately 1 spore / mL. This suspension should be used within 2 hours. [The text then abruptly shifts to a seemingly unrelated topic:] Styrax striata (… T. striatoconidius ZDXH-8 fermentation product extract in MMYC and rice media was used at 500... μ Dissolve in L DMSO, take 0.4 μ L and 20 μ Mix the L-type rice blast fungus spore suspension thoroughly, and add three drops to each barley leaf, with each drop containing 20.4 g of the solution.μ L; control group: 0.4 μ L DMSO and 20 μ Mix the L-spore suspension thoroughly, then add three droplets to each barley leaf, with each droplet containing 20.4 mg / L. μ L. After being placed in darkness for 24 hours, and then under light-dark cycling conditions for 48 hours, the disease incidence of each treatment was observed. The severity of the disease was graded as follows: Grade 0: no lesions; Grade 1: pinhead-sized brown spots; Grade 3: small round spots; Grade 5: typical large spindle-shaped lesions; Grade 7: lesions merge and leaves die. The disease incidence index (= [Σ(number of disease grades × number of lesions) / (total number of droplets × highest disease grade)] × 100%) and the control efficacy (control disease index - experimental disease index) / control disease index × 100% were calculated for each treatment group.

[0066] The control effect of the fermentation extract of the strain on rice blast on detached barley leaves is as follows: Figure 5 As shown, the disease index of treatment group 1 (rice culture medium fermentation extract) was 0, and the disease index of treatment group 2 (MMYC culture medium fermentation extract) was also 0; the fermentation broth of strain ZDXH-8 achieved 100% control efficacy against rice blast on barley leaves.

[0067] Example 4: Effects of ZDXH-8 fermentation broth of *Arthrobacter strobilus* on rice seedling growth Rice seeds were soaked in 15% H2O2 for 10 min, disinfected by soaking in 75% ethanol for 30 s, rinsed three times with sterile water, and then placed in a petri dish lined with absorbent paper. Water was added to completely saturate the absorbent paper, and the seeds were germinated in the dark at 37℃. The ZDXH-8 strain was inoculated into 300 mL MMYC medium / 1000 mL Erlenmeyer flask and cultured statically at 28℃ for 30 days. The supernatant was collected by centrifugation and used as the fermentation broth. Add 10 mL of fermentation broth and 10 mL of MMYC medium to a culture flask, and then add rice basal nutrient solution (KH2PO4 40 mg / L; MgSO4·7H2O 120 mg / L; ZnSO4·7H2O 0.025 mg / L; MnSO4·4H2O 0.25 mg / L; H3BO4 0.25 mg / L; CaCl2 100 mg / L; CuSO4·5H2O 0.01 mg / L; NH4NO3 150 mg / L; K2SO4 100 mg / L; Fe-EDTA 5 mg / L; (NH4)6Mo7O 24Prepare a culture medium with a fermentation broth content of 6.7% by diluting 0.005 mg / L 4H2O and pH 5.5-6.0 to 150 mL. Add 20 mL of fermentation broth to a culture bottle and dilute to 150 mL with rice basal nutrient solution to prepare a culture medium with a fermentation broth content of 13.3%. Use 150 mL of basal nutrient solution as control 1. Add 20 mL of MMYC medium to a culture bottle and dilute to 150 mL with rice basal nutrient solution as control 2. Sprinkle a small amount of perlite on the surface of the prepared culture medium (to prevent rice seeds from sinking to the bottom), transfer the germinated rice seeds into culture bottles (20 seeds per bottle), and culture for 21 days (adding culture medium once during the culture process). After 21 days, take photos to record and measure the stem and leaf height and root length of the rice seedlings.

[0068] After root drenching with strain ZDXH-8, the plant height, root length, and other physiological indicators were significantly improved compared with the control. For example... Figure 6 As shown in Figure A, compared with the control group, the plant height of the treatment group increased, and the higher the concentration of the fermentation broth, the taller the plant and the more vigorous the plant growth. Using 13.3% fermentation broth increased the rice plant height by approximately 8.8 cm. Figure 6 (B), root length increased by 11.5 cm ( Figure 6 (C). This indicates that root irrigation with the fermentation broth of strain ZDXH-8 can promote rice growth and has a good growth-promoting effect. Figure 6 In the figure, "**" represents p < 0.01; "***" represents p < 0.001; and "****" represents p < 0.0001. In summary, this invention isolated an endophytic fungus from the leaves of *Andrographis paniculata*, named ZDXH-8. ITS sequencing alignment and phylogenetic tree construction confirmed that strain ZDXH-8 is *Arthropoda stripes* (a type of fungus). T. striatoconidius The antibacterial activity assay revealed that strain ZDXH-8 exhibited significant antagonistic effects against *Strombus oryzae*, *Fusarium graminearum*, and *Fusarium oxysporum*, with inhibition rates of 66.67%, 48.85%, and 62.70%, respectively. Furthermore, ZDXH-8 achieved 100% control efficacy against rice blast on barley leaves. Growth-promoting experiments showed that treatment with the fermentation broth of strain ZDXH-8 significantly promoted rice plant growth, resulting in substantial increases in physiological indicators such as plant height and root length.

[0069] The above specific embodiments are used to explain and illustrate the present invention, but not to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the claims shall fall within the protection scope of the present invention.

[0070] The above description is only a preferred embodiment of the present invention. Therefore, all equivalent changes or modifications made to the structure, features and principles described in the claims of this patent application are included in the scope of this patent application.

[0071] The gene sequences involved in this invention are as follows: SEQ ID No.1; Name: DNA sequence of strain ZDXH-8 DNA type: genomic DNA Biological origin: Talaromyces striatoconidius CCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCGCGGCCCAACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGCACGTCCCCGGGCCCGCGCCCGCCGAAG CGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTATTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAA TCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCC GTCTGGTCCTCGAGCGTATGGGGCTTTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCATATTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGA SEQ ID No.2; Name: Gene sequence of primer ITS1 DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct TCCGTAGGTGAACCTGCGG SEQ ID No. 3; Name: Gene sequence of primer ITS4 DNA type: other DNA Biological origin: Artificial Sequence / synthetic construct TCCTCCGCTTATTGATATGC.

Claims

1. A strain of *Arthropoda*, characterized by: The ankle fungus is named *Arthropoda stylosa*. Talaromyces striatoconidius It is deposited at the China General Microbiological Culture Collection Center (CGMCC) on September 28, 2025, with accession number CGMCC No. 42229.

2. A fermentation production method for the *Arthropoda* strain according to claim 1, characterized in that, The fermentation production method includes: inoculating the striped anklebacterium into a fermentation medium for fermentation culture.

3. The fermentation production method according to claim 2, characterized in that, The fermentation medium is either MMYC medium or rice medium.

4. A microbial agent, characterized in that, The microbial agent contains the *Arthropoda* as described in claim 1 or the fermentation product obtained by any of the methods described in claims 2-3.

5. The application of *Ankylostella striata* as described in claim 1 or the fungal agent as described in claim 4, characterized in that, Application in any of the following (a)-(c): (a) Inhibit plant pathogens; (b) Prevention and control of plant diseases; (c) Promote plant growth.

6. The application as described in claim 5, characterized in that, The plant in question is an agricultural crop.

7. The application as described in claim 5, characterized in that, The plant pathogens are rice blast fungus, Fusarium graminearum, and Fusarium oxysporum tomato-specific strain; the plant diseases are rice blast, wheat scab, and tomato wilt.

8. The application as described in claim 5, characterized in that, The promotion of plant growth specifically manifests as increasing plant height and root length.

9. The application as described in claim 5, characterized in that, The plant in question is rice.

10. A method for preventing and controlling rice blast and promoting rice plant growth, characterized in that, The method includes spraying or drenching rice plants with the striped ankle fungus as described in claim 1 or the fungal agent as described in claim 4.

Citation Information

Patent Citations

  • Agent for controlling diseases occurring in the stage of raising rice seedlings

    CN101227822A

  • Biocontrol type strain TF-08, culture method and application thereof

    CN111518704A

  • Talaromycesflavus bacterial strain TF-04 and application thereof

    CN113151001A

  • Talaromyces purpureogenus strain, biocontrol agent and application of Talaromyces purpureogenus strain

    CN113528353A

  • Talaromyces TM28, TM28 conidium solid preparation and application thereof

    CN116376723A