IFNAR1 gene-deficient engineered immune cell as well as preparation method and application thereof

Abstract

The invention relates to the field of gene editing and tumor immunotherapy, and discloses an IFNAR1 gene defect type engineered immune cell as well as a preparation method and application thereof. The engineering immune cell is characterized in that: i) an IFNAR1 gene is knocked out; (ii) automatically secreting IFN beta; and (iii) specifically recognizing and killing tumor cells expressing CD19. The engineered immune cell can specifically recognize and kill tumor cells expressing CD19, and meanwhile, IFN beta is automatically secreted to enhance the killing function on the tumor cells.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of gene editing and tumor immunotherapy, more specifically, it relates to a IFNAR1 Genetically defective engineered immune cells and methods of making and using the same. BACKGROUND

[0002] Chimeric antigen receptor T cell (CAR-T) therapy is an important breakthrough in the field of tumor immunotherapy in recent years, and has achieved remarkable results, especially in the treatment of hematological malignancies. The U.S. Food and Drug Administration (FDA) has approved several CAR-T products for the treatment of B-cell leukemia and lymphoma. However, although clinical trials have shown that CAR-T cells can achieve a high initial remission rate, about half of the patients relapse within a year after infusion, and some patients are insensitive to treatment and fail to achieve remission. At the same time, the application of CAR-T in the field of solid tumor treatment is still in the exploratory stage, and its clinical effect is limited, and the overall progress is relatively slow. The above limitations show that the existing CAR-T therapy still needs to be further optimized to improve its function and adaptability, and to overcome the problems of recurrence and drug resistance.

[0003] The functional integrity and in vivo expansion capacity of T cells are the key to the efficacy of CAR-T. Cytokine signaling (signal 3) plays an important role in T cell activation, effector function, expansion and subpopulation polarization. Studies have shown that by introducing specific cytokine signaling pathways into CAR-T cells, their activity and persistence can be enhanced, thereby improving treatment efficacy.

[0004] The activation of type I interferon signaling cascade plays a key role in promoting cancer immunotherapy. IFN-I is an important immunomodulatory cytokine involved in various biological processes, including antiviral defense, inhibition of tumor cell proliferation, enhancement of dendritic cell antigen presentation capacity, and modulation of NK cell killing function, and remodeling of tumor microenvironment, reducing the number of myeloid suppressor cells and Treg cells, and regulating anti-tumor immune response. IFN-I has a dual role in T cell function adjustment. On the one hand, IFN-I can promote T cell activation and expansion, enhance effector function and maintain the formation of central memory T cells; on the other hand, IFN-I can also limit T cell proliferation and survival, drive functional exhaustion, and thus weaken immune effect. This contradictory regulatory effect makes the optimal utilization of IFN-I in CAR-T cell therapy still unclear.

[0005] In the classical IFN-I signaling pathway, IFN-I interacts with the receptor complex in the form of a heterodimer with IFNAR1 / IFNAR2 to activate the JAK-STAT signaling pathway. IFNAR1 is an essential receptor subunit in this pathway, and its deletion can block the transmission of downstream signals and significantly reduce the level of STAT phosphorylation. Studies have shown that knocking out IFNAR1 IFN-I can inhibit tumor cells themselves and promote the remodeling of the tumor microenvironment through IFN-I delivered by tumor cells themselves. However, there is currently no research report that combines IFNAR1 Gene editing combined with CAR-T engineering to achieve the strategy of enhancing CAR-T function and improving its anti-tumor effect. SUMMARY

[0006] The purpose of the present application is to provide a functionally enhanced and more effective engineered immune cell. The engineered immune cell obtained by the present application can specifically recognize and kill tumor cells expressing CD19, while secreting IFNβ to enhance the killing function of tumor cells.

[0007] In order to achieve the above-mentioned purpose of the application, the following technical solutions are adopted in the present application: In a first aspect, the present application provides an engineered immune cell, comprising the following features: (i) IFNAR1 the gene is knocked out; (ii) secretes IFNβ; (iii) specifically recognizes and kills tumor cells expressing CD19.

[0008] Further, the engineered immune cell further comprises the following features: (iv) expresses CAR; (v) the immune cell is a T cell or an NK cell.

[0009] Further, the engineered immune cell further comprises the following features: (iv) the immune cell is a T cell; (v) expresses CAR or TCR.

[0010] Further, the CAR is composed of CD8α signal peptide, single-chain variable fragment scFv recognizing CD19, human CD8α transmembrane region, CD28 co-stimulatory domain, immune receptor tyrosine activation motif CD3ζ, T2A self-cleavage peptide segment, and IFNβ in series.

[0011] Further, the CAR and IFNβ are co-expressed by the same vector.

[0012] In a second aspect, the present application provides a method for preparing an engineered immune cell comprising the following features, (i) IFNAR1 the gene is knocked out; (ii) secretes IFNβ; (iii) specifically recognizes and kills tumor cells expressing CD19; (iv) expresses a CAR; (v) the immune cell is a T cell; comprising the following steps: isolating human primary T cells; knocking out the gene using a CRISPR / Cas9 editing system; IFNAR1 expanding the culture; transfecting the above-mentioned T cells with a lentiviral vector containing a CAR coding sequence; extracting the genome for sequencing analysis and identification, and continuing to expand the culture to obtain the engineered immune cell; the CAR is composed of a CD8α signal peptide, a single-chain variable fragment scFv recognizing CD19, a human CD8α transmembrane region, a CD28 co-stimulatory domain, an immunoreceptor tyrosine activation motif CD3ζ, a T2A self-cleavage peptide segment, and IFNβ in tandem.

[0013] Further, the lentiviral vector containing the CAR coding sequence is a PLVX CD19 IFNβ CAR vector.

[0014] In a third aspect, the present application provides a pharmaceutical composition comprising the engineered immune cell of any one of the first aspect, or prepared by the method of any one of the second aspect, and a pharmaceutically acceptable carrier or excipient.

[0015] In a fourth aspect, the present application provides the use of the engineered immune cell of any one of the first aspect, or prepared by the method of any one of the second aspect, or the pharmaceutical composition of the third aspect, in the preparation of a medicament for treating tumors.

[0016] Further, the tumor is a CD19-positive tumor.

[0017] In summary, the present application has the following beneficial effects: (1) Compared with wild-type CAR-T cells, by knocking out the gene, the negative regulation of IFN-I signal is blocked, avoiding the functional inhibition and pro-apoptotic effect of CAR-T cells in the presence of IFNβ. The present application provides a CAR-T cell with a defect that can be used in the presence of IFN-I. IFNAR1 IFNAR1

[0018] ​​(2) Compared with the conventional CAR T cell technology, the cytokine IFN beta is introduced in the construction of the CAR vector, which can enhance the cytotoxic function, effector molecule release, cell proliferation and promote the differentiation of central memory T cells of the CAR-T cells, and further improve the anti-tumor activity. Using a mouse animal model, the IFN beta secreting CAR-T cells prepared by the application show better anti-tumor effect than the control group in hematological malignancies, have stronger in vivo expansion capacity, and have good safety, showing high clinical application potential. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 : roadmap of construction of CAR-T cells; Figure 2 : sgRNA mode targeting IFNAR1 exon 2 of CD 19; Figure 3 : IFNAR1 editing efficiency of gRNA pairs, wherein A is the genome knockout efficiency; B is the protein editing efficiency detected by Western blot; Figure 4 : IFNAR1 cell viability and expansion fold of unedited CAR-T and IFNAR1 gene knockout CAR-T cells when co-cultured with IFN beta; Figure 5 : IFNAR1 After 8 days of action of the defective CAR-T cells with or without IFN beta, the in vitro apoptosis level was detected by flow cytometry; Figure 6 : IFNAR1 After the defective CAR-T cells with or without IFN beta were co-cultured with tumor cells Nalm6, the in vitro killing activity was detected; Figure 7 : NCG animal test results, the figure shows the tumor volume of each mouse in different treatment groups; Figure 8 : schematic diagram of CAR structure; the structure diagram of lentiviral vector of human second-generation CAR (CD19-28z) targeting CD19 and cytokine fusion expression CAR (CD19-28z-IFN beta) is shown; Figure 9 : technical roadmap of constructing CAR-T cells secreting IFN beta; Figure 10 : monitoring cell viability and expansion fold of CAR-T cells in in vitro culture process; Figure 11 : different CAR-T cell infection efficiency diagram; Figure 12Results of IFNβ expression detection in supernatant after culturing CAR-T cells at different densities; Figure 13 Results of CAR-T cell killing efficiency against Raji tumor cells at different effector-to-target ratios; Figure 14 The secretion of cytokines by co-culturing different CAR-T cells with target cells at an E:T ratio of 1:1; Figure 15 CTV markers for CAR-T cell proliferation; Figure 16 Animal trial results of CAR-T cell therapy for Raji lymphoma; Figure 17 Animal trial results of CAR-T cell therapy for Raji lymphoma. Detailed Implementation

[0020] The technical solutions and effects of this application will be further described in detail below with reference to the embodiments and accompanying drawings.

[0021] It is worth noting that this invention uses CAR-T cells as an example to provide a representative detailed description of the engineered immune cells of this invention. The engineered immune cells of this invention include, but are not limited to, the CAR-T cells described in the context. The engineered immune cells of this invention have the same or similar technical features and beneficial effects as the CAR-T cells described in the context. Specifically, when immune cells express chimeric antigen receptor (CAR), NK cells are equivalent to T cells (or T cells can replace NK cells); when immune cells are T cells, TCR is equivalent to CAR (or CAR can be replaced by TCR).

[0022] Through extensive and in-depth research and a large number of screenings, the inventors of this invention have for the first time [achieved / converted / distributed / converted / etc.]. IFNAR1 By combining knockout with an IFNβ-overexpressing CAR vector, an engineered immune cell capable of self-secreting IFNβ can be constructed. Experimental results show that this invention can utilize... IFNAR1 Gene knockout effectively avoids the inhibitory effect of IFNβ on T cell function without affecting normal T cell function. Simultaneously, the CAR-T cells of this invention can co-express CAR and IFNβ, achieving auto-secretion of IFNβ and significantly enhancing their anti-tumor activity. The chimeric antigen receptor (CAR) described in this invention can be used to treat CD19-positive tumor patients.

[0023] The main advantages of this invention include: (1) The engineered immune cells of the present invention can specifically target CD19 and secrete IFNβ, thereby enhancing the anti-tumor immune effect.

[0024] (2) The target designed in this inventionIFNAR1 The gRNA has stable and efficient gene knockout effect, can effectively block the negative regulation of IFN-I signal to T cells, and avoids the inhibition of IFN beta to T cell proliferation and function.

[0025] (3) The application first finds that, in IFNAR1 On the basis of gene knockout, the CAR vector introducing IFN beta expression can avoid the inhibition of IFN beta, and successfully constructs the CAR-T cell with self-secretion IFN beta ability.

[0026] (4) The application first finds that, in the CAR modified T cell, the exogenous IFN beta expressed together with the CAR can significantly improve the tumor inhibition activity, enhance the cell expansion ability and the level of effector molecule release, and further improve the overall anti-tumor effect.

[0027] In addition, it should be understood that the following examples are only used to illustrate the present application and are not used to limit the scope of the present application. The experimental methods not specified in the following examples are generally carried out under conventional conditions, for example, the conditions described in Sam brook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are weight percentages and weight parts.

[0028] Unless specifically stated, the materials and reagents used in the examples of the present application are commercially available products.

[0029] Example 1: Preparation (activation and culture) and transfection of T cells Human CD3+T cells (STEMCELL Technology) were cultured in CTS medium (Gibco) supplemented with 10% fetal bovine serum (Gibco), IL-2 (100 U / mL), and L-glutamine (1 mM / mL). The cell concentration in the culture medium was maintained at 1-2 x 10 6 To activate the cells, T cell activation magnetic beads (Dynabeads human T-activator CD3 / CD28) were added at a ratio of 3:1 of magnetic beads to cells, and incubated in an incubator at 37°C and 5% CO2.

[0030] After 24 hours of T cell activation, the cells were counted, and the required CAR lentivirus solution was added. After 48 hours of cell activation, the CD3 / CD28 beads were removed with a magnet, and then electrotransformation was performed. In order to find a method that can efficiently knockout specific genes IFNAR1The gRNA was introduced as described in Example 2 below. 4 μg Cas9 protein and 2 μg sgRNA were introduced into 1 × 10⁻⁶ cells via electroporation. 6 Personal primary T cells. Genes were introduced using a Lonza 4D-Nucleofector electroporator with the EH 115 electroporation program. After electroporation, the cells were incubated in an incubator at 37°C and 5% CO2.

[0031] IFNAR1 The roadmap for constructing defective CAR-T cells is as follows: Figure 1 As shown.

[0032] Example 2: Synthesis, Design and Validation of gRNA Candidate sgRNAs for target gene knockout were designed and screened using Synthego's online sgRNA design tool (https: / / design.synthego.com): Human IFNAR1 Gene( IFNAR1 (NCBI Registry No. NM_000629.3). Candidate sgRNAs were chemically synthesized by GenScript Inc. in Nanjing. Guide RNAs were screened by in vitro complexing of commercially synthesized gRNAs with Cas9 and delivery of gRNA / Cas9 ribonucleoprotein (RNP) to T cells via electroporation.

[0033] Figure 2 Depicting the target IFNAR1 A schematic diagram of the sgRNA in exon 2; IFNAR1 Target sequence: TAGATGACAACTTTATCCTG (SEQ ID NO:1).

[0034] Figure 3 Describing the optimization IFNAR1 Editing efficiency of gRNA pairs, genome and protein editing efficiency.

[0035] Example 3: In vitro efficacy of gene editing in primary and engineered T cells Using the CRISPR / Cas9 system and selected gRNA pairs IFNAR1 Genes are edited to obtain IFNAR1 Defective anti-CD19 CAR-T cells were used, with unedited anti-CD19 CAR-T cells as a control. Human primary T cells modified to express CD19-targeting CARs were used to analyze the effect of IFNβ on cell function.

[0036] (1) Proliferation and survival rate detection Unedited and IFNAR1Defective CD19 CAR-T cells were co-cultured with or without 10 ng / mL IFNβ. In the presence of IFNβ, unedited CAR-T cells showed inhibited activity and proliferation; while... IFNAR1 The survival rate and proliferation rate of defective CAR-T cells were comparable to those of the group without IFNβ supplementation. Figure 4 ).

[0037] (2) Apoptosis analysis Promoting T cell apoptosis is one of the effects of IFNβ signaling (Evgin, L., Huff, AL, Wongthida, P. et al. Oncolytic virus-derived type I interferon restricts CART celltherapy. Nat Commun 11, 3187 (2020)). To address the impact of IFNβ signaling on T cell apoptosis, gRNA is used... IFNAR1 Monitoring the proportion of apoptosis in anti-CD19 CAR-T cells in the context of gene editing. In the presence of IFNβ, IFNAR1 Defective CAR-T cells still maintained a high survival rate, significantly better than the unedited control group. Figure 5 ).

[0038] (3) In vitro killing activity detection Analysis of unedited and IFNAR1 In vitro killing activity of defective CD19 CAR-T cells. IFNAR1 Unedited anti-CD19 CAR-T cells were used as a control. Unedited and... IFNAR1 Defective CAR-T cells were cultured for 48 hours with or without 10 ng / mL IFNβ, and then co-cultured with Nalm6 target cells at a predetermined ratio. In the presence of IFNβ, IFNAR1 Defective CAR-T cells still maintained normal lytic activity. Figure 6 ).

[0039] Example 4: In vivo efficacy of gene editing in primary and engineered T cells To further prove IFNAR1 This invention investigates the efficacy of gene knockout in rescuing the inhibitory effect of IFN-I signaling. Using an immunodeficient mouse model, the antitumor effects of unedited and IFNAR1-deficient CD19 CAR-T cells in vivo were analyzed. IFNAR1Defective anti-CD19 CAR-T cells were cultured for 48 hours with and without IFNβ, and then reinfused into Raji lymphoma-bearing mice. Unedited CAR-T cells served as a control. IFNβ treatment significantly inhibited the anti-tumor function of unedited CAR-T cells and shortened the survival time of mice, while... IFNAR1 KO CAR-T cells can still maintain normal anti-tumor function, indicating that IFNAR1 The absence of IFN-I can completely counteract the in vivo functional inhibition effect. Figure 7 ).

[0040] Example 5: Obtaining the full-length sequence of the human IFNβ gene The full-length CDS region of the IFNβ gene was found on the website https: / / www.ncbi.nlm.nih.gov / pubmed / , and the corresponding gene sequence was located. Primers were designed using Snap Gene software and synthesized at the company. Using human T cell cDNA as a template, the extracellular domain of IFNβ was amplified by RT-PCR. The RT-PCR product was sequenced to obtain the IFNβ sequence as follows: (SEQ ID NO:2).

[0041] The amino acid sequence of IFNβ is as follows: MTNKCLLQIALLLCFSTTALSMSYNLLGFLQRSSNFQCQKLLWQLNGRLEYCLKDRMNFDIPEEIKQLQQFQKEDAALTIYEMLQNIFAIFRQDSSSTGWNETIVENLLANVYHQINHLKTVLEEKLEKEDFTRGKLMSSLHLKRYYGRILHYLKAKEYSHCAWTIVRVEILRNFYFINRLTGYLRN (SEQ ID NO:3).

[0042] Example 6: Construction of PLVX CD19 CAR and PLVX CD19 IFNβ CAR vectors This study uses B-cell lymphoma as an example to construct CAR-T cells that can specifically target lymphoma and secrete IFNβ.

[0043] The obtained IFNβ gene sequence was ligated to the pre-constructed second-generation CAR sequence (CD8α-CD28-CD3zeta) (obtained from Nanjing Reindeer Biotechnology Co., Ltd.) via overlap PCR. The CAR sequence was constructed after RT-PCR and sequencing confirmation, yielding the PLVX-CD19 IFNβ-CAR vector. The structural diagram is shown below. Figure 8 As shown.

[0044] Example 7: Packaging of CAR Lentiviral Virus Amplification and viral packaging of PLVX CD19 CAR and PLVX CD19 IFNβ CAR plasmids.

[0045] Cell treatment: 24 hours before transfection, 293T cells were digested with trypsin and seeded into 15cm culture dishes. The cells were then grown in DMEM medium with 10% FBS and incubated at 37°C with 5% CO2. After passage, the cell confluence was observed under a microscope 18-24 hours later. When the confluence reached approximately 90%, transfection could be performed.

[0046] Prepare transfection solution: 1) Take two 5mL EP tubes. Add 10μg of the target plasmid (PLVX CD19 CAR, PLVX CD19 IFNβ CAR), 7.5μg of the packaging plasmid psPAX2, 2.5μg of the packaging plasmid PMD2.G and 1mL of Opti-mem solution to one tube and mix thoroughly (solution 1); add 100μL of PEI transfection reagent and 1mL of Opti-mem solution to the other tube and mix thoroughly (solution 2).

[0047] 2) Add solution 2 to solution 1, vortex to mix, and then incubate at room temperature for 30 minutes.

[0048] 3) Add the above plasmid-PEI mixture to a 15cm culture dish and mix carefully; 4) Place the petri dish in a 37℃, 5% CO2 incubator and continue culturing; 5) Collect the supernatant twice, at 48 h and 72 h after transfection, and centrifuge at 3000 rpm for 20 min at room temperature. 6) Filter the viral supernatant using a 0.45μm filter to obtain PLVX CD19 CAR and PLVX CD19 IFNβ CAR viral stock solutions, respectively.

[0049] Lentiviral concentration: The virus was concentrated using ultracentrifugation (30,000g, 4°C, 3 h), and the concentrated virus can then be used to infect T cells.

[0050] Example 8: IFNAR1 Preparation of gene-edited autocrine IFNβ-secreting CAR-T cells Human PBMCs were obtained by Ficoll density gradient centrifugation using lymphocyte separation medium. T cells were then separated using CD3 magnetic bead sorting. After the T cells were activated for 24 hours with a CD3 / CD28 complex, the CD3 / CD28 beads were removed using a magnet, followed by electroporation.

[0051] In the electroporation step, 4 μg of Cas9 protein and 2 μg of sgRNA were introduced into 1×10⁻⁶ cells. 6 Personal primary T cells. Genes were introduced using a Lonza 4D-Nucleofector electroporator with the EH 115 electroporation program. After electroporation, the cells were incubated at 37°C and 5% CO2 for 24 hours. Cells were then counted, and the T cells were infected with packaged PLVXCD19 CAR and PLVXCD19 IFNβ CAR.

[0052] T cells were cultured in a 37°C, 5% CO2 incubator. On day 7 post-infection, the CAR positivity rate of T cells was detected using CD19 protein (Acro). Fresh culture medium was added every 2 days during the culture process.

[0053] The above steps can yield the following four types of CAR-T cells: IFNAR1 Unedited CD19 CAR-T cells IFNAR1 Gene knockout of CD19 CAR-T cells, IFNAR1 Unedited CD19 IFNβ CAR-T and IFNAR1Gene knockout of CD19IFNβ CAR-T cells.

[0054] Preparation process as follows Figure 9 As shown. By comparing the unedited control group with... IFNAR1 In the in vitro expansion of cells transfected with CD19 IFNβCAR, the knockout group showed significantly inhibited T cell expansion. Meanwhile, IFNAR1 Transfecting CD19 IFNβ CAR with IFNβ knockout not only overcomes the inhibitory effect of IFNβ, but also enhances the amplification capacity of CAR-T. Figure 10 ).

[0055] The proportion of CAR-positive cells in different CAR-T cells was detected by flow cytometry. Figure 11 ), showing that CD19 IFNβ CAR can be IFNAR1 Successful expression of the gene in knockout T cells yielded CD19 CAR-T cells with autocrine IFNβ function. IFNAR1 In the unedited control group, transfection efficiency was significantly reduced.

[0056] To verify whether the constructed IFNβ-autocrine CD19 CAR-T cells could express IFNβ, different CAR-T cells were cultured at different densities. Supernatants were collected after 24 and 48 hours, and IFNβ levels were detected by ELISA. Results are as follows: Figure 12 As shown, the ELISA results indicate that... IFNAR1 The defective CD19 IFNβ CAR-T cells were able to stably secrete IFNβ, indicating that this embodiment successfully constructed CAR-T cells with IFNβ auto-secretion ability.

[0057] Example 9: IFNβ overexpression enhances the killing effect of CAR-T cells on tumor cells The primary function of CAR-T cells is to recognize and kill tumor cells. This can be achieved through bioluminescence detection methods to compare... IFNAR1 Unedited CD19 CAR-T cells (WT) IFNAR1 Gene knockout CD19 CAR-T cells (KO) and IFNAR1 The ability of gene knockout CD19 IFNβ CAR-T cells (OE) to lyse Raji tumor cells.

[0058] Burkitt lymphoma cells Raji expressing firefly luciferase were seeded into 96-well plates at 3 × 10⁶ cells per well. 4CAR-T cells were used in triplicate wells. Untransfected T cells, WT group, KO group, and OE group CAR-T cells were added according to different effector-to-target ratios. After co-culturing at 37℃ and 5% CO2 for 48 hours, luciferase substrate was added to each well and incubated for 10 min. Bioluminescence intensity was quantified using a SynergyH4 microplate reader and the corresponding BioTek Gen5 software. Wells containing only target cells served as blank controls. The specific lysis rate was calculated using the following formula: Specific lysis rate (%) = [1 - (experimental group luminescence value) / (blank control group)] × 100%.

[0059] Experimental results show that ( Figure 13 Compared with untransfected T cells, CAR-T cells in the WT, KO, and OE groups all effectively lysed Raji tumor cells, and the lysis efficiency increased with the increase of the E:T ratio, indicating that the CAR-T cells all have in vitro killing activity. Among them, the OE group showed the highest lysis efficiency, indicating that IFNβ overexpression can further enhance the tumor killing function of CAR-T cells.

[0060] Example 10: IFNβ overexpression enhances Granzyme B and IFN-γ secretion from CAR-T cells. The CAR-T cells obtained in Example 8 from the WT, KO, and OE groups were mixed with Raji tumor cells at an effector-to-target ratio of 1:1 and seeded into 96-well plates for co-culture for 24 hours. After culture, the supernatant was collected by centrifugation, and the secretion levels of cytokines IFN-γ and Granzyme B after co-culture were detected by ELISA. The ELISA kit (purchased from Xinbosheng, China) was used according to the kit instructions. The results showed that all three groups of CAR-T cells could secrete IFN-γ and Granzyme B, but the secretion level in the OE group was significantly higher than that in the WT and KO groups, indicating that the secretion and expression of IFNβ can enhance the cytokine release function of CAR-T cells, thereby enhancing their in vitro anti-tumor effect. Figure 14 ).

[0061] Example 11: IFNβ overexpression promotes CAR-T cell proliferation To verify the effect of IFNβ on the proliferation capacity of CAR-T cells, the CFSE method was used to detect the CAR-T cells in the WT group, KO group and OE group obtained in Example 8.

[0062] One day prior to the experiment, target Raji cells were counted and treated with 2 μg / mL mitomycin C. Different groups of CAR-T cells were labeled with 2 µM CellTrace™ Violet dye, incubated in the dark for 25 min, and then the staining was terminated with culture medium. The dye-labeled CAR-T cells and mitomycin C-treated Raji cells were seeded at a 1:1 effector-to-target ratio into 48-well plates and cultured in medium without any exogenous cytokines. Flow cytometry was performed on day 5 to analyze changes in CAR-T cell proliferation. Figure 15 As shown, compared with the KO and WT groups, the OE group CAR-T cells showed a significantly higher proliferation level, indicating that IFNβ can effectively promote the in vitro proliferation of CD19 CAR-T cells.

[0063] Example 12: In vivo antitumor function study of IFNβ-overexpressing CAR-T cells Using NCG mice, 5×10 6 Raji tumor cells were subcutaneously inoculated into the right back of mice. The long axis (L) and short axis (W) of the tumor were measured using calipers, and the results were calculated according to the formula (L×W). 2 The tumor size was calculated by dividing the result by 2. After approximately 7 days, the subcutaneous tumor had reached a size of about 100–200 mm. 3 .

[0064] Mice were randomly grouped according to tumor size and given different treatments: untransfected T cells, IFNAR1 Unedited CD19 CAR-T cells (WT) IFNAR1 Defective CD19 CAR-T cells (KO) and IFNAR1 Defective CD19 IFNβ CAR-T cells (OE). Each mouse received 1 × 10⁻⁶ cells via tail vein. 6 We selected effector cells and adjusted the CAR positivity rate of effector cells in each group. Untransfected T cells served as the control group.

[0065] Tumor size was monitored every 3–4 days, and the mice's condition and survival were examined. Results showed that CAR-T cells in the WT, KO, and OE groups significantly inhibited lymphoma growth, with OE exhibiting a stronger tumor-suppressive effect and longer survival. Figure 16 ).

[0066] On days 6 and 14 of treatment, peripheral blood was collected via transorbital sampling, and flow cytometry was used to analyze the expansion of CAR-T cells and T cell subset typing in the peripheral blood. The results showed that IFNβ-secreted CAR-T cells had better in vivo expansion capacity, and the expanded CAR-T cells were predominantly central memory T cells (Tcm). Figure 17These results indicate that IFNβ overexpression can significantly promote the proliferation of CAR-T cells in vivo, promote their differentiation into Tcm, and significantly enhance the anti-tumor effect in NCG mice.

[0067] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0068] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. An engineered immune cell, characterized in that, Includes the following features: (i) IFNAR1 The gene was knocked out; (ii) Autocrine IFNβ; (iii) Specifically recognizes and kills tumor cells expressing CD19.

2. The engineered immune cells according to claim 1, characterized in that, It also includes the following features: (iv) Express CAR; (v) Immune cells are T cells or NK cells.

3. The engineered immune cells according to claim 1, characterized in that, It also includes the following features: (iv) The immune cells are T cells; (v) Express CAR or TCR.

4. The engineered immune cells according to claim 2 or 3, characterized in that, The CAR is composed of a CD8α signal peptide, a single-chain variable fragment scFv that recognizes CD19, a human CD8α transmembrane region, a CD28 co-stimulatory domain, an immune receptor tyrosine activation motif CD3ζ, a T2A self-cleaving peptide, and IFNβ in tandem.

5. The engineered immune cells according to claim 2 or 3, characterized in that, The CAR and IFNβ are co-expressed by the same vector.

6. A method for preparing engineered immune cells comprising the following characteristics, (i) IFNAR1 The gene was knocked out; (ii) Autocrine IFNβ; (iii) Specifically recognizes and kills tumor cells expressing CD19; (iv) Express CAR; (v) The immune cells are T cells; Its features are, Includes the following steps: Isolate primary human T cells; Knockout using the CRISPR / Cas9 editing system IFNAR1 Gene amplification and culture; The T cells were transfected with a lentiviral vector containing the CAR coding sequence. The genome was extracted, sequenced, and identified. The cells were then cultured on a larger scale to obtain the engineered immune cells. The CAR is composed of a CD8α signal peptide, a single-chain variable fragment scFv that recognizes CD19, a human CD8α transmembrane region, a CD28 co-stimulatory domain, an immune receptor tyrosine activation motif CD3ζ, a T2A self-cleaving peptide, and IFNβ in tandem.

7. The preparation method according to claim 6, characterized in that, The lentiviral vector containing the CAR coding sequence is the PLVX CD19 IFNβ CAR vector.

8. A pharmaceutical composition, characterized in that, It comprises engineered immune cells as described in any one of claims 1-5, or engineered immune cells prepared by the preparation method described in any one of claims 6-7, and pharmaceutically acceptable carriers or excipients.

9. The engineered immune cells according to any one of claims 1-5, or the engineered immune cells prepared by the preparation method according to any one of claims 6-7, or the use of the pharmaceutical composition according to claim 8 in the preparation of a medicament for treating tumors.

10. The use according to claim 9, characterized in that, The tumor is a CD19-positive tumor.

Images