CCR7-mediated migration of dendritic cell-derived exosomes and improvement of cardiac function after myocardial infarction

By overexpressing the CCR7 chemokine receptor in dendritic cells, the migration of DEXs to the spleen was enhanced, and the secretion of IL-4 and IL-10 was activated, thus resolving the problem of unclear migration mechanism of DEXs and improving cardiac function after MI.

CN121495867APending Publication Date: 2026-02-10QINGPU BRANCH OF ZHONGSHAN HOSPITAL AFFILIATED TO FUDAN UNIV (SHANGHAI QINGPU DISTRICT CENT HOSPITAL)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511729067.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-24
Publication Date
2026-02-10

AI Technical Summary

Technical Problem

The mechanism by which dendritic cell-derived exosomes (DEXs) migrate to lymphoid tissues after myocardial infarction (MI) is unclear, affecting their therapeutic effect, and the mechanism of cardiac function recovery after MI is still unclear.

Method used

By overexpressing or upregulating the activity of CCR7 chemokine receptor in dendritic cells, DEXs are enhanced to migrate to the spleen, and cells secreting IL-4 and IL-10 are activated, thus improving cardiac function.

Benefits of technology

It enhanced the migration of DEXs to the spleen, reduced the inflammatory response, improved myocardial systolic and diastolic function, and improved cardiac function after MI.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention relates to migration of CCR7-mediated dendritic cell-derived exosomes and improvement of cardiac functions after myocardial infarction, in particular to a dendritic cell-derived exosome, CCR7 expression or activity in the dendritic cell is up-regulated, CCR7 overexpression can enhance migration of the dendritic cell-derived exosomes to the spleen, and CCR7 expression or activity of the dendritic cell-derived exosomes is up-regulated. And the CCR7 knockdown weakens the migration ability of the dendritic cell source exosome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of immunology, specifically to CCR7-mediated migration of dendritic cell-derived exosomes and improvement of cardiac function after myocardial infarction. Background Technology

[0002] Despite significant advances in the diagnosis and treatment of myocardial infarction (MI), it remains the leading cause of death worldwide. The progression of MI often triggers adverse ventricular remodeling, ultimately leading to ventricular dysfunction and even death. The immune system plays a crucial role in ventricular remodeling, participating in both the inflammatory and repair phases. Previous studies have shown that dendritic cell-derived exosomes (DEXs) can migrate to lymphoid tissues and activate CD4+. + T cells improve cardiac function after myocardial infarction (MI). Prolonging the residence time of diabetic excitatory molecules (DEXs) in vivo can lead to more desirable immunomodulatory effects and enhance their therapeutic efficacy. However, whether the migration of MI-DEXs plays an additional role in their therapeutic effect, and the mechanisms by which DEXs migrate to lymphoid tissues, remain unclear.

[0003] Dendritic cells (DCs), as core immune regulators in both innate and adaptive immunity, play a crucial role in wound healing after myocardial infarction (MI). In animal models of MI, DC removal led to a more severe inflammatory response and poorer ventricular remodeling compared to controls, suggesting a protective effect of DCs during the inflammatory phase following MI. Furthermore, DCs pretreated with infarct lysate were able to activate infarct-specific regulatory T cells in lymph nodes, spleen, and infarcted myocardium, promoting wound remodeling, maintaining left ventricular systolic function, and improving survival. These results suggest that DCs have a protective effect after MI, and their therapeutic effect is partly dependent on CD4+. + Activation of T cells.

[0004] Exosomes are small vesicles secreted by cells, containing proteins, DNA, and RNA, and are considered "messengers" for intercellular communication. Exosomes derived from immune cells participate in communication between immune cells; DEXs can participate in antigen presentation and can also migrate to lymphoid tissues after myocardial infarction (MI).

[0005] Chemokine receptors (CCRs) and their ligands (CCLs) are key factors regulating immune cell migration. Dendritic cells (DCs) highly express CCR7 after antigen uptake. CCR7 and its ligands CCL19 and CCL21 can promote the precise migration of DCs to lymphoid tissues. However, whether CCR7 is also involved in the migration of dendritic cells (DEXs) remains unclear.

[0006] This study aims to explore the role of CCR7 and its ligands CCL19 / CCL21 in the migration of DEXs and further analyze the association between DEX migration and improvement of cardiac function after MI, thereby providing new candidate strategies for protecting cardiac function after MI. Summary of the Invention

[0007] The present invention first provides a dendritic cell-derived exosome, wherein the expression or activity of CCR7 in the dendritic cells is upregulated.

[0008] In one or more embodiments, the dendritic cells are bone marrow-derived dendritic cells.

[0009] In one or more embodiments, bone marrow-derived dendritic cells are derived from mammals.

[0010] In one or more embodiments, the mammal includes one or more of the following: mouse, rabbit, cow, pig, sheep, dog, cat, and horse.

[0011] In one or more embodiments, the rat includes one or more of mice, rats, hamsters, and guinea pigs.

[0012] In one or more embodiments, the mammal is a mammal suffering from myocardial infarction, preferably a mouse suffering from myocardial infarction.

[0013] In one or more embodiments, the lymphoid tissue includes the spleen or lymph nodes.

[0014] In one or more embodiments, the exosomes overexpress the chemokine receptor CCR7.

[0015] In one or more embodiments, the upregulation of CCR7 expression or activity includes: transferring the coding sequence of the CCR7 protein into dendritic cells to obtain transformed dendritic cells.

[0016] In one or more embodiments, the dendritic cells are dendritic cells treated with damage-associated molecular patterns (DAMP).

[0017] In one or more embodiments, the dendritic cells are dendritic cells treated with the myocardial injury microenvironment.

[0018] In one or more embodiments, the myocardial injury microenvironment includes: (1) supernatant of hypoxic cultured primary cardiomyocytes; (2) supernatant of infarcted mouse myocardial tissue; and (3) supernatant of necrotic HL-1 cells.

[0019] The present invention also provides a pharmaceutical composition comprising:

[0020] (1) Dendritic cell-derived exosomes and pharmaceutically acceptable excipients as described in any embodiment of this document, and / or

[0021] (2) Dendritic cells with upregulated CCR7 expression or activity and pharmaceutically acceptable excipients,

[0022] In one or more embodiments, (1) the dendritic cells are dendritic cells treated with myocardial injury microenvironment.

[0023] In one or more embodiments, the upregulation of CCR7 expression or activity includes: transferring the coding sequence of the CCR7 protein into dendritic cells to obtain transformed dendritic cells.

[0024] In one or more embodiments, the myocardial injury microenvironment includes: (1) supernatant of hypoxic cultured primary cardiomyocytes; (2) supernatant of infarcted mouse myocardial tissue; and (3) supernatant of necrotic HL-1 cells.

[0025] This invention also provides the use of dendritic cell-derived exosomes and / or dendritic cells with upregulated CCR7 expression or activity as described herein in the preparation of pharmaceutical compositions for treating myocardial injury or its symptoms.

[0026] In one or more embodiments, the myocardial injury includes one or more of myocardial infarction, ischemic myocardial injury, coronary artery disease, coronary syndrome, and hypoxia-related heart disease.

[0027] In one or more embodiments, the myocardial injury is a myocardial infarction.

[0028] In one or more embodiments, the pharmaceutical composition targets the spleen or lymph nodes.

[0029] In one or more embodiments, the treatment of myocardial injury symptoms includes reducing the infarct area, increasing the left ventricular ejection fraction, increasing the left ventricular fractional shortening, and reducing the left ventricular end-diastolic and end-systolic diameters.

[0030] In one or more embodiments, the pharmaceutical composition for treating myocardial injury is [equivalent to / is used to] activate [the immune system]. A pharmaceutical composition that promotes the secretion of IL-4 and IL-10 by cells to improve cardiac function.

[0031] In one or more embodiments, the upregulation of CCR7 expression or activity includes: transferring the coding sequence of the CCR7 protein into dendritic cells to obtain transformed dendritic cells.

[0032] This invention also provides applications of dendritic cell-derived exosomes and / or dendritic cells with upregulated CCR7 expression or activity as described herein, the applications including:

[0033] (1) Applications for non-therapeutic purposes to improve cardiac function;

[0034] (2) Applications targeting the spleen or lymph nodes for non-therapeutic purposes;

[0035] (3) Activation Non-therapeutic applications of cells to promote the secretion of IL-4 and IL-10.

[0036] In one or more embodiments, the improvement of cardiac function includes regulating myocardial cell metabolism, reducing local inflammatory response, and enhancing myocardial contractile and diastolic function.

[0037] This invention also provides a method for screening candidate substances that promote or inhibit the directed migration of dendritic cell-derived exosomes to lymphoid tissues, comprising:

[0038] (1) Contact the candidate material with a system containing dendritic cell-derived exosomes as described herein, and

[0039] (2) The expression of chemokine receptor CCR7 in dendritic cell-derived exosomes was detected and compared with the control group. If the expression or activity of chemokine receptor CCR7 was upregulated, the substance was a candidate substance for promoting the directional migration of dendritic cell-derived exosomes to lymphoid tissues. If the expression or activity of chemokine receptor CCR7 was downregulated, the substance was a candidate substance for inhibiting the directional migration of dendritic cell-derived exosomes to lymphoid tissues.

[0040] In one or more embodiments, the lymphoid tissue includes the spleen or lymph nodes. In one or more embodiments, the control is the same system without the substance.

[0041] In one or more embodiments, the system is a solution system, a cell system, a tissue system, or an animal, such as the mouse. Detailed Implementation

[0042] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form preferred technical solutions.

[0043] Immune cells play a crucial role in ventricular remodeling after myocardial infarction (MI). Previous work has demonstrated that MI-DEXs can migrate to the spleen and lymph nodes, thereby improving cardiac function after MI, but the migration mechanism remains unclear. This study found that CCR7 is highly expressed in MI-DEXs, while CCL19 / CCL21 is elevated in the spleen and serum of MI-infected mice. Further functional experiments showed that CCR7 overexpression enhances the migration of MI-DEXs to the spleen, while CCR7 downregulation reduces their accumulation in the spleen. Furthermore, we found that the migration of MI-DEXs to the spleen increases left ventricular wall thickness in the infarcted area, reduces left ventricular dilation, and improves cardiac function.

[0044] This study also explored MI-DEXs and Cell-cell relationships. Flow cytometry and qPCR results showed that MI-DEXs increased spleen... The cell ratio was adjusted, and the expression of IL-4 and IL-10 was upregulated. Previous studies have shown that... Cells play a protective role in scar formation and left ventricular dilation after MI, and are a type of healing cell triggered by heart-specific antigens. Cell activation is crucial for cardiac function recovery; meanwhile, IL-4 and IL-10 have been shown to be protective cytokines during ventricular remodeling after myocardial infarction (MI). Therefore, our results support a mechanism by which MI-DEXs activate cytokines secreting IL-4 and IL-10. Cells protect heart function.

[0045] Exosomes are important mediators of intercellular communication and play a crucial role in regulating immune cells and immune responses after myocardial infarction (MI). Previous studies have shown that exosomes can promote the repair of infarcted myocardium, and their mechanism of protecting cardiac function is related to communication between lymphocytes and intrinsic cardiomyocytes. With research progress, the systematic application of immune cell-derived exosomes as a novel strategy for treating MI has gradually attracted attention. Given the natural material transport capacity and good biocompatibility of exosomes, the engineered design of exosomes to enhance their therapeutic effects holds great promise. Our results indicate that CCR7 overexpression can enhance the migration of MI-DEXs to the spleen and improve cardiac function after MI; therefore, CCR7 is expected to be a potential target for the bioengineering of MI-DEXs to enhance therapeutic efficacy.

[0046] However, some noteworthy phenomena also exist in this study. For example, after MI-DEX treatment, the spleen... The expression of pro-inflammatory factors such as IFN-γ, IL-1β, and IL-6 was also elevated in cells. Considering the presence of multiple [inflammatory factors] in the spleen... Cell subsets (including both pro-inflammatory and anti-inflammatory subsets) suggest that MI-DEXs may enhance the expression of anti-inflammatory cytokines without significantly inhibiting the expression of pro-inflammatory factors, thus forming a more complex immune regulatory network.

[0047] In summary, the migration of dendritic cell-derived exosomes to the spleen after myocardial infarction (MI) is CCR7-mediated, and their mechanism of improving cardiac function includes activation of... This study suggests that enhancing the migration ability of MI-DEXs can improve cardiac function after MI, and CCR7 is expected to serve as a potential target for the bioengineering of MI-DEXs to enhance their migration and cardioprotective effects.

[0048] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in this application and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.

[0049] definition

[0050] The term "dendritic cell" (DC) derives from the stellate pleomorphism or dendritic projections on its surface. DCs lack specific cell surface molecular markers and are primarily identified through morphological characteristics, combined cell surface markers, and their ability to activate naive T cells in mixed lymphocyte responses. Originating from pluripotent hematopoietic stem cells in the bone marrow, DCs are widely distributed in the skin, airways, and lymphatic organs, exhibiting high heterogeneity. They are the most potent professional antigen-presenting cells (APCs) in the body, efficiently uptake, process, and present antigens. Immature DCs possess strong migration capabilities, while mature DCs effectively activate naive T cells, playing a central role in initiating, regulating, and maintaining the immune response.

[0051] The term "exosome" refers to nanoscale membrane vesicles with a diameter of approximately 30-150 nm that are actively secreted by cells. They have a typical lipid bilayer structure and are mostly cup-shaped or spherical. Their surface is rich in markers of the tetraspan membrane protein family, such as CD63, CD81, and CD9. Inside, they encapsulate bioactive substances such as nucleic acids (miRNA, mRNA, DNA fragments, etc.), proteins (signaling molecules, enzymes, immune molecules, etc.), and lipids (cholesterol, sphingomyelin, etc.) derived from the mother cell. They are widely present in body fluids such as blood, saliva, urine, and cerebrospinal fluid. They can be transported to distant target cells through body fluids and deliver the biomolecules they carry through membrane fusion or endocytosis, thereby regulating the physiological functions or pathological states of recipient cells and participating in various physiological and pathological processes such as intercellular communication, immune regulation, tissue repair, and tumor metastasis.

[0052] The term "dendritic cell-derived exosomes" (DEXs) refers to nanoscale membranous vesicles actively released by dendritic cells (DCs) after their fusion with the cell membrane via multivesicles. These vesicles carry bioactive substances such as nucleic acids, proteins, and lipids derived from DCs and serve as important mediators for DC-mediated immune regulation and intercellular communication.

[0053] The term "chemokine receptor" refers to a class of G protein-coupled receptors expressed on the cell surface. Chemokine receptors (CCRs) are the core subfamily of the chemokine receptor family, specifically referring to cell surface receptors that can specifically bind to CC class chemokines (the ligands have two adjacent cysteine ​​residues at the N-terminus), mediating physiological and pathological processes such as directed cell migration and immune regulation.

[0054] The term "myocardial injury" refers to a pathological state in which myocardial cells or tissues suffer structural damage (such as cell necrosis and apoptosis) and functional abnormalities (such as decreased pumping capacity) due to factors such as ischemia, inflammation, toxins, and excessive mechanical load. It is often accompanied by elevated levels of damage markers such as troponin in the blood. In severe cases, it can lead to complications such as myocardial infarction and affect normal cardiac function. Myocardial injury includes, but is not limited to, myocardial infarction, ischemic myocardial injury, coronary heart disease, coronary syndrome, and hypoxia-related heart diseases.

[0055] The term "myocardial infarction" (MI) is a serious cardiovascular disease caused by acute and persistent ischemia and hypoxia of the coronary arteries, leading to the death of myocardial cells. Clinically, it often manifests as severe and persistent retrosternal pain, which may be accompanied by fever, arrhythmia, shock or heart failure, and can be life-threatening in severe cases.

[0056] The term “improvement” includes any beneficial or desired effect on the symptoms or lesions of a disease or pathological condition, and may include even a small reduction in one or more measurable markers of the disease or condition (e.g., myocardial injury). Improvement may optionally include a reduction or relief of symptoms of the disease or condition, or a delay in the progression of the disease or condition. “Improvement” does not necessarily mean the complete eradication or cure of the disease or condition or its associated symptoms.

[0057] In this document, the terms “contains,” “includes,” “containing,” and similar terms encompass the meanings of “basically composed of” and “composed of.” For example, when this document discloses “A contains B and C,” “A is basically composed of B and C” and “A is composed of B and C” should be considered as having been disclosed in this document.

[0058] The term "pharmaceuticalally acceptable excipient" refers to a carrier and / or excipient that is pharmacologically and / or physiologically compatible with the subject and the active ingredient, and is well known in the art (see, for example, Remington's Pharmaceutical Sciences, edited by Gennaro AR, 19th ed., Pennsylvania: Mack Publishing Company, 1995), and includes, but is not limited to: pH adjusters, surfactants, adjuvants, and ionic strength enhancers. For example, pH adjusters include, but are not limited to, phosphate buffers; surfactants include, but are not limited to, cationic, anionic, or nonionic surfactants, such as Tween-80; and ionic strength enhancers include, but are not limited to, sodium chloride.

[0059] exosomes

[0060] The present invention first provides a dendritic cell-derived exosome, wherein the expression or activity of CCR7 in the dendritic cells is upregulated.

[0061] In one or more embodiments, the dendritic cells are bone marrow-derived dendritic cells.

[0062] In one or more embodiments, bone marrow-derived dendritic cells are derived from mammals.

[0063] In one or more embodiments, the mammal includes one or more of the following: mouse, rabbit, cow, pig, sheep, dog, cat, and horse.

[0064] In one or more embodiments, the rat includes one or more of mice, rats, hamsters, and guinea pigs.

[0065] It should be understood that dendritic cells in different animals have similar functions and structures, and this application is not limited to rat dendritic cells.

[0066] In one or more embodiments, the mammal is a mammal suffering from myocardial infarction.

[0067] In one or more embodiments, the lymphoid tissue includes the spleen or lymph nodes.

[0068] In one or more embodiments, the dendritic cells are dendritic cells treated with damage-associated molecular patterns (DAMP).

[0069] In one or more embodiments, the dendritic cells are dendritic cells treated with the myocardial injury microenvironment.

[0070] In one or more embodiments, the myocardial injury microenvironment includes: (1) supernatant of hypoxic cultured primary cardiomyocytes; (2) supernatant of infarcted mouse myocardial tissue; and (3) supernatant of necrotic HL-1 cells.

[0071] In one or more embodiments, the upregulation of CCR7 expression or activity includes: transferring the coding sequence of the CCR7 protein into dendritic cells to obtain transformed dendritic cells. This invention relates to promoters of the CCR7 protein; any substance that can increase the activity of the CCR7 protein, improve its stability, promote its expression, prolong its effective duration, or promote its gene transcription and translation can be used in this invention as a "promoter" of the CCR7 gene. For example, vectors that increase CCR7 protein expression or activity.

[0072] Those skilled in the art are aware of conventional methods for introducing protein-coding sequences into cells, including but not limited to plasmid-mediated methods (using recombinant plasmids as vectors to mediate plasmid entry into cells through physical or chemical means), viral vector-mediated methods (using modified vectors such as lentiviruses and adenoviruses to carry the target sequence), electroporation methods (using a short-term high-voltage electric field to create transient pores in the cell membrane, allowing the coding sequence to enter the cell rapidly), and liposome transfection methods (using cationic liposomes to form a complex with the coding sequence, which is then fused to the cell membrane to complete the introduction).

[0073] Pharmaceutical Composition

[0074] The present invention also provides a pharmaceutical composition comprising (1) dendritic cell-derived exosomes as described in any embodiment herein and pharmaceutically acceptable excipients, and / or (2) dendritic cells with upregulated CCR7 expression or activity and pharmaceutically acceptable excipients. In one or more embodiments, (1) the dendritic cells are dendritic cells treated with a myocardial injury microenvironment. In one or more embodiments, the upregulation of CCR7 expression or activity comprises: transducing the coding sequence of the CCR7 protein into dendritic cells to obtain transformed dendritic cells. In one or more embodiments, the myocardial injury microenvironment comprises: (1) supernatant of hypoxic cultured primary cardiomyocytes; (2) supernatant of infarcted mouse myocardial tissue; and (3) supernatant of necrotic HL-1 cells.

[0075] The pharmaceutical compositions of this application may be in solid dosage form, semi-solid dosage form, or liquid dosage form. Solid dosage forms include powders, tablets, capsules, pills, or granules; semi-solid dosage forms include ointments, gels, or plasters; and liquid dosage forms include solutions, syrups, emulsions, or tinctures.

[0076] Liquid dosage forms may contain inert diluents conventionally used in the art, such as water or other solvents, solubilizers, and emulsifiers, specifically, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butanediol, dimethylformamide, and oils. In addition to these inert diluents, the composition may also contain auxiliaries, such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents, and fragrances. For example, suspensions may contain suspending agents, specifically, for example, ethoxylated isooctadecyl alcohol, polyoxyethylene sorbitol and dehydrated sorbitan esters, microcrystalline cellulose, aluminum methoxide, and agar, or combinations thereof.

[0077] Semi-solid dosage forms may include conventional matrices and excipients. Depending on the specific dosage form, the appropriate matrices or excipients can be selected. Commonly used matrices and excipients for exosome semi-solid dosage forms include: matrix materials such as polyethylene glycol (PEG 4000 / 6000 / 10000), sodium carboxymethyl cellulose (CMC-Na), hydroxypropyl methylcellulose (HPMC), hydroxyethyl cellulose (HEC), hyaluronic acid, sodium alginate, chitosan, petrolatum, lanolin, liquid paraffin, glyceryl stearate, beeswax, cetyl wax, insect wax, stearic acid, triethanolamine, polysorbate 80, glyceryl monostearate, fatty acid sorbitan, and poloxamer 188; functional excipients such as xanthan gum, carbomer, methylcellulose, glycerin, propylene glycol, butylene glycol, azone, menthol, limonene, phenoxyethanol, methylparaben, ethylparaben, chlorhexidine alcohol, steviol glycosides, povidone K30, and low-concentration ethanol.

[0078] Solid dosage forms may contain conventional inert excipients; fillers include microcrystalline cellulose (MCC), lactose, starch, mannitol, sucrose, dicalcium phosphate, and dextrin; binders include povidone (PVP K30 / K90), hydroxypropyl methylcellulose (HPMC), sodium carboxymethyl cellulose (CMC-Na), starch paste, gum arabic, and gelatin; disintegrants include sodium carboxymethyl starch (CMS-Na), crospovidone (PVPP), crospovidone carboxymethyl cellulose (CCMC-Na), low-substituted hydroxypropyl cellulose (L-HPC), and starch; lubricants include magnesium stearate, calcium stearate, talc, micronized silica gel, polyethylene glycol (PEG 4000 / 6000), and sodium stearate fumarate; coating materials include hydroxypropyl methylcellulose (HPMC), povidone (PVP), polyvinyl acetate phthalate (PVAP), hydroxypropyl methylcellulose phthalate (HPMCP), and polymethyl methacrylates (Eudragitin). L / S), insect wax, carnauba wax; freeze-drying preservatives include trehalose, sucrose, mannitol, lactose, dextran, glycine, and maltose; flavoring agents include steviol glycosides, aspartame, sucrose, and flavorings (mint flavoring, fruit flavoring); preservatives include parabens (methylparaben, ethylparaben), sodium benzoate, and potassium sorbate; and flow aids include talc, micronized silica gel, and magnesium stearate.

[0079] This invention also provides the use of dendritic cell-derived exosomes and / or dendritic cells with upregulated CCR7 expression or activity as described herein in the preparation of pharmaceutical compositions for treating myocardial injury or its symptoms.

[0080] In one or more embodiments, the myocardial injury includes one or more of myocardial infarction, ischemic myocardial injury, coronary artery disease, coronary syndrome, and hypoxia-related heart disease.

[0081] In one or more embodiments, the myocardial injury is a myocardial infarction.

[0082] In one or more embodiments, the pharmaceutical composition targets the spleen or lymph nodes. The surface of the exosomes of this application can be modified with specific antibodies, such as CD163 antibodies against splenic macrophages, CD4 antibodies against lymph node T cells, CD20 antibodies against splenic B cells, or specific molecules targeting splenic / lymph node vascular endothelial cells (such as lymph node homing receptor CCR7 antibodies, splenic vascular addressin MAdCAM-1 antibodies), to enhance spleen / lymph node targeting and immune regulation. The exosomes of this application can also be loaded with other drugs, such as anti-inflammatory drugs, like natural anti-inflammatory compounds such as curcumin and resveratrol, or small molecule anti-inflammatory drugs (such as ibuprofen derivatives and dexamethasone), and other drugs for treating myocardial injury, such as aspirin, P2Y12 receptor inhibitors, heparin, amiodarone, lidocaine, etc. Targeting the spleen can directly inhibit the pro-inflammatory activity of spleen immune cells and reduce the release of pro-inflammatory factors. At the same time, the drug can migrate with immune cells to the site of myocardial injury, exert local anti-inflammatory effects, and relieve myocardial edema and necrosis. When targeting lymph nodes, it can inhibit the amplification of inflammatory signals in lymph nodes.

[0083] In one or more embodiments, the treatment of myocardial injury symptoms includes reducing the infarct area, increasing the left ventricular ejection fraction, increasing the left ventricular fractional shortening, and reducing the left ventricular end-diastolic and end-systolic diameters.

[0084] In one or more embodiments, the pharmaceutical composition for treating myocardial injury is [equivalent to / is used to] activate [the immune system]. A pharmaceutical composition that promotes the secretion of IL-4 and IL-10 by cells to improve cardiac function.

[0085] In one or more embodiments, the upregulation of CCR7 expression or activity includes: transferring the coding sequence of the CCR7 protein into dendritic cells to obtain transformed dendritic cells.

[0086] The pharmaceutical composition of this application can be administered to mammals such as mice, livestock, and humans through various routes, including but not limited to oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, local, sublingual, or rectal routes.

[0087] application

[0088] This invention also provides applications of dendritic cell-derived exosomes and / or dendritic cells with upregulated CCR7 expression or activity as described herein, the applications including:

[0089] (1) Application for non-therapeutic purposes to improve cardiac function;

[0090] (2) Applications targeting the spleen or lymph nodes for non-therapeutic purposes;

[0091] (3) Activation Non-therapeutic applications of cells to promote the secretion of IL-4 and IL-10.

[0092] In one or more embodiments, the improvement of cardiac function includes regulating myocardial cell metabolism, reducing local inflammatory response, and enhancing myocardial contractile and diastolic function.

[0093] Non-therapeutic applications of targeting the spleen or lymph nodes include research on common immune mechanisms, drug development assistance, and bioimaging and tracing applications. Immune mechanism research: Exosomes are modified with spleen- or lymph node-specific targeting molecules (such as CCR7 antibodies, MAdCAM-1 antibodies), loaded with fluorescent probes (such as FITC, Cy5) or labeled proteins (such as GFP), and directionally delivered to the spleen or lymph nodes. This allows for tracking the migration pathways, proliferation and differentiation patterns, and intercellular interactions of immune cells (macrophages, T cells, B cells), providing a visualization tool for studying immune network regulation mechanisms. Drug development assistance: By targeting drugs to the spleen or lymph nodes via exosomes, the distribution of drugs in non-target organs such as the liver, kidneys, and heart can be simultaneously detected to assess drug targeting specificity, providing a reference for drug safety evaluation and avoiding off-target toxicity. Applications in bioimaging and tracing: In vivo tissue imaging probe carriers: Exosomes carry magnetic resonance imaging (MRI) contrast agents (such as superparamagnetic iron oxide nanoparticles) and positron emission tomography (PET) probes (such as 18F-labeled compounds). After targeting the spleen or lymph nodes, the anatomical structure, physiological state, and pathological changes (such as lymph node enlargement and splenic fibrosis) of the target organs can be clearly presented through medical imaging technology, providing novel probes for the optimization of imaging diagnostic technology.

[0094] filter

[0095] This invention also provides a method for screening candidate substances that promote or inhibit the directed migration of dendritic cell-derived exosomes to lymphoid tissues, comprising:

[0096] (1) Contact the candidate material with a system containing dendritic cell-derived exosomes as described herein, and

[0097] (2) Detect the expression of chemokine receptor CCR7 in dendritic cell-derived exosomes and compare it with the control group. If the expression or activity of chemokine receptor CCR7 is upregulated, the substance is a candidate substance that promotes the directional migration of dendritic cell-derived exosomes to lymphoid tissues. If the expression or activity of chemokine receptor CCR7 is downregulated, the substance is a candidate substance that inhibits the directional migration of dendritic cell-derived exosomes to lymphoid tissues.

[0098] In one or more embodiments, the lymphoid tissue includes the spleen or lymph nodes. In one or more embodiments, the control is the same system without the substance.

[0099] In one or more embodiments, the system is a solution system, a cell system, a tissue system, or an animal, such as the mouse.

[0100] Example

[0101] Example 1: Materials and Methods

[0102] 1. Animals

[0103] Wild-type male C57BL / 6 mice were used for the culture of bone marrow-derived dendritic cells (BMDCs) and the preparation of a myeloma (MI) model. Mice were housed in a specific pathogen-free (SPF) environment with a 12-h / 12-h light-dark cycle, a room temperature of 22 ± 1 ℃, and humidity of 65%–70%, with free access to food and water. This study was approved by the Ethics Committee of Zhongshan Hospital and the Animal Ethics Committee of the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, and animal experiments followed relevant Chinese animal welfare regulations.

[0104] 2. Preparation and treatment of myocardial infarction model

[0105] Mechanical ventilation was performed using a small animal ventilator, combined with isoflurane inhalation anesthesia. After opening the chest to expose the heart, the left coronary artery (LCA) was ligated with 8-0 silk suture. The infarcted myocardium turning white indicated successful myocardial infarction (MI). Mice that underwent only chest opening without LCA ligation were designated as the sham-operated group. After surgery, the air was expelled, the skin was sutured, and the mice were returned to their cages after recovery. 24 hours after MI, different types of diethylstilbestrol (DEXs) or saline were injected via the tail vein.

[0106] 3. Cell isolation and culture

[0107] Dendritic cells derived from mouse bone marrow were isolated using previous methods. Mice were sacrificed and femurs were harvested. Bone marrow cells were washed and analyzed using a 1×10⁻⁶ m² / hb ... 6Cells were seeded at a concentration of [number] cells / mL in cell culture flasks and cultured in RPMI-1640 medium containing 10% fetal bovine serum, 1% penicillin-streptomycin, 1 ng / mL IL-4, and 10 ng / mL granulocyte-macrophage colony-stimulating factor (GM-CSF). After 48 hours, non-adherent cells were gently washed away, and semi-adherent cell clusters were cultured, with the medium changed every 2 days. On day 7, the medium was changed to RPMI-1640 complete medium containing 10% exosome-free fetal bovine serum (exosomes removed by ultracentrifugation at 100,000×g), while maintaining GM-CSF and IL-4 levels. BMDCs were identified by flow cytometry using anti-CD11c, CD40, CD80, and CD86 antibodies. The supernatant was collected for the isolation of DEXs. In the overexpression group, CCR7 overexpression / interference was first performed on BMDCs, then the exosome medium was removed, and the supernatant was collected to prepare DEXs. DEXs were isolated from the spleens of mice in different treatment groups. Cells, using commercial Use the cell sorting kit and follow the instructions.

[0108] 4. Lentiviral preparation and infection

[0109] We purchased mouse CCR7 overexpression lentivirus (Genomeditech, Shanghai Genomede Biotechnology Co., Ltd.), mouse CCR7 shRNA lentivirus (Genomeditech, Shanghai Genomede Biotechnology Co., Ltd.), and corresponding control lentiviruses (Genomeditech, Shanghai Genomede Biotechnology Co., Ltd.). The overexpression lentivirus vector is a third-generation lentivirus system based on the CMV promoter, and the inserted target sequence is the mouse CCR7 coding sequence (NCBI accession number: NM_007719). The target sequence of the mouse CCR7 shRNA used to interfere with CCR7 expression is 5'-GCTGGTGATGGTCAAGATAAA-3' (SEQ ID NO: 2). BMDCs were infected with different viruses according to the instructions to obtain cells with CCR7 overexpression or knockdown.

[0110] 5. Simulate the MI microenvironment

[0111] Methods for simulating the microenvironment of myocardial infarction (MI) have been described in previous studies, including: (1) supernatant of primary cardiomyocytes cultured under hypoxia; (2) supernatant of myocardial tissue from infarcted mice; and (3) supernatant of necrotic HL-1 cells. This study used the third method: mouse cardiomyocyte line HL-1 cells were seeded in culture dishes pre-coated with 0.02% gelatin and 5 μg / mL fibronectin, and cultured in Claycomb medium (containing 10% fetal bovine serum, 2 mM L-glutamine, 100 U / mL penicillin, 100 μg / mL streptomycin and 0.1 mM norepinephrine) at 37 ℃ and 5% CO2. When the cell confluence reached 80%–90%, the original medium was discarded, and serum-free Claycomb medium was added. Subsequently, the cells were subjected to repeated freeze-thaw cycles at -80 ℃ and 37 ℃ for 3 cycles to induce cell necrosis. Two hours after necrosis, the culture supernatant was collected and centrifuged at 300×g for 10 min and 2000×g for 10 min to remove cells and large debris. The supernatant was then filtered through a 0.22 μm filter membrane to obtain the necrotic HL-1 cell supernatant, which was used as a stimulation solution to simulate the MI microenvironment.

[0112] Adjust the BMDCs cultured on days 6-7 to 1×10⁻⁶. 6 Cells were resuspended at a density of 1 / mL in RPMI-1640 complete medium containing 10% exosome-free fetal bovine serum. The supernatant of the necrotic HL-1 cells was added at a volume ratio of 1:10 (i.e., 100 μL / mL). The mixture was incubated at 37 ℃ and 5% CO2 for 24 h. The control group received an equal volume of serum-free Claycomb medium. After incubation, the supernatant of BMDCs from each group was collected for subsequent isolation and characterization of DEXs, and some BMDCs were retained for phenotypic and functional assays.

[0113] 6. Isolation and Characterization of DEXs

[0114] DEXs were isolated using ExoQuick-Tc exosome precipitation reagent according to the instructions. DEXs were confirmed by Western blot detection of exosome marker proteins CD63 and Alix; particle morphology was observed using transmission electron microscopy; and particle size distribution was determined using nanoparticle tracking analysis (NTA).

[0115] 7. Experimental Grouping

[0116] Exosome grouping:

[0117] (1) DEX group: On days 6-7, BMDCs were replaced with RPMI-1640 complete medium containing 10% exosome-free fetal bovine serum (without any cardiomyocyte supernatant), and incubated at 37 ℃ and 5% CO2 for 24 h. The cell supernatant was collected and prepared into DEXs after differential centrifugation and filtration through a 0.22 μm filter membrane.

[0118] (2) MI-DEX group: DEXs obtained by treating BMDCs with 100 μL / mL necrotic cardiomyocyte supernatant for 24 h;

[0119] (3) CCR7 overexpression MI-DEX group: BMDCs were first infected with CCR7 overexpression lentivirus for 72 h, and then treated with necrotic cardiomyocyte supernatant for 24 h to isolate DEXs;

[0120] (4) CCR7 knockdown MI-DEX group: BMDCs were first infected with CCR7 shRNA lentivirus for 72 h, and then treated with necrotic myocardial cell supernatant for 24 h to isolate DEXs.

[0121] Animal grouping:

[0122] (1) Sham surgery group: only open chest surgery without ligation of LCA;

[0123] (2) MI group: normal saline was injected via the tail vein 24 hours after MI;

[0124] (3) DEX group: DEXs were injected 24 h after MI;

[0125] (4) MI-DEX group: MI-DEXs were injected 24 h after MI;

[0126] (5) CCR7over-MI-DEX group: MI overexpression MI-DEXs were injected 24 h after MI;

[0127] (6) CCR7down-MI-DEX group: CCR7 was injected to knock down MI-DEXs 24 h after MI.

[0128] 8. DEX labeling and fluorescence imaging

[0129] DEXs were labeled with the near-infrared fluorescent dye DiR, and purified DEXs were obtained after removing free dye by centrifugation. Near-infrared fluorescence images of the body surface and organs were acquired using a small animal in vivo imaging system, and the radiation efficiency of the whole body, spleen, and liver was quantitatively analyzed.

[0130] 9. Echocardiography

[0131] Echocardiography was performed on the 14th day after MI. M-mode ultrasound was used to measure the left ventricular end-systolic diameter (LVIDs) and end-diastolic diameter (LVIDd), and the ejection fraction (EF%) and fractional shortening (FS%) were calculated.

[0132] 10. Histological examination

[0133] Mice were sacrificed on day 14 after myocardial infarction (MI). Hearts were fixed in 4% paraformaldehyde for 24 h, routinely embedded in paraffin, sectioned (5 μm thick), dewaxed in xylene, and rehydrated with graded ethanol before Masson's trichrome staining. Infarct wall thickness and percentage of fibrosis area were measured using image analysis software, with three measurements taken at different locations within the infarct area for each section.

[0134] 11. Flow cytometry

[0135] Samples were pretreated with an Fc receptor blocker to reduce nonspecific binding, followed by staining with CD45, CD3, and CD4 antibodies for 30 min, and incubated at 4 °C in the dark. Data were acquired using flow cytometry and analyzed using the accompanying software. , , Cell ratio.

[0136] 12. Real-time quantitative PCR

[0137] RNA was extracted from cells or tissues using a total RNA extraction kit. 500 ng of RNA was reverse transcribed into cDNA, followed by real-time quantitative PCR using the SYBR Green system. The reaction conditions were 95 ℃ for 3 min, followed by 40 cycles (95 ℃ for 5 s, 60 ℃ for 34 s). GAPDH was used as an internal control, and the relative expression levels were calculated using the 2^-ΔΔCt method. Primer sequences for each inflammatory cytokine (TNF-α, IFN-γ, IL-1β, IL-6, IL-4, IL-10) were prepared according to the instructions.

[0138] 13. Statistical Analysis

[0139] All data are expressed as mean ± standard deviation. Unpaired t-tests were used for comparisons between two groups; one-way ANOVA with Tukey post-hoc tests was used for comparisons of three or more groups. Statistical analysis was performed using GraphPad Prism, and p < 0.05 was considered statistically significant.

[0140] Example 2 Experimental Results

[0141] 1. CCR7 is highly expressed in MI-DEXs, and its ligand CCL19 / 21 is also elevated in the spleen of MI mice.

[0142] This study first prepared and characterized MI-DEXs: transmission electron microscopy revealed their typical vesicle structure; Western blot showed positivity for CD63 and Alix; and NTA detected a particle pattern with a diameter of approximately 117 nm. Subsequently, CCR7 expression was detected, showing that CCR7 expression in MI-DEXs was significantly higher than in control DEXs. Simultaneously, the levels of CCL19 and CCL21 in the serum and spleen of MI mice were detected, and both were significantly elevated, suggesting that MI-DEXs may follow a CCR7-dependent migration mechanism similar to that of DCs.

[0143] 2. CCR7 mediates the migration of MI-DEXs to the spleen after MI.

[0144] Based on the established high expression of CCR7 in MI-DEXs, we further compared the migration of DEXs and MI-DEXs in vivo after MI. Near-infrared fluorescence imaging results showed that both DEXs and MI-DEXs migrated to the spleen and liver after MI, but the fluorescence signal of MI-DEXs in the spleen was significantly higher than that of DEXs, while there was no significant difference between the two in the liver, suggesting that CCR7 may specifically promote the migration of MI-DEXs to the spleen.

[0145] To further verify the role of CCR7, we overexpressed or knocked down CCR7 in BMDCs to obtain different MI-DEXs. Imaging results showed that CCR7 overexpression significantly enhanced the accumulation of MI-DEXs in the spleen, while CCR7 knockdown significantly reduced their signal intensity in the spleen. These results indicate that CCR7 mediates the migration of MI-DEXs to the spleen, and that CCR7 overexpression can further enhance their migration ability.

[0146] 3. Enhancing the migration ability of MI-DEXs can improve cardiac function after MI.

[0147] Next, we will explore the relationship between MI-DEXs migration and cardiac function. Previous studies have shown that MI-DEXs activate the spleen... Cellular Improvement of Cardiac Function After Myocardial Infarction (MI). In this study, we used echocardiography and Masson staining to assess cardiac function and remodeling on day 28 after MI. The results showed that compared with the MI-DEX group alone, the CCR7 overexpression MI-DEX group had further improved left ventricular ejection fraction and fractional shortening, and reduced left ventricular end-diastolic and end-systolic diameters, indicating a more significant improvement in cardiac function; while the CCR7 knockdown MI-DEX group showed a decrease in the above indicators, indicating a weakened treatment effect. The left ventricular ejection fraction (LVEF) was 58% in the CCR7-overexpressing MI-DEX group and 50% in the MI-DEX-only group. The fractional shortening (SSM) was 30% in the CCR7-overexpressing MI-DEX group and 24% in the MI-DEX-only group. The left ventricular end-diastolic diameter (LVED) was 3.2 mm in the CCR7-overexpressing MI-DEX group and 3.8 mm in the MI-DEX-only group. The left ventricular end-systolic diameter (LVED) was 2.2 mm in the CCR7-overexpressing MI-DEX group and 2.5 mm in the MI-DEX-only group.

[0148] Masson staining results showed that MI-DEXs maintained left ventricular wall thickness in the infarct area and had no significant effect on the fibrosis percentage. Although the percentage of fibrosis did not differ significantly among the MI-DEX treatment groups, the infarct wall thickness was slightly lower in the CCR7 knockdown group, which may be related to its poor improvement in cardiac function.

[0149] 4. MI-DEXs activate the spleen cell

[0150] Previous studies have shown that Cell activation plays a crucial role in myocardial wound healing after myocardial infarction (MI). To investigate the relationship between MI-DEXs and... To investigate the relationships between cells, we used flow cytometry to analyze the leukocytes in the spleen of mice under different treatments. The proportion of cells. Results showed that, compared to the sham-operated group, the spleen in the MI group had a lower proportion of cells. The proportion of cells decreased slightly, and the spleen in the sham-operated group showed... The cell proportion was 17%, in the spleen of the MI group The cell proportion was 12%; while in the MI-DEX injection group, The significantly increased cell percentage (23%) suggests that MI-DEXs can activate CD4 after MI. + T cells, which help improve heart function.

[0151] 5. MI-DEXs induce spleen Increased cellular anti-inflammatory cytokines

[0152] Further examination of spleens in different groups Cellular cytokine expression was examined, and the mRNA levels of IL-4 and IL-10 were significantly increased in the MI-DEX group compared to the MI group. Specifically, the IL-4 mRNA level in the MI-DEX group was 1.7 times that in the MI group, and the IL-10 mRNA level in the MI-DEX group was 1.8 times that in the MI group, indicating that MI-DEX injection can induce spleen... Cells produce more anti-inflammatory cytokines. Numerous studies have confirmed the protective effects of IL-4 and IL-10 on ventricular remodeling after myocardial infarction (MI). Therefore, IL-4 and IL-10 are likely... Key effector factors in cell-mediated protection of cardiac function.

[0153] Notably, this study also observed elevated levels of pro-inflammatory cytokines such as IFN-γ, IL-1β, and IL-6 in the MI-DEX group, suggesting that MI-DEXs are associated with CD4+. + There are complex regulatory relationships among T cells; it's not simply a matter of CD4 being controlled. + T cells "transform" into an anti-inflammatory phenotype.

[0154] sequence of this article

[0155] SEQ ID NO: 1 CCR7 mRNA sequence

[0156]

[0157] SEQ ID NO: 2 Mouse CCR7 shRNA target sequence

[0158] GCTGGTGATGGTCAAGATAAA

Claims

1. A dendritic cell-derived exosome, characterized in that, CCR7 expression or activity is upregulated in the dendritic cells. Preferably, the dendritic cells are bone marrow-derived dendritic cells. Preferably, the upregulation of CCR7 expression or activity includes: transferring the coding sequence of the CCR7 protein into dendritic cells to obtain transformed cells.

2. The dendritic cell-derived exosomes as described in claim 1, characterized in that, The bone marrow-derived dendritic cells are derived from mammals. Preferably, the mammal includes one or more of the following: mouse, rabbit, cow, pig, sheep, dog, cat, and horse. Preferably, the mammal is a mammal suffering from myocardial infarction. More preferably, the mammal is a mouse suffering from myocardial infarction.

3. The dendritic cell-derived exosomes as described in claim 1 or 2, characterized in that, The dendritic cells are dendritic cells treated with damage-associated molecular patterns (DAMP), and more preferably, the dendritic cells are dendritic cells treated with the myocardial injury microenvironment.

4. A pharmaceutical composition, characterized in that, It includes: (1) The dendritic cell-derived exosomes and pharmaceutically acceptable excipients as described in claim 3, and / or (2) Dendritic cells with upregulated CCR7 expression or activity and pharmaceutically acceptable excipients, Preferably, (1) the dendritic cells are dendritic cells treated with myocardial injury microenvironment.

5. The use of dendritic cell-derived exosomes and / or dendritic cells with upregulated CCR7 expression or activity as described in claim 3 in the preparation of a pharmaceutical composition for treating myocardial injury or its symptoms. Preferably, the myocardial injury includes one or more of the following: myocardial infarction, ischemic myocardial injury, coronary artery disease, coronary syndrome, and hypoxia-related heart disease. More preferably, the myocardial injury is myocardial infarction.

6. The application as described in claim 5, characterized in that, The treatment of myocardial injury symptoms includes one or more of the following: reducing the infarct area, increasing the left ventricular ejection fraction, increasing the left ventricular fractional shortening, and decreasing the left ventricular end-diastolic and end-systolic diameters.

7. The application as described in claim 5, characterized in that, The pharmaceutical composition targets the spleen or lymph nodes.

8. The application according to claim 5, characterized in that, The pharmaceutical composition for treating myocardial injury is formulated by activating... A pharmaceutical composition that promotes the secretion of IL-4 and IL-10 by cells to improve cardiac function.

9. The use of dendritic cell-derived exosomes and / or dendritic cells with upregulated CCR7 expression or activity as described in claim 3, wherein the use comprises: (1) Application for non-therapeutic purposes to improve cardiac function; (2) Applications targeting the spleen or lymph nodes for non-therapeutic purposes; (3) Activation Non-therapeutic applications of cells to promote the secretion of IL-4 and IL-10.

10. Methods for screening candidate substances that promote or inhibit the directed migration of dendritic cell-derived exosomes to lymphoid tissues, including: (1) Contacting the candidate material with a system comprising dendritic cell-derived exosomes as described in any one of claims 1-3, and (2) The expression of chemokine receptor CCR7 in dendritic cell-derived exosomes was detected and compared with the control group. If the expression or activity of chemokine receptor CCR7 was upregulated, the substance was a candidate substance for promoting the directed migration of dendritic cell-derived exosomes to lymphoid tissues. If the expression or activity of chemokine receptor CCR7 was downregulated, the substance was a candidate substance for inhibiting the directed migration of dendritic cell-derived exosomes to lymphoid tissues. Preferably, the lymphatic tissue includes the spleen or lymph nodes. Preferably, the control is an identical system that does not contain the substance. Preferably, the system is a solution system, a cell system, a tissue system, or an animal, preferably a mouse.