Transcription factor gene osrav9 for regulating drought resistance of rice and application thereof

Abstract

This invention belongs to the field of plant genetic engineering technology, specifically involving the OsRAV9 gene, a transcription factor that regulates drought resistance in rice, and its application. A drought-induced expression of the OsRAV9 gene was screened, its nucleotide sequence being shown in SEQ ID NO:1; the protein sequence encoded by this gene is shown in SEQ ID NO:2. Using Agrobacterium-mediated transformation, OsRAV9 overexpressing transgenic lines and CRISPR / Cas9 mutant lines were obtained. Seedling drought stress experiments showed that under drought stress, the accumulation rate of MDA in OsRAV9 gene-deficient plants was accelerated, and sufficient free proline could not be formed. In contrast, OsRAV9 overexpressing plants showed a significant increase in free proline content and a relatively slower accumulation rate of malondialdehyde (MDA) under drought stress, preliminarily indicating that OsRAV9 positively regulates drought resistance in rice seedlings.

Description

OsRAV9 gene, a transcription factor that regulates drought resistance in rice, and its application. Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the functional identification and application of the transcription factor OsRAV9 gene in regulating drought resistance in rice. Background Technology

[0002] Rice is a widely cultivated major food crop globally (Giri J, Parida SK, Raghuvanshi S, et al. Emerging Molecular Strategies for Improving Rice Drought Tolerance. CurrGenomics, 2021, 22(1): 16-25). Drought is one of the major environmental stresses facing rice production, significantly reducing rice yield and quality. Studies show that the yield reduction caused by drought varies in different regions and years, generally ranging from 20-30%, while in severe cases, the reduction can reach 40-60%, and in some areas, there may even be a complete crop failure. In addition, drought can also lead to a decline in rice quality, affecting its nutritional value and taste (RAY DK, GERBER JS, MACDONALDG K, et al. Climate variation explains a third of global crop yield variability[J]. Nat Commun, 2015, 6: 5989.).

[0003] In recent years, drought-induced grain losses have reached approximately 40 billion kilograms, making the development of drought-resistant rice varieties an urgent necessity. However, due to the complexity and variability of drought environments, newly bred and promoted drought-resistant varieties may face reduced or even lost resistance after several years of application (Fukai S, Cooper M.. Development of drought-resistant cultivars using physiomorphological traits in rice. Field Crops Res, 1995, 40: 67-86). In this context, continuously identifying drought-resistant genes in rice and elucidating their molecular mechanisms of drought resistance is particularly important. Introducing drought-resistant genes into rice through genetic engineering to enhance its drought resistance is crucial for improving rice yield and quality and ensuring food security. Therefore, the research and application of drought-resistant genes have important reference value for the safe production of rice and are a key way to improve the drought resistance of rice and ensure food security (Wang, H., Ye, T., Guo, Z. et al. A double-stranded RNA binding protein enhances drought resistance via protein phase separation in rice. Nat Commun 15, 2514 (2024)).

[0004] The RAV gene family consists of plant-specific transcription factors belonging to the B3 superfamily. These genes possess one or more DNA-binding domains, including the B3 domain and the AP2 domain. They play crucial roles in plant growth and development, signal transduction, and abiotic stress responses (Genome-wide identification and expression analysis of transcription factors of RAV family in litchi. Yue XQ, Yang CK, Yue Z, Kai BZ. 2022). The AP2 / ERF (APETALA2 / ethylene responsive factor) transcription factor is one of the largest transcription factor families in plants and plays a vital role in regulating abiotic stress responses in rice. When rice encounters adverse conditions, the AP2 / ERF transcription factor can bind to cis-acting elements such as GCAC(A / G)N(A / T)TCCC(A / G)ANG(C / T), GCC-box(AGCCGCC), and DRE / CRT(A / GCCGAC) in the promoter regions of stress-related genes, thereby regulating the expression of these genes and improving the rice's adaptability to adverse environments (Tsubasa SJ, Ling Y. ERF gene clusters: working together to regulate metabolism. Trends Plant Sci, 2021, 26:23-32.). Furthermore, the AP2 / ERF transcription factor family plays an important role in the growth, development, and metabolite synthesis of plants. All AP2 / ERF transcription factor family proteins contain at least one highly conserved AP2 DNA-binding domain consisting of 60–70 amino acid residues (Nakano T, Suzuki K, Fujimura T, Shinshi H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol, 2006, 140:411-432.). The amino acid sequences of the AP2 / ERF transcription activation domain vary considerably and can be divided into three categories: those containing acidic amino acids, those containing acidic amino acids and serine, and those containing acidic amino acids and serine / threonine with hydroxyl groups. Some AP2 / ERF proteins contain a transcriptional repression domain, and transcription factors containing the EAR (L / FDLNL / F(X)P) motif play a negative regulatory role in the expression of plant stress response genes.Most RAV genes encode the conserved sequence R / KLFGV, known as the BRD (B3 repression domain), which primarily functions as a transcriptional repressor (Kagaya Y, Tsukaho H. Arabidopsis transcription factors, RAV1 and RAV2, are regulated by touch-related stimuli in a dose-dependent and biphasic manager. Genes Genet Syst, 2009, 84: 95-99.). Furthermore, each AP2 / ERF transcription factor contains one or more nuclear localization signaling regions, primarily containing arginine and lysine, which regulate the transcription factor's entry into the nucleus to perform its function (Wang Y H. Rice ERF Transcriptional Activator DRF2 Regulates Wax Biosynthesis in Leaf Surface. MS Thesis of Chinese Academy of Agricultural Sciences, Beijing, China, 2010). AP2 / ERF transcription factors, especially the ERF and DREB subfamilies, occupy important positions in rice stress response signaling pathways. Under normal growth conditions, the expression level of AP2 / ERF genes is usually low, but it increases significantly when subjected to abiotic stress. AP2 / ERF can bind to elements such as GCC-box, DRE / CRT, or GT-1 (GAAAAA) to regulate the expression of downstream target genes, ultimately causing physiological and biochemical changes and helping to resist external abiotic stress.

[0005] In summary, the RAV gene family plays diverse roles in plant biology, with functions encompassing growth and development, stress response, and hormone signaling. In-depth research on the RAV gene family helps us understand how plants adapt to and respond to complex environmental changes, providing a theoretical basis and molecular tools for crop improvement and agricultural production. However, the drought resistance function of the RAV family in rice remains unclear. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings and deficiencies of existing technologies and to provide an application of the transcription factor gene OsRAV9 in drought resistance of rice. This application involves overexpressing OsRAV9 to enhance the drought resistance of rice, providing a new genetic resource for drought-resistant rice breeding.

[0007] To achieve the above technical objectives, this application adopts the following technical solution:

[0008] (1) Cloning of the OsRAV9 gene

[0009] RNA was extracted from leaves of the japonica rice variety Nipponbare and reverse transcribed into cDNA using Superscript III (purchased from Invitrogen, USA). Reaction conditions: 65℃ for 5 min, 50℃ for 60 min, and 70℃ for 10 min. Using rice genome information, amplification primers OsRAV9-full-F (5'ATGGGGGTGGTCAGCTTCTC 3') and OsRAV9-full-R (5'ATCACCAGAGTCCAACACATTACCT3') were synthesized to amplify the full-length cDNA of the OsRAV9 gene (1722 bp). PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 2 min 50 sec, 28 cycles; extension at 72℃ for 7 min. The PCR product obtained by amplification was ligated into the pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced to obtain the required gene ORF, the sequence of which is the nucleotide sequence shown in SEQ ID NO:1, encoding a 365 amino acid sequence (the sequence shown in SEQ ID NO:2).

[0010] (2) OsRAV9 gene overexpression and construction of CRISPR / Cas9 knockout lines

[0011] This invention constructed an overexpression vector pU1301-OsRAV9-Flag (see Figure 2A) and a CRISPR / Cas9-OsRAV9 gene knockout vector (Figure 2B). The applicant used Agrobacterium-mediated transformation to transform these two vectors into the japonica rice variety Nipponbare, obtaining positive lines for gene overexpression and CRISPR / Cas9 positive lines. The expression levels were detected, and two T1 generation overexpression lines (numbered OE-RAV9-14 and OE-RAV9-13, see Figure 3A) and two CRISPR / Cas9 transformed lines were selected. (Detection primers were designed upstream and downstream of the target site to amplify the corresponding fragments and perform sequencing. Materials with gene editing at the target site, resulting in large fragment deletions or premature translation termination, were screened for subsequent experiments. Finally, two lines with premature termination, numbered RAV9-4 and RAV9-9 (see Figure 3B), were selected as materials for subsequent experiments.)

[0012] (3) Functional identification of OsRAV9 gene under drought stress

[0013] This invention identified drought stress in OsRAV9 transgenic materials (overexpression lines and CRISPR / Cas9 mutant lines). Compared with the control materials, the OsRAV9 overexpression materials showed significantly improved drought resistance, while the RAV9 mutants were less drought-tolerant (Figure 4). Seedling drought stress experiments showed that under drought stress, OsRAV9 gene-deficient plants accumulated MDA at an accelerated rate and could not form sufficient free proline, while OsRAV9 overexpression plants showed a significant increase in free proline content and a relatively slower MDA accumulation rate under drought stress, preliminarily indicating that OsRAV9 positively regulates drought resistance in rice seedlings (Figure 5). These results suggest that OsRAV9 may have potential functions in drought resistance and lodging resistance in rice, providing a theoretical basis and new germplasm resources for breeding drought-resistant and lodging-resistant rice varieties.

[0014] Advantages of this invention:

[0015] (1) This invention analyzes the drought-induced expression patterns of the rice RAV gene family, screens and identifies the OsRAV9 gene, and subsequent studies have found that OsRAV9 is a positive regulator of drought resistance in rice. Through genetic transformation, overexpression of this gene yields a new drought-resistant rice line.

[0016] (2) There are very few research reports on RAV genes in rice, and few documents support that rice RAV genes can participate in the synergistic regulation of drought resistance. The OsRAV9 gene cloned in this invention enriches the research on this type of functional gene in rice.

[0017] (3) Rice with overexpression of OsRAV9 showed significantly enhanced resistance to drought stress, while the rav9 mutant was less drought-tolerant. This indicates that the OsRAV9 gene is involved in the drought resistance response of rice and plays an important role. Increasing the expression level of the OsRAV9 gene can regulate the accumulation of resistance factors in rice, thereby improving the drought resistance of rice. Attached Figure Description

[0018] Figure 1: Schematic diagram of OsRAV9 induced expression. Figure label explanation: Figure 1 shows the significantly induced expression of OsRAV9 in wild-type (i.e., non-transgenic) 'Nipponbare' rice after drought stress, compared to the control.

[0019] Figure 2: Construction of OsRAV9 overexpression vector and CRISPR / Cas9 gene knockout vector. Figure labeling: Figure A in Figure 2 is a map of the pU1301-OsRAV9-3*Flag overexpression vector. Figure B in Figure 2 is a map of the CRISPR / Cas9-OsRAV9 gene knockout vector.

[0020] Figure 3: Detection results of transgenic progeny. Figure labeling: Figure A in Figure 3 shows the detection results of OsRAV9 overexpression material (T1 generation). Figure labeling: Two transgenic rice lines, OE-RAV9-14 (high expression level) and OE-RAV9-13 (medium expression level), were selected for subsequent studies. Figure B in Figure 3 shows the detection of RAV9 mutant gene editing type. Two mutant lines, RAV9-4 and RAV9-9, with premature translation termination, were selected for subsequent studies.

[0021] Figure 4: Statistical analysis of drought stress phenotypes and survival rates after drought stress in control and transgenic materials. Figure labeling: Figure A in Figure 4 shows the phenotypic observation of control and transgenic materials after 15 days of drought stress. Figure B in Figure 4 shows the statistical results of survival rates after 15 days of drought stress in control and transgenic materials. The results indicate that, compared with the control material, OsRAV9 overexpression is more drought-resistant, while the RAV9 mutant is more sensitive to drought.

[0022] Figure 5: Proline and malondialdehyde (MDA) content in leaves of control and transgenic materials after 15 days of drought stress treatment. Figure labeling: In Figure 5A, after 15 days of drought stress, the Pro content per 1g of leaf in the knockout rav9 material was significantly lower than that in the wild type, while the proline content in the overexpression material OE-14 was higher than that in the wild type. In Figure 5B, compared to the wild type, the MDA content per 1g of OE-OsRAV9 rice leaves decreased, while the MDA content in osrav9 leaves was significantly higher. The results indicate that under drought stress, OsRAV9 gene-deficient plants cannot form sufficient free Pro, and the MDA accumulation rate in these plants is accelerated. In contrast, OsRAV9 overexpression plants showed a significant increase in free Pro content and a relatively slower MDA accumulation rate under drought stress, suggesting that OsRAV9 positively regulates drought resistance in rice seedlings. Detailed Implementation

[0023] Description of sequences in a sequence list

[0024] SEQ ID NO: 1 is the nucleotide sequence of the OsRAV9 gene cloned in this invention.

[0025] SEQ ID NO: 2 is the protein sequence encoded by the OsRAV9 gene.

[0026] The following examples define the present invention and describe the methods for isolating and cloning cDNA segments containing the complete coding region of the OsRAV9 gene, and for verifying the function of the OsRAV9 gene. Based on the following description and these examples, those skilled in the art can determine the essential features of the invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from its spirit and scope.

[0027] Example 1: Isolation and Cloning of the OsRAV9 Gene

[0028] 1. Rice RNA extraction and reverse transcription

[0029] Total RNA was extracted from fresh leaves of wild-type japonica rice cultivar Nipponbare (a publicly used rice material). The MiniBEST Plant RNA Extraction Kit was used, following the instructions for the TaKaRa PrimeScript TMRT reagent Kit with gDNA Eraser. The obtained RNA samples were first subjected to a genomic DNA removal reaction. The DNA removal reaction solution consisted of: 2.0 μL 5×gDNA Eraser Buffer, 1.0 μL gDNA Eraser, 1.0 μg RNA, and 6.0 μL RNase-free ddH2O. After mixing, the mixture was incubated in a dry bath at 42°C for 2 min. The digested mixture was then used for reverse transcription. The reaction solution consisted of: 1.0 μL PrimeScript RT EnzymeMix I, 4.0 μL RT Primer Mix, 4.0 μL 5×Prime Script Buffer 2, 1.0 μL RNase-Free ddH2O, and 10.0 μL of the digested mixture. Reverse transcription reaction conditions: 37℃, 15 min; 85℃, 5 sec, 4℃ storage.

[0030] 2. Analysis of OsRAV9 gene expression pattern induced by PEG-simulated drought stress

[0031] To investigate whether the OsRAV9 gene is involved in the drought resistance process of rice, this invention used RT-qPCR to detect the relative expression level of the OsRAV9 gene transcription in wild-type rice after drought stress. The results showed that the OsRAV9 gene expression was significantly upregulated by PEG drought stress. Wild-type 'Nipponbare' rice is a conventional japonica rice variety. Drought stress experiments were conducted on it when it reached the 4-leaf stage. After the stress experiment, total RNA was extracted from leaves of the treated lines and reverse transcribed into cDNA as a template. OsRAV9-specific primers were designed: forward primer qOsRAV9-F (5'CGTCTGTTGTTTCATCTTCGAT3') and reverse primer qOsRAV9-R (5'CATTTGCAATCTCTGACCTGAC 3'). Using rice endogenous actin Actin (gene accession number AK101613) as an internal reference gene, forward primer Actin-F (5'GAGACCTTCAACACCCCTGCTA3') and reverse primer Actin-R (5'ATCACCAGAGTCCAACACATTACCT3') were designed. Real-time quantitative RT-qPCR analysis was performed using a Geeen PCR Master Mix kit (following the kit instructions) on a BIO-Rad-CFX Connect real-time PCR instrument. Results showed that OsRAV9 expression was significantly upregulated inducible by drought, suggesting that OsRAV9 may be involved in rice's drought resistance response.

[0032] 3. Obtaining the OsRAV9 gene sequence

[0033] The full-length sequence of OsRAV9 was cloned using cDNA from Nipponbare japonica rice as a template, with forward primer OsRAV9-full-F (5'ATGGGGGTGGTCAGCTTCTC 3') and reverse primer OsRAV9-full-R (5'TAGGTGCCCTGCTGTTATAG 3'). PCR reaction conditions: 94℃ pre-denaturation for 3 min; 30 cycles of 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 1 min followed by 330 sec; extension at 72℃ for 7 min. The amplified PCR product was ligated into the pGEM-T vector, positive clones were screened and sequenced, and positive strains were stored at -80℃. The open reading frame (ORF) of the desired OsRAV9 gene was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. The 574 amino acids corresponding to the open reading frame (ORF) of the OsRAV9 gene were determined using BlastX (http: / / www.ncbi.nlm.nih.gov), and the protein sequence encoded by the OsRAV9 gene was inferred as shown in the sequence listing SEQ ID NO: 2.

[0034] Example 2: OsRAV9 overexpression and CRISPR / Cas9 gene knockout vector construction

[0035] 1. Construction of overexpression vectors

[0036] To verify the gene function of OsRAV9, the applicant constructed an overexpression vector to transform Nipponbare embryogenic callus. Using the plasmid of the OsRAV9 positive clone obtained in Example 1 as a template, overexpression primers were designed, with homologous recombination adapter bases added to both ends of the primers. These primers were named the forward primer OsRAV9-OE-F (5'GAACGATAGCCGGTACCATGGGGGTGGTCAGCTT') and the reverse primer OsRAV9-OE-R (5'CTTTGTAATCGGATCCCTATAACAGCAGGGCACC 3'), respectively, and PCR amplification was performed. The obtained PCR products were subjected to agarose gel electrophoresis and purified, then stored at -20℃ for later use. The pU1301-3*Flag strain was activated in liquid LB medium (with 50 mg / L kanamycin added), and the plasmid was extracted. The plasmid was then double-digested with KpnI and BamHI, and the digested products were purified and stored at -20℃ for later use. The OsRAV9 target fragment, recovered from the above enzyme digestion, was infused with the linearized vector pU1301-3*Flag using a homologous recombinase to obtain the recombinant vector (pU1301-OsRAV9-3*Flag). The specific reaction system was as follows: 1.0 μL of double-digested linearized pU1301-3*Flag vector, 1.0 μL of 5×CEⅡBuffer, 0.5 μL of Exnase II homologous recombinase, 0.8 μL of PCR-purified and recovered OsRAV9 with the vector adapter, and the volume was brought to 5.0 μL with sterile ddH2O. After incubation at 37℃ for 0.5 h, heat shock transformation was performed on Escherichia coli strain DH5α. The specific transformation procedure is as follows: Thaw *E. coli* DH5α competent cells stored at -80℃ on ice. Add 50 μL of competent cells to 5 μL of the ligation reaction mixture, mix gently, and place on ice for 15-30 min. After the ice bath, incubate at 42℃ for 90 sec, then immediately place on ice for 3 min. Add 400 μL of LB liquid medium and incubate at 37℃, 200 rpm for 45 min to recover the cells. After recovery, centrifuge at 5000 rpm for 2 min, discard 300 μL of supernatant, and resuspend the cells in the remaining supernatant. Spread the bacterial suspension evenly on LB solid medium (with 50 mg / L kanamycin added) and incubate inverted at 37℃ overnight. Pick single clones, select 2-3 positive clones for sequencing, and preserve the strain without any mutations and the corresponding plasmid, naming it recombinant plasmid pU1301-OsRAV9-3*Flag.The correctly sequenced recombinant plasmid pU1301-OsRAV9-3*Flag was transformed into competent Agrobacterium tumefaciens EHA105 cells using a freeze-thaw method. Single colonies were picked and cultured on YEP liquid medium (YEP liquid medium is a commonly used medium; in this example, 30 mg / L rifampin and 50 mg / L kanamycin were added). The culture was shaken at 28°C for 36-48 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use.

[0037] 2. Construction of CRISPR / Cas9 gene knockout vector

[0038] Utilizing the CRISPR-P 2.0 developed by the State Key Laboratory of Genetic Improvement for Major Crops in Central China (Central China Agricultural University) CRISPR-P v2.0(hzau.edu.cn) Design of OsRAV9 guide RNA (gRNA). Based on the OsRAV9 DNA sequence and gene structure, two gRNAs were designed (i.e., gRNA1: 5'GCAGTCGTCGCGGTACAAGG 3'; gRNA2: 5'CGCGGCCACCAACTTCCCCG 3'). Adapter primers RAV9-gRNA1-U3F (5'GCAGTCGTCGCGGTACAAGGgttttagagctagaaata 3'), RAV9-gRNA1-U3R (5'CCTTGTACCGCGACGACTGCtgcaccagccgggaat 3'), and RAV9-gRNA2-U3F (5'...

[0039] CGCGGCCACCAACTTCCCCGgttttagagctagaaata 3'),RAV9-gRNA2-U3R(5'

[0040] CGGGGAAGTTGGTGGCCGCGtgcaccagccgggaat 3'), and the adapter primers S5AD5-F (5'CAGATGATCCGTGGCAACAAAG3') and S5AD5-R (5'TTTCTAGCTCTAAAACAAAA 3') required for gRNA to be ligated into the expression vector pRGEB32; L5AD5-F (5'CAGATGATCCGTGGCAACAAAGCACCAGTGGTCTAG3') and L5AD5-R (5'

[0041] TTTCTAGCTCTAAAACAAAAAAAAAAGCACCGACTCG3'). Using pGTR plasmid as a template, PCR amplification was performed using three primer pairs: L5AD5-F / RAV9-gRNA1-U3R, RAV9-gRNA1-U3F / RAV9-gRNA2-U3R, and RAV9-gRNA2-U3F / L5AD5-R. PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 30 sec, 26 cycles; 72℃ extension for 7 min. The three obtained RCR products were diluted 20-50 times and mixed in equal volumes. 1 μL of the above mixture was used as a template for amplification using primer pair S5AD5-F / S5AD5-R. PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 45 sec, 26 cycles; 72℃ extension for 7 min. The obtained product (i.e., a DNA fragment containing two gRNAs in tandem) was purified and its concentration was determined. The CRISPR / Cas9 expression vector pRGEB32 was digested with BsaI, and the digestion product was purified and recovered to obtain a linearized pRGEB32 vector. The purified PCR product was ligated into the linearized pRGEB32 vector using infusion recombination. Specific reaction conditions: 100 ng PCR product, 50-80 ng linearized pRGEB32 vector, 1 μL infusion enzyme (Takara), 1 μL 10× infusion buffer, ddH2O added to 10 μL, reacted at 50℃ for 30 min. The above reaction product was heat-shocked and transformed into *E. coli* DH5α. Single clones were selected for positive detection and sequencing. Positive strains and plasmids were preserved, and the positive plasmid was transformed into *Agrobacterium tumefaciens* EHA105 competent cells. Single colonies were picked and cultured on YEP liquid medium (YEP liquid medium is a commonly used medium, and in this example, 30 mg / L rifampicin and 50 mg / L kanamycin were added), and cultured at 28°C with shaking for 36-48 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use.

[0042] Example 3: Genetic transformation of rice

[0043] 1. Callus Induction: Prepare sterile callus induction medium in advance. Pour 40-50 mL of induction medium into a 100 mL Erlenmeyer flask. Remove the husks from rice seeds (Nipponbare variety, same as above). Perform aseptic operations in a laminar flow hood, first soaking the seeds in 75% ethanol solution for 1 min, then soaking them in 0.1% HgCl2 solution for 15-20 min, and finally washing them 5-10 times with sterile water. Inoculate 8-12 seeds into each flask and incubate in the dark at 28℃ for 40-50 days to induce callus formation.

[0044] 2. Subculture: Prepare the subculture medium 2-3 days in advance, using the callus induction medium formula. Sterilize the medium using standard methods to ensure it is dry (medium with excessive moisture is detrimental to callus growth). Select pale yellow, granular, dry, and highly viable callus tissue from the induced callus and transfer it to the subculture medium. Incubate in the dark at 28°C for 20 days.

[0045] 3. Pre-culture: Dispense sterile pre-culture medium into 500mL Erlenmeyer flasks in advance. Before the experiment, add 300μL of 100Mm acetylsyl syringone and 5mL of 40% glucose to every 250mL of medium, mix well, and fill 8-10 plates of medium into each flask. From the subcultured callus, pick out pale yellow, granular, dry, and viable callus tissue and transfer it into the culture plates of pre-culture medium. Inoculate about 60-80 pieces of callus tissue the size of mung beans into each plate. If the callus tissue is too large, it can be crushed with sterile forceps. Incubate in the dark at 8℃ for 3 days.

[0046] 4. Infection and Co-culture: Two days before the experiment, Agrobacterium strains containing the target gene (OsRAV9) were streaked onto Petri dishes containing antibiotics (30 mg / L rifampin and 50 mg / L kanamycin) to activate the bacteria. Prepare suspension medium (100 mL / strain), co-culture medium (250 mL / strain), large Petri dishes, small Petri dishes (lined with absorbent paper and filter paper, sterilized and dried before use), and several 250 mL sterile Erlenmeyer flasks. The streaked Agrobacterium was scraped into 1 / 2 N6 suspension medium (N6 medium is a commonly used plant tissue culture medium, with 100 μL AS + 2 mL 50% glucose added), and incubated at 28℃ and 200 rpm for 30 min. Simultaneously, the pre-cultured callus was collected into 250 mL sterile Erlenmeyer flasks while shaking the bacteria. The Agrobacterium culture was poured into the callus and soaked for 30 min. Discard the bacterial suspension. First, invert the Erlenmeyer flask containing the callus tissue onto a sterile dish to absorb the bacterial suspension. Then, spread the callus tissue onto filter paper in a sterile dish, cover it with another sheet of filter paper, and gently press the callus tissue with sterile forceps to absorb the surface bacterial suspension. Allow it to air dry for 3-4 hours. Use a sterile spoon to evenly spread the fully dried callus tissue onto the co-culture medium (it's best not to move it after spreading to reduce contact between the medium and the callus surface and prevent excessive growth of Agrobacterium). Incubate in the dark at 19°C for 3 days.

[0047] 5. Washing and Screening (S1 medium): Prepare sterile water, large and small dishes (containing absorbent paper and filter paper), several 250mL Erlenmeyer flasks, and screening medium. Transfer the co-cultured callus to a washing cup, pour in sterile distilled water until the callus is completely submerged, cover and shake for 20-30 seconds, then discard the sterile distilled water. Repeat this process 2-3 times. Add sterile distilled water until the callus is completely submerged, cover and shake to mix, shake for 20-30 seconds, let stand for 5 minutes, then discard the sterile distilled water. Add sterile distilled water until the callus is completely submerged, cover and shake to mix, shake for 20-30 seconds, then let stand for 10 minutes. Finally, discard the sterile distilled water, add sterile distilled water containing 500mg / L carbenicillin, and shake at 200rpm for 30 minutes. Discard the distilled water and allow the callus to air dry. Transfer the treated callus to screening medium and incubate in the dark at 28℃ for 20 days.

[0048] 6. Screening (referred to as culture medium S2): Prepare screening culture medium S2. Add 300 μL carbenicillin, 250 μL hygromycin, and 5 mL 50% glucose to each 250 mL culture medium. After pouring, open the lid on a clean bench and blow with sterile air for 1.5-2 hours. The surface of the screening medium should not be too wet, otherwise it will not be conducive to the inhibition of Agrobacterium and the growth of resistant callus during screening. Select dry callus that is not contaminated with Agrobacterium from S1 culture medium and place it on S2 culture medium (inoculate 25 to 30 callus tissues per plate). Incubate in the dark at 28°C for 20 days.

[0049] 7. Callus differentiation: Prepare the differentiation medium 3-4 days in advance. Select small pieces of pale yellow, dense, and dry resistant callus tissue, inoculate them into the differentiation medium, and culture them at 28℃ under light (light intensity 3000 Lux) for 40 days. Seedlings will differentiate in the later stage of culture.

[0050] 8. Rooting: Prepare the rooting medium 2-3 days in advance. Prepare 4-5 sterile empty dishes; remove the differentiated seedlings from the differentiation medium, taking only one seedling from each callus, trimming excessively long leaves and roots with scissors, and inoculate them into rooting tubes, with 1-2 seedlings in each tube; culture in a light culture room (light intensity 3000 Lux) for 15-20 days, and after the roots have grown sufficiently, harden off the seedlings for 4-7 days, and then transplant them to the greenhouse.

[0051] The specific culture medium formulation and preparation method for rice genetic transformation involved in the embodiments of the present invention are as follows:

[0052] Mother liquor formula:

[0053] 1. MSmax stock solution (10X)

[0054]

[0055] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.

[0056] 2. MSmin stock solution (100X)

[0057]

[0058]

[0059] Note: Na2MoO4 must be dissolved separately before mixing with other components, and then diluted with distilled water to a final volume of 1000 mL. Store at room temperature.

[0060] 3. N6max stock solution (10X)

[0061]

[0062] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.

[0063] 4. N6min stock solution (100X)

[0064]

[0065] Dilute to 1000 mL with distilled water and store at room temperature.

[0066] 5. Fe2+-EDTA stock solution (100X)

[0067] Add 300 mL of distilled water and 2.78 g of FeSO4·7H2O to a reagent bottle;

[0068] Add 300 mL of distilled water to another reagent bottle and heat to 70 °C. Then add 3.73 g of Na2EDTA·2H2O and dissolve it. Mix the solutions from the two reagent bottles and keep them at 70 °C for 2 hours. Then add distilled water to make up to 1000 mL and store at 4 °C protected from light.

[0069] 6. Vitamin stock solution (100X)

[0070]

[0071] Add distilled water to a final volume of 1000 mL and store at 4°C.

[0072] 7. AAmax stock solution (10X)

[0073]

[0074] Add distilled water to a final volume of 1000 mL and store at room temperature away from light.

[0075] 8. AAmin stock solution (100X)

[0076]

[0077] Dissolve Na2MoO4 separately, then mix it with other components and add distilled water to bring the volume to 1000 mL. Store at room temperature away from light.

[0078] 9.6-BA stock solution (1 mg / mL)

[0079] Add 100 mg of 6-BA to 1.0 mL of 1 M KOH and shake until the 6-BA dissolves. Then add distilled water to bring the volume to 100 mL and store at room temperature.

[0080] 10. KT stock solution (1 mg / mL)

[0081] Add 100 mg of KT to 1.0 ml of 1 M KOH and shake until KT dissolves. Then add distilled water to bring the volume to 100 mL and store at room temperature.

[0082] 11.2,4-D stock solution (1 mg / mL)

[0083] Add 100 mg of 2,4-D to 1.0 mL of 1 M KOH and shake for 5 min. Then add 10 mL of distilled water and shake until the 2,4-D dissolves. Make up to 100 mL with distilled water and store at room temperature.

[0084] 12.100μM AS stock solution

[0085] AS 0.196g;

[0086] 10 mL of DMSO;

[0087] Aliquot into 1.5mL centrifuge tubes and store at 4°C.

[0088] 13. IAA stock solution (1 mg / mL)

[0089] Add 100mg of IAA to 1.0ml of 1N KOH and shake until the IAA dissolves. Then, bring the volume to 100ml with dH2O and store at room temperature away from light.

[0090] 14. NAA stock solution (1 mg / mL)

[0091] Add 100 mg of NAA to 1.0 mL of 1 M KOH and shake until the NAA dissolves. Then, bring the volume to 100 mL with distilled water and store at room temperature away from light.

[0092] Culture medium formulation:

[0093] 1. Induction medium

[0094]

[0095]

[0096] Add distilled water to bring the volume to 1000 mL.

[0097] 2. Subculture medium

[0098] Add distilled water to bring the volume to 1000 mL.

[0099] 3. Pre-culture medium

[0100] Add distilled water to a final volume of 250 mL.

[0101] 4. Co-culture medium

[0102] Add distilled water to a final volume of 250 mL.

[0103] 5. Suspension culture medium

[0104] Add distilled water to bring the volume to 100 mL.

[0105] 6. Screening culture medium

[0106] Add distilled water to a final volume of 250 ml.

[0107] 7. Differentiation medium

[0108]

[0109] Add distilled water to bring the volume to 1000 mL.

[0110] 8. Rooting medium

[0111]

[0112] Add distilled water to bring the volume to 1000 mL.

[0113] Example 4: Identification of drought resistance in transgenic materials

[0114] 1. Cultivation of transgenic rice materials

[0115] Seeds from three rice lines—T1 overexpression line, knockout line, and wild-type 'Nipponbare'—with plump grains and consistent morphology were selected. The glumes were removed by hand to ensure grain integrity. The seeds were placed in sterile conical flasks and soaked in 75% ethanol for 1 minute, then the ethanol was discarded. The seeds were then soaked in 0.15% HgCl2 solution for 15–20 minutes, and the HgCl2 solution was poured into a mercuric chloride recovery bottle. Finally, the seeds were washed 7–8 times with sterile ddH2O. After blotting the seeds dry on filter paper, they were evenly spread on MS medium prepared 3 days in advance and placed in a constant temperature and light incubator. The culture conditions were set at 28℃, light intensity of 300 μmol·m⁻²·s⁻¹, 14 h light / 10 h dark, and 70% relative humidity. When the first true leaf of the rice seedlings unfolded, the seedlings were transferred to rice nutrient solution and cultured until the three-leaf stage, while maintaining other conditions.

[0116] 2. Identification of drought resistance in seedlings of transgenic materials

[0117] This experiment was based on the "Identification of Seedling Phenotypes in Rice under Abiotic Stress" published by Huazhong Agricultural University, with slight modifications. Rice seedlings from three lines—T2 generation overexpression line, knockout line, and wild-type "Nipponbare"—with consistent growth were carefully transplanted into small pots. They were cultured in a 28℃ constant-temperature greenhouse with 14 hours of light, 10 hours of darkness, and 70% relative humidity to simulate a natural growth environment. When the seedlings reached the 4-leaf stage, surface water was carefully drained or watering was stopped, and photos were taken for recording. Subsequently, the number of days of leaf curling was recorded daily at the same time for each individual plant. After 10-15 days of drought treatment, when the control group showed irreversible full leaf curling (leaves were still curled in the morning, depending on air temperature and humidity), rehydration was performed to examine the phenotype, and photos were taken to calculate the survival rate.

[0118] 3. Measurement of physiological and biochemical indicators related to drought stress

[0119] Rice leaves were collected after 10 days of drought stress. The contents of malondialdehyde (MDA) and proline (Pro) were determined according to the instructions accompanying the Solarbio MDA and Proline content detection kit. Three to five replicates were taken for each measurement line, and the average value was calculated.

Claims

1. The application of overexpression of the transcription factor OsRAV9 gene in improving drought resistance in rice, characterized by: The nucleotide sequence of the rice OsRAV9 gene is shown in SEQ ID NO:1.

Images