Porcine delta coronavirus strain and application thereof

By preparing an inactivated vaccine by isolating the PDCoV HN02 strain of porcine deltacoronavirus, the problem of low immunogenicity of existing vaccines has been solved, and effective prevention and control of porcine deltacoronavirus has been achieved.

CN121495874APending Publication Date: 2026-02-10PULIKE BIOLOGICAL ENG INC +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411078588.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-08-07
Publication Date
2026-02-10

AI Technical Summary

Technical Problem

Existing porcine deltacoronavirus vaccines have low immunogenicity, making it difficult to effectively control porcine deltacoronavirus disease. Furthermore, highly virulent viral strains are difficult to isolate, leading to challenges in vaccine preparation.

Method used

The porcine deltacoronavirus strain PDCoV HN02 was isolated and prepared into an inactivated vaccine containing an immunizing dose of porcine deltacoronavirus antigen and a pharmaceutically acceptable carrier. Adjuvants included mineral oil, aluminum glue adjuvant, etc., for the prevention of porcine deltacoronavirus infection.

Benefits of technology

The prepared inactivated vaccine can effectively prevent porcine deltacoronavirus infection, has good immunogenicity and biosafety, rapidly generates antibodies, and controls the spread of the epidemic.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention belongs to the technical field of veterinary biological products, and particularly relates to a porcine delta coronavirus strain and application thereof. The invention discloses a porcine delta coronavirus strain PDCoV HN02, and the preservation number of the porcine delta coronavirus strain PDCoV HN02 is CCTCC (China Center For Type Culture Collection) NO: V202441. The invention also discloses a vaccine composition, which comprises an antigen of the porcine deltacoronavirus strain PDCoV HN02 in an immune dose and a pharmaceutically acceptable carrier. After an animal is immunized by a vaccine composition containing the strain, an animal body can quickly generate an antibody, and the vaccine composition has good prevention and control effects on current epidemic porcine deltacoronavirus infection and is good in biological safety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of veterinary biological products technology, specifically relating to a porcine deltacoronavirus strain and its application. Background Technology

[0002] Porcine deltacoronavirus (PDCoV) is a significant pathogen causing diarrhea in pigs, infecting pigs of all ages. The clinical symptoms in infected pigs are similar to those caused by porcine epidemic diarrhea virus (PEDV), both manifesting as diarrhea and piglet mortality, resulting in substantial economic losses to the pig farming industry.

[0003] Currently, there are no effective drugs for porcine deltacoronavirus, and conventional treatments are ineffective. Vaccines are the primary measure for prevention and control of the disease. However, isolating porcine deltacoronavirus is difficult, and highly virulent strains are hard to isolate, resulting in vaccines with low immunogenicity and ineffective control of porcine deltacoronavirus disease. Therefore, it is urgent to isolate highly pathogenic wild-type porcine deltacoronavirus strains with good immunogenicity and prepare them into highly effective inactivated vaccines, which is of great significance for preventing porcine deltacoronavirus outbreaks. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a porcine deltacoronavirus strain, a prepared inactivated vaccine, and its application, which can effectively prevent porcine deltacoronavirus infection.

[0005] This invention relates to a porcine deltacoronavirus strain, PDCoV HN02, with accession number CCTCC NO:V202441. This strain exhibits strong virulence and good immunogenicity.

[0006] This invention also relates to a vaccine composition comprising an immunologic dose of an antigen of the porcine deltacoronavirus strain PDCoV HN02 and a pharmaceutically acceptable vector; wherein the antigen is an inactivated whole virus antigen, preferably an inactivated porcine deltacoronavirus strain PDCoV HN02 or a culture thereof. The culture can be a 1-15 generation culture. The antigen in the vaccine composition is prepared from a virulent strain, exhibits good immunogenicity, and provides complete protection for pigs.

[0007] In a preferred embodiment of the present invention, the antigen content in the vaccine composition of the present invention is ≥10 before inactivation. 6.0 TCID 50 / ml.

[0008] In a more preferred embodiment of the present invention, the antigen content in the vaccine composition of the present invention is 10% before inactivation. 6.0 -10 7.5 TCID 50 / ml.

[0009] In a preferred embodiment of the present invention, the antigen content in the vaccine composition of the present invention is 10% before inactivation. 7.0 TCID 50 / ml.

[0010] In some embodiments, pharmaceutically acceptable carriers include at least one of adjuvants, lyophilization protectants, immunostimulants, antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants, and preservatives.

[0011] Preferably, the adjuvant comprises one or more of the following: mineral oil, aluminum gel adjuvant, saponin, avrididine, DDA, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion, polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives, RIBI adjuvant system, Block co-polymer, SAF-M, monophospholipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin of Escherichia coli, cholera toxin, IMS1314, muramyl dipeptide, Montanide ISA 206, Montanide ISA 201, and gel adjuvant.

[0012] In some embodiments, the concentration range of the adjuvant is from 5 wt% to 50 wt%, preferably from 30 wt% to 50 wt%, more preferably 50 wt%.

[0013] In some embodiments, the freeze-drying protectant is selected from sugars, polyols, polymers, surfactants, salts, amines, or amino acids.

[0014] Preferably, the immunostimulant includes α-interferon, β-interferon, γ-interferon, granulocyte-macrophage colony-stimulating factor, macrophage colony-stimulating factor, or interleukin-2.

[0015] The present invention also relates to the use of the vaccine composition in the preparation of a medicament for the prevention of porcine deltacoronavirus-related diseases.

[0016] The porcine deltacoronavirus strain of the present invention is a prevalent wild-type porcine deltacoronavirus strain. A vaccine composition prepared with this strain can prevent the spread of porcine deltacoronavirus epidemics. Furthermore, after immunizing animals with the vaccine composition containing this strain, the animals' bodies can rapidly produce antibodies, which has a good preventive and control effect on the currently prevalent porcine deltacoronavirus infection and good biosafety. Detailed Implementation

[0017] The following explanations are provided for the relevant terms used in this application:

[0018] The term "Porcine deltacoronavirus" (PDCoV) is an RNA virus with a genome size of approximately 25 kb. Like other coronaviruses, it has axon-like surface spikes, hence its name. PDCoV primarily attacks the intestines of pigs, causing severe diarrhea and vomiting. Infected pigs exhibit significant growth retardation and dull coat color. PDCoV is mainly transmitted through the fecal-oral route, and the virus can survive in the environment for a long time, posing a serious threat to pig production and breeding.

[0019] This invention relates to porcine deltacoronavirus (strain) PDCoV HN02, deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:V202441, located at Wuhan University, Wuhan, China, on March 28, 2024.

[0020] The term "porcine deltacoronavirus PDCoV HN02" is also known as "porcine deltacoronavirus HN02 strain".

[0021] This invention relates to a vaccine composition comprising an immunologic dose of porcine deltacoronavirus (PDCoV) HN02 antigen and a pharmaceutically acceptable vector.

[0022] The term "vaccine composition," also known as an immunogenic composition, refers to an immunogenic preparation, including whole cells, inactivated or attenuated, live viruses or bacteria, or polysaccharides, or combinations thereof, which are administered to stimulate a humoral and cellular immune response in a receptor to one or more antigens present in the immunogenic composition. Immunization is the process of administering a vaccine composition and stimulating an immune or immunogenic response to an antigen in a host, preferably an animal such as a pig.

[0023] The term "immune dose" should be understood as "immunely effective dose," also known as immune protective dose or effective dose to elicit an immune response. It refers to the amount of antigen that can effectively induce an immune response in a recipient, sufficient to prevent or improve the signs or symptoms of disease, including adverse health effects or complications thereof. This immune response may be sufficient for diagnostic purposes or other tests, or may be suitable for preventing signs or symptoms of disease, including adverse health outcomes or complications of infection caused by a pathogen. Humoral immunity or cell-mediated immunity, or both, can be induced. An animal's immune response to an immunogenic composition can be indirectly assessed, for example, by measuring antibody titers, lymphocyte proliferation analysis, or directly assessed by monitoring signs or symptoms after challenge with a wild-type strain. The protective immunity provided by the vaccine can be assessed by measuring, for example, clinical signs in the subject such as mortality, reduction in morbidity, temperature values, overall physiological status, and overall health and performance. The immune response may include, but is not limited to, the induction of cellular and / or humoral immunity.

[0024] The term "porcine deltacoronavirus antigen" refers to any composition containing at least one form of porcine deltacoronavirus antigen that can induce, stimulate, or resist an immune response to porcine deltacoronavirus infection. The antigen form includes, but is not limited to, inactivated, attenuated, or subunit antigens. Inactivated antigens can be inactivated and maintain their immunogenicity by various methods, including chemical treatment, physical treatment (such as acoustic treatment, irradiation, heat), or any other commonly used method sufficient to inhibit the replication or growth of the organism. Preferably, the pathogen is inactivated after collection and optionally subjected to clarification and purification. Chemical treatment uses, for example, formalin or formaldehyde, β-propiolactone, ethyleneimine, diethyleneimine BEI, thimerosal, etc. Inactivation methods are well known to those skilled in the art, such as treatment with β-propiolactone (Plana-Duran et al., Vet. Microbiol., 1997, 55:361-370) or with BEI (US5587164).

[0025] The term "pharmaceutically acceptable carrier" refers to a carrier or diluent, preferably an adjuvant, that does not irritate the body or impede the biological activity and properties of the compound in all components of the vaccine composition of the present invention, except for the porcine deltacoronavirus antigen.

[0026] The term "adjuvant" may include aluminum gel adjuvants; saponins, such as Quil A, QS-21 (Cambridge Biotech Incorporation, Cambridge MA), and GPI-0100 (Galenica Pharmaceuticals Incorporation, Birmingham AL); water-in-oil emulsions; oil-in-water emulsions; water-in-oil-in-water emulsions; polymers of acrylic acid or methacrylic acid; and compounds selected from copolymers of maleic anhydride and alkenyl derivatives.

[0027] The term "emulsion" may be particularly based on light liquid paraffin oils (European Pharmacopea type); isoprenoid oils resulting from olefin oligomerization, such as squalane or squalene oils, especially isobutylene or decanene; esters of acids or alcohols containing linear alkyl groups, more particularly vegetable oils, ethyl oleate, propylene glycol di-(octanoate / decanoate), glyceryl tri-(octanoate / decanoate), or propylene glycol dioleate; esters of branched fatty acids or alcohols, especially isostearates. Oils are used in combination with emulsifiers to form emulsions. Emulsifiers are preferably nonionic surfactants, especially esters of sorbitan, esters of mannitol (such as anhydrous mannitol oleate), esters of aliphatic glycols, esters of polyglycerol, esters of propylene glycol, and esters of oleic acid, isostearic acid, castor oil, or hydroxystearic acid. These may be ethoxylated, as well as polyoxypropylene-polyoxyethylene block copolymers, especially Pluronic products, particularly L121. See Hunter et al., *The theory and practical application of adjuvants* (Ed. by DES Stewart-Tull, John Wiley and Sons, New York, 1995: 51-94) and Todd et al., *Vaccine* (1997, 15: 564-570). For example, the SPT emulsion described on page 147 and the MF59 emulsion described on page 183 of "Vaccine design, the Subunit and adiuvant approach" (Plenum Press, 1995) by Powell M and Newman M can be used.

[0028] The term "polymer of acrylic acid or methacrylic acid" preferably refers to crosslinked acrylic acid or methacrylic acid polymers, especially those crosslinked with polyolefin ethers or polyols of sugar, compounds known as Carbomer (trade name Carbopol) (Phameuropa, 1996, 8(2)). Those skilled in the art may also refer to U.S. Patent US2909462, which describes such acrylic polymers crosslinked with polyhydroxylated compounds having at least three hydroxyl groups, preferably no more than eight, wherein the hydrogen atoms of at least three hydroxyl groups are replaced by unsaturated aliphatic radicals having at least two carbon atoms. Preferred groups are those containing 2-4 carbon atoms, such as vinyl, allyl, and other ethylenically unsaturated groups. These unsaturated groups may themselves contain other substituents, such as methyl groups. These products are sold under the name Carbopol (BF Goodrich, Ohio, USA), which is particularly suitable. They are crosslinked with allyl sucrose or with allyl pentaerythritol. Among these, Capop 974P, 934P and 971P can be mentioned, with Capop 971P being the preferred choice.

[0029] The term "copolymer of maleic anhydride and alkenyl derivatives" may also refer to the copolymer of maleic anhydride and ethylene, EMA (Monsanto), which dissolves in water to produce an acidic solution, which is then neutralized, preferably to physiological pH, to produce an adjuvant solution into which immunogenic, immunizing, or vaccine compositions can be incorporated.

[0030] The term "adjuvant" also includes, but is not limited to, RIBI adjuvant system (Ribi Incorporation), Block co-polymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-sensitive enterotoxin (recombinant or other), cholera toxin, IMS1314, muramyl dipeptide, gel adjuvant, etc.

[0031] In a preferred embodiment, the adjuvant includes one or more of the following: mineral oil, aluminum gel adjuvant, saponin, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion, polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives, RIBI adjuvant system, Block co-polymer, SAF-M, monophospholipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin of Escherichia coli, cholera toxin, IMS1314, muramyl dipeptide, Montanide ISA 206, Montanide ISA 201, or gel adjuvant.

[0032] Preferably, the adjuvant is a biphasic adjuvant used to prepare an oil-in-water emulsion.

[0033] In some embodiments, the concentration range of the adjuvant is from 5 wt% to 50 wt%, preferably from 30 wt% to 50 wt%, more preferably 50 wt%. The concentration range of the adjuvant may be, but is not limited to, 5 wt%, 10 wt%, 15 wt%, 20 wt%, 25 wt%, 30 wt%, 35 wt%, 40 wt%, 45 wt%, or 50 wt%.

[0034] The term "lyophilization protectant" refers to a component, other than excipients, that protects the efficacy of a drug's active ingredient during the freeze-drying process and subsequent storage. Lyophilization protectants can be selected from sugars, polyols, polymers, surfactants, salts, amines, or amino acids.

[0035] In some embodiments, the immunostimulant includes alpha-interferon, beta-interferon, gamma-interferon, granulocyte-macrophage colony-stimulating factor, macrophage colony-stimulating factor, or interleukin-2.

[0036] The present invention also relates to a vaccine composition comprising an immunologic dose of the porcine deltacoronavirus strain or culture thereof inactivated antigen and a pharmaceutically acceptable carrier.

[0037] In one embodiment of the present invention, the porcine deltacoronavirus PDCoV HN02 antigen in the vaccine composition of the present invention is an inactivated antigen of porcine deltacoronavirus PDCoV HN02 or its culture.

[0038] The term “prevention” in relation to swine deltacoronavirus infection refers to inhibiting the replication of swine deltacoronavirus, inhibiting the spread of swine deltacoronavirus, or preventing swine deltacoronavirus from settling in its host, as well as alleviating the symptoms of disease or illness caused by swine deltacoronavirus infection.

[0039] The present application will be further described below with reference to specific embodiments, and the advantages and features of the present application will become clearer with the description. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present application without departing from the spirit and scope of the present application, but such modifications and substitutions all fall within the protection scope of the present application.

[0040] All chemical reagents used in the embodiments of this application are of analytical grade and were purchased from Sinopharm Group. Unless otherwise specified, the experimental methods described in this application are conventional methods; and the biological materials described are commercially available unless otherwise specified.

[0041] Example 1: Isolation of porcine deltacoronavirus (PDCoV) HN02

[0042] 1. Sample screening and processing

[0043] Small intestinal contents were collected from piglets suffering from diarrhea in various regions. Detection was performed using the multiplex RT-PCR method for porcine rotavirus, porcine transmissible gastroenteritis virus (TGEV), and porcine epidemic diarrhea virus (PEDV) according to GB / T 36871-2018, and the fluorescent RT-PCR method for PDCoV in the SN / T 5124-2019 Technical Specification for Quarantine of Porcine Delta Coronavirus. The results showed negative for porcine rotavirus, TGEV, and PEDV, but positive for PDCoV. The small intestinal contents were diluted with DMEM medium at a mass ratio of 1:5, mixed thoroughly, centrifuged at 10000 rpm for 10 min at 2–8°C, and the supernatant was filtered through a 0.22 μm filter, aliquoted, and stored as A1, A2, A3, A4, A5, A6, A7, A8, A9, and A10, respectively.

[0044] 2. Isolation of porcine deltacoronavirus

[0045] 2.1 Separation method of the present invention

[0046] LLC-PK1 cells that have grown to a monolayer were washed 2–3 times with DMEM medium containing 0.5 μg / ml trypsin. PDCoV-positive small intestinal contents were seeded onto LLC-PK1 cells at 10% (V / V) and incubated at 37°C for 1 hour. The adsorption medium was discarded, and DMEM medium containing 0.5 μg / ml trypsin was added. The cells were then cultured at 37°C and 5% CO2. The cytopathic effect was observed daily. Cell cultures were harvested when more than 80% of cells showed CPE (cytopathic effect) or 72–96 hours after seeding. Cell cultures were passaged continuously to the F5 generation in the above manner. Before each passage, the harvested cell cultures were repeatedly frozen and thawed 2–3 times.

[0047] 2.2 Separation using conventional methods

[0048] LLC-PK1 cells that have grown to a monolayer were washed 2-3 times with DMEM medium. PDCoV-positive small intestinal contents were then inoculated onto LLC-PK1 cells at 10% (V / V) and incubated at 37°C for 1 hour. The adsorption solution was discarded, DMEM medium was added, and the cells were cultured at 37°C with 5% CO2. The lesion condition was observed daily. Cell cultures were harvested when more than 80% of cells showed signs of cerebral embolism (CPE) or 72-96 hours after inoculation. Cell cultures were passaged continuously to the F5 generation in the same manner. Before each passage, the harvested cell cultures were repeatedly frozen and thawed 2-3 times.

[0049] A1, A2, A3, A4, A5, A6, A7, A8, A9, and A10 were isolated as viruses according to the isolation method of the present invention (2.1) and the conventional isolation method (2.2), respectively. The harvested viral fluids were named A1-1, A2-1, A3-1, A4-1, A5-1, A6-1, A7-1, A8-1, A9-1, A10-1 and A1-2, A2-2, A3-2, A4-2, A5-2, A6-2, A7-2, A8-2, A9-2, A10-2, respectively, and their viral titers were determined. The results are shown in Table 1.

[0050] Table 1. Virus titer determination results of viruses isolated by different isolation methods

[0051] The results showed that the virus could be isolated from all positive samples using the method of this invention, while 6 out of 10 samples isolated using conventional methods showed no detectable viral titer (no cytopathic effect). At the same time, in the 4 out of 10 samples where viral titer could be detected, the viral titer isolated by the method of this invention was significantly higher than that of conventional methods.

[0052] The isolated A9-1 was named porcine deltacoronavirus PDCoV HN02 and was preserved.

[0053] Example 2: Identification of porcine deltacoronavirus (PDCoV) HN02

[0054] 2.1 IFA Identification

[0055] F5 generation virus solution was inoculated into LLC-PK1 cells that had grown into a monolayer in 6-well plates. After 48–72 hours of culture, cell endothelial processes (CPE) appeared. Cells were washed with PBS (pH 7.4, 0.02 mol / L) and fixed with 80% ice-cold acetone at 2–8°C for 30 min. The primary antibody was PDCoV monoclonal antibody 1G12 (1:1000), and the secondary antibody was FITC-labeled anti-mouse IgG (1:500). Normal cell controls were included. Observation under an inverted fluorescence microscope showed specific green fluorescence only in the virus inoculation wells, indicating that the isolated virus was PDCoV.

[0056] 2.2 Sequencing

[0057] Primers for amplifying the PDCoV S gene were designed using Primer 5.0 software, based on the PDCoV gene sequence published in GenBank. These primers were synthesized by Genewiz and their sequences are as follows:

[0058] SF1: ATTCATGGCGCAATGAAATAG

[0059] SR1: TTGTGCAATAAGAGATCTGAT

[0060] SF2: CATCCTATTGTGTCACTAAGC

[0061] SR2: CCAACTGCTTGGTTAAATGAT

[0062] SF3: ATGCTGAGAAAATGGCAATGTA

[0063] SR3: TTTACAAACTCATCCTCAGGT

[0064] The S1 amplification product was 1537 bp, the S2 amplification product was 1366 bp, and the S3 amplification product was 1518 bp. Viral RNA was extracted using a commercial nucleic acid extraction kit. The three-segment gene amplification system consisted of: PrimeScript One Step Enzyme Mix 2 μl, 2×One Step Buffer 25 μl, forward and reverse primers 1 μl each, ddH2O 15 μl, and template 4 μl. PCR reaction conditions were: 50℃ for 30 min, 94℃ for 2 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 10 min, 25℃ for 5 min. The PCR amplification products were electrophoresed on a 1% agarose gel, amplifying bands of approximately 1500 bp, consistent with the target band size. The PCR products were purified using a Gel Extraction Kit D2500 and sent to Suzhou Kingwise Biotechnology Co., Ltd. for sequencing. Nucleotide sequence assembly using SeqMan software revealed that the full-length S gene of this strain is 3480 bp, indicating that PDCoV HN02 is a porcine deltacoronavirus. Simultaneously, sterility, purity, and exogenous virus tests were performed on the viral fluid of this strain, and all results were satisfactory. No bacteria, fungi, or mycoplasma grew, and the results for exogenous viruses PEDV, TGEV, PRoV, PRRSV, PCV2, PRV, CSFV, BVDV, and PPV were all negative.

[0065] Example 3: Pathogenicity test of porcine deltacoronavirus PDCoV HN02

[0066] 3.1 Screening for viral challenge: Ten 21-24 day old piglets that were negative for porcine deltacoronavirus, porcine rotavirus, porcine epidemic diarrhea virus, and porcine transmissible gastroenteritis virus antigens were randomly divided into two groups of five piglets each. Group 1 was the challenge group, and each piglet was orally administered 8 ml of PDCoV HN02 viral fluid (virus content 10...) 6.0 TCID 50 Group 2 served as the control group, receiving oral inoculation with DMEM culture medium only (8 ml / head). Experimental pigs were isolated and observed for 14 consecutive days.

[0067] 3.2 Clinical Symptoms: Within 48 hours of challenge, all experimental pigs in the challenge group began to exhibit lethargy, decreased appetite, vomiting, and loose, watery diarrhea. The control group showed normal appetite and mental state.

[0068] 3.3 Necropsy and Tissue Infection: Seven days after the challenge, two piglets were randomly selected from the challenge group for necropsy. The jejunum and ileum walls showed thinning with hemorrhage; mesenteric lymph nodes also showed hemorrhage. Quantitative real-time RT-PCR was performed on the jejunum, ileum, duodenum, cecum, colon, and mesenteric lymph nodes. The results showed that all samples were positive for PDCoV, and negative for porcine rotavirus (PRoV), porcine epidemic diarrhea virus (PEDV), and porcine transmissible gastroenteritis virus (TGEV).

[0069] 3.4 Anal swabs were collected daily after the challenge and the PDCoV antigen in the anal swabs was detected by the PDCoV fluorescence quantitative RT-PCR method. The results showed that the peak of viral shedding was reached on the 4th day after the challenge and lasted until at least the 14th day after the challenge.

[0070] In summary, this invention demonstrates that the isolate PDCoV HN02 is a highly virulent strain of porcine deltacoronavirus, which is pathogenic to piglets aged 21–24 days.

[0071] Example 4: Culture of porcine deltacoronavirus PDCoV HN02 virus

[0072] The LLC-PK1 cells, which had grown to a monolayer, were washed 2-3 times with DMEM medium containing 0.5 μg / ml trypsin. PDCoVHN02 virus solution was then inoculated onto the monolayer LLC-PK1 cells at a ratio of 2% (V / V) and incubated at 37°C for 1 hour. The adsorption solution was discarded, and DMEM medium containing 0.5 μg / ml trypsin was added. The cells were then cultured at 37°C and 5% CO2. When the cytopathic effect reached 80% or more, the virus solution was harvested and subjected to three freeze-thaw cycles at -70°C. Cell debris was removed by centrifugation at 8000 rpm for 10 minutes, and the supernatant was collected for inactivation.

[0073] Example 5: Preparation of inactivated vaccine against porcine deltacoronavirus (PDCoV) HN02

[0074] Take PDCoV HN02 strain virus solution, add 2 mol / L cyclized diethyleneimine (BEI) to a final BEI concentration of 3 mmol / L, stir at 37°C for 36 hours to inactivate the virus, then add sodium thiosulfate to a final concentration of 2 mmol / L, and terminate the inactivation at 37°C for 30 minutes. Store the inactivated antigen at 2–8°C for later use. Inoculate the inactivated antigen into monolayer LLC-PK1 cells at a ratio of 2% (V / V). Harvest 72 hours after inoculation as F1 generation. Repeat this process until F3 generation; no cytopathic effect indicates successful inactivation.

[0075] After inactivation, the antigen is slowly added to the adjuvant under low-speed conditions. After mixing, the mixture is stirred at 350 rpm for 5 minutes. The adjuvant suitable for this invention can be any adjuvant known to those skilled in the art. In this invention, a biphasic adjuvant (water-in-oil-in-water emulsion) is selected, such as Montanide ISA 201 adjuvant. Specific proportions are shown in Table 2. The emulsified vaccine undergoes dosage form testing as follows: A clean pipette is used to draw a small amount of vaccine and drop it onto a clean, cold water surface. If it diffuses in a cloud-like manner, the vaccine dosage form is qualified. The emulsified vaccine undergoes stability testing as follows: 10 ml of vaccine is added to a centrifuge tube and centrifuged at 3000 rpm for 15 minutes. If no layering or emulsion breaking is observed, the vaccine stability is qualified.

[0076] Table 2. Composition ratio of inactivated vaccine for porcine deltacoronavirus (PDCoV) HN02.

[0077] Example 6: Safety Trial of Porcine Delta Coronavirus (PDCoV) HN02 Inactivated Vaccine

[0078] 6.1 Safety trials in pregnant sows

[0079] Eight pregnant sows that were negative for PDCoV antigen and antibodies 4–6 weeks before farrowing were randomly divided into four groups of two sows each. Group 1 received an intramuscular injection of vaccine 1 (4 ml / sow) prepared in Example 5 via the neck; Group 2 received an intramuscular injection of vaccine 2 (4 ml / sow) prepared in Example 5 via the neck; Group 3 received an intramuscular injection of vaccine 3 (4 ml / sow) prepared in Example 5 via the neck; and Group 4 served as a control group, receiving an equal volume of sterile PBS via the neck. The sows' mental state, appetite, and body temperature were observed after immunization. A booster immunization was administered 2–4 weeks before farrowing, and the sows' mental state, appetite, and body temperature were observed again until farrowing. The results are shown in Table 3.

[0080] Table 3. Safety test results of inactivated vaccines in pregnant sows.

[0081] The results showed that, compared with the control group 4, the six pregnant sows in the immunization groups 1, 2 and 3 had no abnormalities in spirit, feed intake, body temperature, pregnancy and farrowing, and no adverse reactions were observed at the injection site or throughout the body. All the sows survived.

[0082] 6.2 Safety test of piglets

[0083] Twenty PDCoV antigen-antibody negative piglets aged 3-5 days were randomly divided into four groups of five piglets each. Group 5 received an intramuscular injection of vaccine 1 (2 ml / pig) prepared in Example 5 into the neck; Group 6 received an intramuscular injection of vaccine 2 (2 ml / pig) prepared in Example 5 into the neck; Group 7 received an intramuscular injection of vaccine 3 (2 ml / pig) prepared in Example 5 into the neck; and Group 8 served as a control group, receiving an equal volume of sterile PBS into the neck. The piglets' mental state, appetite, body temperature, and fecal condition were observed after immunization for 14 consecutive days. The results are shown in Table 4.

[0084] Table 4. Safety test results of inactivated vaccines administered to piglets.

[0085] The results showed that, compared with the control group 8, the 15 piglets in the immunization groups 5, 6, and 7 had no abnormalities in spirit, suckling, body temperature, or feces. No adverse reactions were observed at the injection site or throughout the body, and all piglets survived.

[0086] Safety trials on pregnant sows and piglets have shown that the inactivated vaccines 1, 2, and 3 prepared in this invention are safe for immunizing sows and piglets.

[0087] Example 7: Immunogenicity test of porcine deltacoronavirus PDCoV HN02 inactivated vaccine

[0088] 7.1 Active immunization test

[0089] Twenty pregnant sows that were negative for porcine deltacoronavirus, porcine rotavirus, porcine epidemic diarrhea virus, and porcine transmissible gastroenteritis virus antigens and antibodies 4–6 weeks before farrowing were randomly divided into four groups of five sows each. Group 9 received an intramuscular injection of vaccine 1 (4 ml / sow) prepared in Example 5 via the neck; Group 10 received an intramuscular injection of vaccine 2 (4 ml / sow) prepared in Example 5 via the neck; Group 11 received an intramuscular injection of vaccine 3 (4 ml / sow) prepared in Example 5 via the neck; and Group 12 served as a control group, receiving an equal volume of sterile PBS via the neck. The sows' mental state, appetite, and body temperature were observed after immunization. A booster immunization was administered 2–4 weeks before farrowing, and the sows' mental state, appetite, and body temperature were observed again until farrowing.

[0090] After farrowing, five 3-day-old piglets from each sow in groups 9 to 12 were collected, totaling 25 piglets per group and 100 piglets in total. All piglets were orally administered 8 ml of porcine deltacoronavirus (PDCoV) HN02 virus solution (virus content of 106.0 TCID50 / ml), and their clinical manifestations after challenge were observed. The results are shown in Table 5.

[0091] Table 5 Results of Active Immunization Tests

[0092] The results showed that piglets born to immunized sows, after challenge with the virus at 3 days of age, showed no abnormalities in their mental state, suckling, body temperature, or feces in groups 9, 10, and 11, and all survived. In group 12, the control group, 25 out of 25 piglets exhibited typical symptoms of porcine deltacoronavirus, including vomiting and watery diarrhea, after challenge. Immunization of pregnant sows with vaccines 1, 2, and 3 all resulted in 100% protection for their offspring, indicating that inactivated vaccines 1, 2, and 3 have good protective effects.

[0093] 7.2 Passive Immunization Experiment

[0094] Forty piglets aged 3–5 days that were negative for porcine deltacoronavirus, porcine rotavirus, porcine epidemic diarrhea virus, and porcine transmissible gastroenteritis virus were randomly divided into four groups of 10 piglets each. Group 13 received an intramuscular injection of vaccine 1 (2 ml / piglet) prepared in Example 5 via the neck; Group 14 received an intramuscular injection of vaccine 2 (2 ml / piglet) prepared in Example 5 via the neck; Group 15 received an intramuscular injection of vaccine 3 (2 ml / piglet) prepared in Example 5 via the neck; and Group 16 served as a control group, receiving an equal volume of sterile PBS via the neck. A second vaccination was administered two weeks after the first vaccination. The piglets' mental state, appetite, body temperature, and fecal condition were observed after immunization.

[0095] Twenty-one days after the second immunization, all piglets were orally administered porcine deltacoronavirus (PDCoV) HN02 virus solution, 8 ml / pig (virus content 106.0 TCID50 / ml), and the clinical manifestations of the piglets after challenge were observed. The results are shown in Table 6.

[0096] Table 6 Results of Passive Immunization Tests

[0097] The results showed that 21 days after the second immunization, the 10 immunized piglets in groups 13, 14, and 15 showed no abnormalities in suckling, mental state, body temperature, or feces, and all survived. In group 16, the 10 control piglets, 10 out of 10 exhibited typical symptoms of porcine deltacoronavirus, including vomiting and watery diarrhea. Vaccines 1, 2, and 3 all showed a 100% protection rate for piglets, indicating that inactivated vaccines 1, 2, and 3 have good protective effects.

[0098] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the technical solution of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention shall still fall within the scope of the technical solution of the present invention.

Claims

1. A porcine deltacoronavirus strain PDCoV HN02, with accession number CCTCCNO:V202441.

2. A vaccine composition, wherein, The vaccine composition comprises an immunizing dose of the PDCoV HN02 strain of porcine deltacoronavirus of claim 1 and a pharmaceutically acceptable vector.

3. The vaccine composition according to claim 2, wherein, The antigen is an inactivated whole virus antigen, preferably an inactivated porcine deltacoronavirus strain PDCoV HN02 or its culture.

4. The vaccine composition according to claim 3, wherein, Antigen content ≥10 before inactivation 6.0 TCID 50 / ml; preferably, the antigen content is 10% of the pre-inactivation level. 6.0 -10 7.5 TCID 50 / ml; more preferably, the antigen content is 10% of the pre-inactivation level. 7.0 TCID 50 / ml.

5. The vaccine composition according to claim 2, wherein, The pharmaceutically acceptable carriers include at least one of adjuvants, lyophilization protectants, immunostimulants, antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants, and preservatives.

6. The vaccine composition according to claim 5, wherein, The adjuvants include one or more of the following: mineral oil, aluminum gel adjuvant, saponins, avrididine, DDA, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion, polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives, RIBI adjuvant system, Block co-polymer, SAF-M, monophospholipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin of Escherichia coli, cholera toxin, IMS1314, muramyl dipeptide, MontanideISA 206, MontanideISA 201, and gel adjuvant.

7. The vaccine composition according to claim 5, wherein, The concentration range of the adjuvant is from 5 wt% to 50 wt%, preferably from 30 wt% to 50 wt%, and more preferably 50 wt%.

8. The vaccine composition according to claim 5, wherein, The freeze-drying protectant is selected from sugars, polyols, polymers, surfactants, salts, amines, or amino acids.

9. The vaccine composition according to claim 5, wherein, The immunostimulants include α-interferon, β-interferon, γ-interferon, granulocyte-macrophage colony-stimulating factor, macrophage colony-stimulating factor, or interleukin-2.

10. Use of the vaccine composition of any one of claims 2-9 in the preparation of a medicament for the prevention of porcine deltacoronavirus-related diseases.

Citation Information

Patent Citations

  • Acrylic acid polymer laxative compositions

    US2909462A

  • Porcine reproductive and respiratory syndrome virus antigen and processes for the preparation and use of said antigen in vaccines and diagnostics

    US5587164A