Pichia pastoris K1 with effect of improving starch solubility

Abstract

The invention discloses a pichia pastoris (Pichia kudriavzevii) K1 with an effect of improving the solubility of quinoa starch, and the preservation number of the pichia pastoris K1 is CGMCC (China General Microbiological Culture Collection Center) No.39012. The invention further discloses a preparation method of the pichia pastoris K1. The strain is separated from Chinese traditional fermented food'slurry ', and the solubility of starch can be remarkably changed through fermentation treatment. After the pichia pastoris K1 is used for fermenting chenopodium quinoa starch for 24 hours, the solubility of the chenopodium quinoa starch is improved to 35.84% from 13.93% of original starch, and the improvement amplitude reaches 21.91%. The invention provides an efficient and safe microbial resource for starch deep processing, and has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology and relates to a Pichia kudriavzevii K1 with the function of enhancing the solubility of quinoa starch. Background Art

[0002] Quinoa starch has attracted much attention in the fields of healthy foods and functional ingredients due to its natural low glycemic index (GI < 35), high water solubility, and excellent emulsifying properties. Its content accounts for 53.50% - 69.20% of the dry weight of grains, and its highly branched molecular structure endows it with unique functions different from ordinary cereal starches. However, natural quinoa starch has a rough texture, poor gelatinization stability, weak hydration ability, and insufficient tolerance to temperature and shear, which severely restricts its large-scale application in high-value-added food systems.

[0003] Currently, starch modification mainly relies on chemical methods (such as crosslinking, esterification, etc.) or physical methods (such as ultrasound, microwave, ultra-high pressure). Although chemical methods have definite effects, they require strong acids, strong bases, or crosslinking agents, which are likely to damage the natural conformation of starch and are accompanied by risks such as chemical residues, environmental pollution, and low consumer acceptance. Physical methods do not require reagent addition, but the equipment is expensive, the energy consumption is high, the processing efficiency is limited, and it is difficult to precisely control the molecular structure. Therefore, the development of green, mild, and starch structure-modifying technologies with targeted modifications has become an industry consensus.

[0004] Microbial fermentation has become an emerging strategy for starch bio-modification due to its advantages such as environmental friendliness, simple operation, and low cost. Amylases, debranching enzymes, etc. secreted by specific strains during metabolism can carve starch granules at multiple scales: regulate the conformation of molecular chains, reshape the crystalline region, and modify the surface morphology, thereby synchronously optimizing their physical and chemical properties and digestion performance. Existing studies have shown that lactic acid bacteria fermentation can change the gel properties of millet starch, and the combined fermentation of Lactobacillus plantarum and Saccharomyces cerevisiae can reduce the paste viscosity and retrogradation value of hulless barley starch. However, existing work mostly focuses on the improvement of gel properties, thermal stability, or digestion rate. There is still a lack of systematic research on significantly and directionally enhancing the solubility of starch through microbial fermentation, especially using Pichia strains to specifically modify quinoa starch.

[0005] In this study, a strain of Pichia kudriavzevii ( Pichia kudriavzevii ) K1 was isolated and screened from the traditional Chinese fermented food "jiangshui" and was first applied to the fermentation modification of quinoa starch. This strain can significantly enhance the solubility of quinoa starch under mild conditions, providing an efficient and safe microbial resource for breaking through the bottleneck of the weak hydration ability of natural quinoa starch, and also laying a theoretical and technical foundation for the development of green bio-modification technologies and high-solubility starch-based functional ingredients. Summary of the Invention

[0006] The purpose of this invention is to provide a Pichia pastoris K1 strain that can efficiently improve starch solubility and to clarify its application in quinoa starch modification.

[0007] The Pichia pastoris K1 described in this invention was isolated from a slurry sample from Gansu Province using YPD medium and identified by ITS sequence analysis as... Pichia kudriavzevii The aforementioned Pichia pastoris Pichia kudriavzevii K1 has the accession number CGMCC No.39012 at the China General Microbiological Culture Collection Center (Address of the collection center: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, China; Date of accession: October 23, 2025).

[0008] Compared with the prior art, the present invention has the following advantages: the strain can secrete amylase during fermentation, which can effectively degrade the α-1,4 and α-1,6 glycosidic bonds in starch molecules, thereby promoting the debranching of amylopectin and the dissolution of amylose; at the same time, it preferentially hydrolyzes the amorphous region of starch, increasing the ratio of crystalline to amorphous regions of starch, and ultimately significantly improving starch solubility. Experimental results show that the solubility of quinoa starch after 24 hours of fermentation with K1 reaches 35.84%, which is 21.91% higher than that of the original starch. Attached Figure Description The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings: Figure 1 This is a colony morphology diagram of the Pichia pastoris K1 strain of the present invention. Figure 2 The ¹H NMR spectra of natural quinoa starch (NS) and Pichia pastoris fermented starch (K6, K12, K18, K24) are shown. Figure 3 XRD patterns and relative crystallinity results for natural quinoa starch (NS) and Pichia pastoris fermented starch (K6, K12, K18, K24). Figure 4 Bar chart showing the solubility of natural quinoa starch (NS) and Pichia pastoris fermented starch (K6, K12, K18, K24). Detailed Implementation To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0009] Example 1: Isolation and Identification of Strains K1 The Pichia pastoris involved in this invention ( Pichia kudriavzevii K1 has been deposited in a relevant microbial culture center. The quinoa starch used in the following examples was purchased commercially, and the YPD medium is a conventional reagent in the art and can be prepared according to standard methods.

[0010] 1. Separation and purification: Take 10 mL and dilute it 10-fold in 90 mL of 0.85% physiological saline. Select 10... -3 ~10 -7 Dilute 1 mL and spread it onto YPD medium, then incubate at 32°C for 48 hours.

[0011] 2. Purification culture: Based on the colony morphology, pick single colonies and streak them multiple times on YPD medium for purification until uniform single colonies are obtained.

[0012] YPD medium composition: 20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose, 15 g / L agar, pH 6.5.

[0013] 3. Molecular identification: Genomic DNA was extracted and purified from the strain, and its ITS region was amplified using universal primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3'). After sequencing the PCR product, homology comparison was performed in the NCBI database, identifying the strain as *Pichia pastoris*. Pichia kudriavzevii ), and named it K1.

[0014] The present invention Pichia pastoris ( Pichia kudriavzevii K1 has the following biological characteristics: 1. Morphological characteristics: The bacterial cells of the strain are spherical, arranged in a single row, and do not form spores.

[0015] 2. Culture characteristics: When the strain was cultured at 32℃ for 48 h on YPD medium, the colonies were regular, cream-colored, and had neat edges.

[0016] 3. Genetic characteristics (ITS sequence of the strain): The ITS sequence of strain K1 (full length 480bp) was obtained through ITS region amplification and sequencing, as follows: TGTGGGCATTCTACTGATTTGAGGTCGAGCTTTTTGTTGTCTCGCAACACTCGCTCTCGGCCGCCAAGCGTCCCTGAAAAAAAGTCTAGTTCGCTCGGCCAGCTTCCGCTCCCTTTCAGGCGAGTCGCAGCTCCGACGCTCTTTACACGTCGTCCGCTCCGCTCCCCCAACTCTGCGCACGCGCAAGATGGAAACGACGCTCAAACAGGCATGCCCCCCGGAATGCCGAGGGGCGCAATGT GCGTTCAAGAACTCGATGATTCACGATGGCTGCAATTCACACTAGGTATCGCATTTCGCTGCGCTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGTTTGTTTTTCGTAGATTTCTCTTGTCGACTATGCTATATTCCACATTTTAGGTGTTGTTGTTTTCGTTCCGCTCACGCAGTGTAGTACTAAATCACAGTAATGATCCTTCCGCAGGTCACCCCTACGGAAG Example 2: Pichia pastoris K1 fermentation of quinoa starch (taking 6 hours of fermentation as an example) 1. Activation of the bacterial strain and preparation of the starter culture: Pichia pastoris K1 was inoculated into YPD liquid medium and cultured at 32℃ and 180 r / min for 24 hours for activation. The activated bacterial solution was centrifuged at 4000 rpm for 5 minutes, the cells were collected, washed twice with sterile physiological saline, and finally resuspended in sterile physiological saline to adjust the bacterial concentration to 1×10⁻⁶. 8 CFU / mL, to be used as a starter culture.

[0017] 2. Starch Fermentation Treatment: Add 15 g of quinoa starch and 75 mL of distilled water (solid-liquid ratio 1:5, w / v) to a 250 mL Erlenmeyer flask and mix well to prepare a starch suspension. Inoculate the suspension with the K1 starter culture prepared above to achieve a final concentration of 1 × 10⁻⁶. 8 CFU / mL.

[0018] 3. Fermentation process: After sealing the conical flask, place it in a constant temperature shaking incubator at 32℃ and ferment at a speed of 220 r / min for 6 hours.

[0019] 4. Post-processing: After fermentation, the mixture was centrifuged at 5000 rpm for 10 minutes, and the supernatant was discarded. The precipitate was dried in a 40℃ oven to constant weight, ground and pulverized, and passed through a 100-mesh sieve to obtain the Pichia pastoris K1 fermented quinoa starch sample, named K6.

[0020] Example 3: Pichia pastoris K1 fermentation of quinoa starch (taking 12 hours of fermentation as an example) The difference between this embodiment and Embodiment 2 is that the fermentation time is extended to 12 hours, while the remaining steps and parameters are the same as in Embodiment 2. The obtained sample is named K12.

[0021] Example 4: Pichia pastoris K1 fermentation of quinoa starch (taking 18 hours of fermentation as an example) The difference between this embodiment and Embodiment 2 is that the fermentation time is extended to 18 hours, while the remaining steps and parameters are the same as in Embodiment 2. The obtained sample is named K18.

[0022] Example 5: Pichia pastoris K1 fermentation of quinoa starch (taking 24 hours of fermentation as an example) The difference between this embodiment and Embodiment 2 is that the fermentation time is extended to 24 hours; all other steps and parameters are the same as in Embodiment 2. The obtained sample is named K24.

[0023] Example 6: Nuclear magnetic resonance (NMR) spectral analysis of starch fermented by Pichia pastoris K1 Accurately weighed sample (8 mg) was placed in an NMR tube, and deuterated dimethyl sulfoxide (DMSO-d6) was added to enhance solubility. The mixture was sonicated at 75 °C for 3 min and analyzed using a 600 MHz NMR spectrometer, with tetramethylsilane (TMS, 0 ppm) as an internal reference. α-1,4 and α-1,6 glycosidic bonds were identified based on characteristic peaks at 5.11 ppm and 4.91 ppm, respectively. Branching degree (DB) was calculated using Equation I: (I) Where I1,4 and I1,6 are the respective peak areas of α-1,4 and α-1,6 glycosidic bonds.

[0024] Figure 2Figure 2 shows the ¹H NMR spectra of natural quinoa starch (NS) and Pichia pastoris-fermented starches (K6, K12, K18, K24). As shown in Figure 2, the DB value of natural quinoa starch (NS) is 11.43%. After fermentation with Pichia pastoris enzyme activity, the DB value initially decreased more rapidly, but then increased with prolonged fermentation time. The lowest DB value (9.49%) was observed at 6 hours of fermentation, increasing to 12.38% at 24 hours. This later increase in DB value is likely due to the breaking of α-1,4 glycosidic bonds. Because the steric hindrance of α-1,4 glycosidic bonds is more stable than that of α-1,6 glycosidic bonds, a longer fermentation time and higher enzyme activity are required for their breakage.

[0025] Example 7: XRD analysis and calculation of relative crystallinity of starch fermented by Pichia pastoris K1 The crystal structure of each sample was determined using an X-ray diffractometer (Shimadzu, XRD-6000, Japan), resulting in XRD diffraction patterns. Tests were conducted at 40 kV and 40 mA, with a diffraction angle (2θ) scanning range of 10°–40° and a scanning speed of 4° / min. The test results are shown below. Figure 3 Calculate the relative crystallinity (RC) using Formula II: (II) Figure 3 XRD patterns and relative crystallinity results for natural quinoa starch (NS), natural quinoa starch (NS), and Pichia pastoris-fermented starches (K6, K12, K18, K24). Figure 3 As shown, natural quinoa starch (NS) exhibits typical A-type crystallization diffraction peaks at 2θ = 15.1°, 17.3°, 18.1°, and 23.2°. Samples after different fermentation treatments also showed A-type crystallization diffraction patterns, indicating that fermentation did not change its crystal structure type, and the crystalline structure was basically maintained. However, with prolonged fermentation time, the relative crystallinity (RC) of the samples gradually decreased, dropping to 34.51% after 24 hours of fermentation in the Pichia pastoris treatment group. This is because the combined action of acid and enzymes during fermentation weakens and disrupts the hydrogen bond network between starch molecules, leading to a certain degree of dissociation of the crystalline region structure.

[0026] The crystalline regions of starch can be considered "structural fortresses" to resist dissolution, and its crystallinity is one of the key factors affecting starch dissolution behavior. As crystallinity decreases, the proportion of amorphous regions increases, intermolecular forces weaken, and more pores and channels are formed inside the starch, which facilitates water entry and molecular diffusion, ultimately improving its solubility.

[0027] Example 8: Determination of starch solubility during Pichia pastoris K1 fermentation To determine the solubility of starch in the above samples: Prepare a 1% (w / v) starch suspension and heat and stir in a magnetic water bath at 95°C for 30 minutes. After cooling to room temperature, centrifuge the starch suspension at 3500 rpm for 15 minutes. Carefully pour the supernatant into pre-weighed petri dishes and dry at 105°C to constant weight. Calculate the solubility (S) using Formula III: (III) In the formula, A is the mass of the supernatant after drying (g), and W is the mass of the starch sample taken (g).

[0028] Figure 4 The bar chart shows the solubility of natural quinoa starch (NS), natural quinoa starch (NS), and Pichia pastoris-fermented starches (K6, K12, K18, K24). As can be seen from the figure, all fermentation treatments significantly improved starch solubility compared to natural quinoa starch (NS, solubility 13.93%). After 18 h and 24 h of fermentation with Pichia pastoris K1, the solubility increased to 27.54% and 35.84%, respectively. This indicates that fermentation treatment has a significant effect on improving the solubility of quinoa starch. The enhanced solubility may be attributed to the synergistic effect of acid and enzymes during fermentation, leading to starch molecular chain breakage, reduced crystallinity, and an increased proportion of amorphous regions. The Pichia pastoris K1 fermentation group samples exhibited higher branching and lower crystallinity, resulting in weakened intermolecular forces, easier penetration of water molecules into loosely structured regions, and an increase in hydration sites, thereby further improving solubility.

[0029] In summary, the Pichia pastoris K1 strain provided by this invention significantly improves the solubility of quinoa starch better than traditional natural starch after 24 hours of fermentation, demonstrating the novelty, inventiveness, and outstanding technical effect of this invention.

[0030] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A strain of Pichia pastoris K1 that enhances the solubility of quinoa starch, characterized in that, The strain is Pichia pastoris K1, which was isolated from a slurry sample from Lanzhou City, Gansu Province using YPD medium; the Pichia pastoris... Pichia Kudryavzevii K1 has the accession number CGMCC No.39012 at the China General Microbiological Culture Collection Center. Fermented starch was prepared by adding the strain at an inoculum of 5% to a 25% quinoa starch suspension. The solubility of the starch increased by no less than 20% after fermentation.

Images