Candida antarctica lipase B mutant as well as coding gene and application thereof
By directing the evolution and rational design of Candida antarcticis lipase B, multiple amino acid sequence mutants were constructed, solving the problems of insufficient thermal stability and enzyme activity of CALB and achieving efficient catalysis in high-temperature industrial applications.
Patent Information
- Application Number
- CN202511702983.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-19
- Publication Date
- 2026-02-10
AI Technical Summary
The existing Candida antarcticis lipase B (CALB) has poor thermal stability and insufficient enzyme activity, which limits its expansion in high-temperature industrial applications.
By conducting directed evolution and rational design of Candida antarcticis lipase B, mutants with multiple amino acid sequence mutations were constructed to improve its thermal stability and enzyme activity, including mutants such as A282Y, A282M, Q231F, A89K, A275M, A275L, I255P, and V236I.
The mutant exhibits improved thermal stability by 0.5-10℃, increased enzyme activity by 1-2 times, and improved catalytic efficiency by 1.0-4.5 times, making it suitable for high-temperature industrial catalytic reactions.
Smart Images

Figure CN121495903A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biocatalysis application technology, specifically to an Antarctic Candida lipase B mutant, its encoding gene, and its applications. Background Technology
[0002] Antarctic Candida lipase B (CALB, PDB ID: 1TCA) has a molecular weight of 33.5 kDa and contains a Ser105-Asp187-His224 catalytic triplet and a Thr40-Gln106 oxygen anion hole. Relying on its unique three-dimensional conformation and specific substrate-binding pocket, it exhibits excellent ester synthesis and hydrolysis activities, with prominent regioselectivity and corresponding selectivity. It demonstrates high stability and strong activity in non-aqueous systems and is widely used in the synthesis of pharmaceutical intermediates. Due to its highly efficient catalytic hydrolysis and transesterification reactions, it is widely used in the food and pharmaceutical industries, with microbial lipases being the mainstream in industrial applications.
[0003] CALB often requires high temperatures in industrial catalytic applications, as these temperatures can accelerate reaction rates, increase solubility, reduce contamination risks, and save on cooling costs. However, wild-type CALB suffers from poor thermal stability and insufficient enzyme activity, which limits its application in high-temperature industries. Therefore, developing highly heat-resistant and highly active lipases to improve their optimal reaction temperature, heat resistance, and catalytic activity is crucial for industrial development.
[0004] To improve the catalytic properties of lipases, methods include natural screening and protein engineering, among which protein engineering includes directed evolution and rational design. For example, mutations at position 146 can improve the thermal inactivation temperature of mutants; or single / double mutants can be obtained through semi-rational design, improving performance; or highly flexible residue mutations can be screened, such as the T50 mutant, or directed mutations can be used to obtain mutants with improved activity and thermal stability. In other words, existing methods mostly improve one or two properties of enzymes, and have not conducted research on improving multiple properties. Summary of the Invention
[0005] To overcome the problems in the existing technology, this invention addresses the dual bottlenecks that restrict the application of the existing Candida antarcticis lipase B (CALB) in high-temperature industrial scenarios: poor thermal stability and enzyme activity levels that are difficult to match the increasing industrial catalytic demands. This invention provides a lipase mutant with high thermal stability and high activity, which is obtained through enzyme engineering molecular modification, thereby broadening the industrial applications of CALB.
[0006] In an embodiment of the present invention, a first aspect provides an Antarctic Candida lipase B mutant, wherein the amino acid sequence of the Antarctic Candida lipase B mutant is based on the amino acid sequence of the Antarctic Candida lipase B parent as a template, including one or more of the following mutations from the N-terminus to the C-terminus: Ala and Tyr at position 282, Ala and Met at position 282, Gln and Phe at position 231, Ala and Lys at position 89, Ala and Met at position 275, Ala and Leu at position 275, Ile and Pro at position 255, and Val and Ile at position 236. The amino acid sequence of the Antarctic Candida lipase B parent is shown in SEQ ID NO.1.
[0007] Preferably, the amino acid sequence of the *Candida antarcticis* lipase B mutant is shown in any one of SEQ ID NO. 2 to SEQ ID NO. 9. Preferably, the amino acid sequence of the Candida antarcticis lipase B mutant can also be a sequence obtained by substitution, deletion or addition of one or more amino acid residues as shown in any one of SEQ ID NO.2 to SEQ ID NO.9.
[0008] Preferably, the method for preparing the Candida antarcticis lipase B mutant includes the following steps: S1. The recombinant microorganism containing the nucleotide sequence encoding the Candida antarcticis lipase B mutant is inoculated into the culture medium for fermentation culture until the OD600 value of the fermentation broth reaches 2-5, and the seed liquid is obtained. S2. The seed culture is added to the fermentation medium for fermentation and expression culture, and then glycerol is added for induced fermentation culture. S3. After fermentation, centrifuge and collect the supernatant to obtain an enzyme solution containing the Candida antarcticis lipase B mutant.
[0009] Preferably, the culture medium in step S1 is YPD medium, and the fermentation temperature is 30°C.
[0010] Preferably, step S2 includes fermentation expression culture for 1-2 days, adding glycerol for induction, and continuing induction fermentation culture for 2-3 days.
[0011] Preferably, the temperature of the fermentation expression culture and the induced fermentation culture in step S2 is 30°C.
[0012] Based on a general inventive concept, the present invention also provides a coding gene for an Antarctic Candida lipase B mutant, the nucleotide sequence of which is shown in any one of SEQ ID NO.11 to SEQ ID NO.18. Alternatively, the coding region of the gene may include a nucleotide sequence as shown in any one of SEQ ID NO.11 to SEQ ID NO.18.
[0013] Based on a general inventive concept, the present invention also provides a recombinant vector comprising the encoding gene of the above-mentioned Candida antarcticis lipase B mutant.
[0014] Based on a general inventive concept, the present invention also provides a recombinant microorganism comprising the encoding gene of the above-mentioned Candida antarcticis lipase B mutant.
[0015] Based on a general inventive concept, the present invention also provides the application of an Antarctic Candida lipase B mutant in the catalytic synthesis of DHA glycerides.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a mutant of Candida antarcticis lipase B, exhibiting good thermostability and enzyme activity. The amino acid sequences of the lipase mutants shown in SEQ ID NO.2~SEQ ID NO.9 show Tm values that are 1.9℃, 2.8℃, 9.8℃, 1.3℃, 0.7℃, 0.7℃, 0.5℃, and 1.8℃ higher than those of wild-type Candida antarcticis lipase B, respectively. Furthermore, their esterification specific activities are 1.78 times, 1.05 times, 1.05 times, 1.84 times, 1.01 times, 1.12 times, 1.25 times, and 1.15 times higher than those of the wild-type, respectively. The esterification catalytic efficiency of the A282Y mutant is 4.5 times that of the wild-type, while the efficiencies of the other mutants are more than twice that of the wild-type. Compared to the wild-type lipase, the lipase mutant provided by this invention shows significantly improved thermostability and enhanced catalytic activity, which is beneficial for industrial applications. Attached Figure Description
[0017] Figure 1 This is an electrophoresis result diagram provided in an embodiment of the present invention, wherein... Figure 1 A shows the electrophoresis diagram of the target gene and empty plasmid. Figure 1 B is an electrophoresis image used to verify colony PCR; Figure 2 The recombinant plasmid pGAPZ(Mα)A provided in this embodiment of the invention; Figure 3 Crystal structure diagram of *Candida antarcticis* lipase B (CALB) provided for the implementation of this invention; Figure 4 Bar charts showing the Tm determination of Candida antarcticis lipase B mutant and wild type provided in embodiments of the present invention; Figure 5The activities of Antarctic Candida lipase B mutant and wild-type enzyme protein esterification enzyme provided in the embodiments of the present invention; Figure 6 The activities of the Antarctic Candida lipase B mutant and wild-type enzyme proteolytic enzyme provided in the embodiments of the present invention. Detailed Implementation
[0018] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0019] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.
[0020] the term In this invention, the term "nucleotide mutant" refers to the smallest unit in the nucleotide sequence of a gene that can undergo mutation.
[0021] Similarly, the term "amino acid mutant" as used in this invention refers to the smallest unit in the amino acid sequence of a protein that can be mutated.
[0022] The ">" symbol used in this invention represents a base mutation when indicating a nucleotide mutation.
[0023] In this invention, the label “c.” represents the nucleotide sequence of the protein-coding gene.
[0024] The label “p.” used in this invention represents the amino acid sequence of a protein when indicating a protein mutant.
[0025] The term "catalytic efficiency" as used in this invention refers to the specific activity of catalytic synthesis of DHA glycerides.
[0026] The term "enzyme activity" used in this invention refers to the ability of an enzyme to catalyze a certain chemical reaction. In this invention, enzyme activity is expressed as specific activity or specific enzyme activity, which refers to the enzyme activity per gram of enzyme protein, with the unit being U / g. When the enzyme protein is measured in mL, enzyme activity can also be expressed as U / mL.
[0027] In this invention, the term "original CALB gene" refers to the original CALB gene that encodes the original amino acid sequence of the Candida antarcticis lipase B mutant of this invention before mutation. The terms "original" and "original" are relative to the "mutation" provided in this invention.
[0028] In this invention, the enzyme property Tm value is defined as the temperature at which 50% of the enzyme molecules denature (i.e., the three-dimensional structure unfolds or the enzyme loses its native conformation) when the enzyme is heated at a constant rate under certain solution conditions. The higher the Tm value, the stronger the thermal stability of the enzyme.
[0029] The terms "mutant protein" and "mutant" used in this invention can be used interchangeably.
[0030] Appendix to this invention specification Figure 1 The term “bp” represents a gene length unit; the term “Marker” represents a DNA molecular weight standard; the term “pGAPZ(Mα)A-1 / pGAPZ(Mα)A-2” represents a vector plasmid; the term “CALB-1 / CALB-2” represents a target gene; and the term “T1-T10” represents a colony name.
[0031] Appendix to this invention specification Figure 2 The terms “AOX1 promoter / GAP promoter / TEF1 promoter / EM7 promoter” refer to promoters; “Mα” refers to signal peptides; “CALB” refers to target genes; “BleoR” refers to resistance genes; “ori” refers to replication initiation sites; and “AOX1terminator / CYC1 terminator” refers to terminators.
[0032] Specifically, the present invention obtains a CALB mutant protein with good stability and high enzyme activity through the following steps: (1) The original CALB gene in this invention was obtained from the literature (JU, TMH, SP, et al. The sequence, crystal structure determination and refinement of two crystal forms of lipase B from Candida antarctica.[J].Structure (London, England: 1993),1994,2(4):293-308.) (based on the literature, it was synthesized by BGI). The original CALB gene was obtained, and its nucleotide sequence is shown in SEQ ID NO.10. The original CALB amino acid sequence encoded by the nucleotide sequence of the original CALB gene is shown in SEQ ID NO.1 (PDB accession number: 1TCA).
[0033] (2) Based on the biological information provided in step (1), and combined with rational design and site-directed mutagenesis, an Antarctic Candida lipase B mutant with good thermal stability and high enzyme activity was constructed.
[0034] Based on the original Candida antarctic lipase B gene, this invention successfully constructed a mutant with thermal stability increased by 0.5-10℃ compared to the original wild type and enzyme activity increased by 1-2 times compared to the original Candida antarctic lipase B (CALB) through rational design and site-directed mutagenesis. This CALB mutant can efficiently catalyze the synthesis of DHA glycerides, with an catalytic efficiency increased by 1.0-4.5 times compared to the original. The enzyme catalytic reaction equation is shown below.
[0035]
[0036] Based on the above, this invention has discovered the following amino acid mutants that affect the enzyme activity of CALB. Their sequences include mutations at positions 282 (p.Ala282Tyr), 282 (p.Ala282Met), 231 (p.Gln231Phe), 89 (p.Ala89Lys), 275 (p.Ala275Met), 275 (p.Ala275Leu), 255 (p.Ile255Pro), and 236 (p.Val236Ile).
[0037] Correspondingly, the amino acid sequence of the CALB mutant protein contains one or more of the following mutations from the N-terminus to the C-terminus of the original CALB protein: Ala and Tyr at position 282, Ala and Met at position 282, Gln and Phe at position 231, Ala and Lys at position 89, Ala and Met at position 275, Ala and Leu at position 275, Ile and Pro at position 255, and Val and Ile at position 236. This mutant CALB enzyme activity exhibits a significant change. In this invention, "multiple" refers to two or more.
[0038] Specifically, compared to the original CALB, the following lipase mutants exhibit significantly enhanced enzyme activity, including catalytic efficiency for DHA glycerol synthesis. The mutant protein sequences specifically include: The CALB mutant protein No. 1 contains an Ala and Tyr mutation at position 282 from the N-terminus to the C-terminus of the original CALB amino acid sequence as shown in SEQ ID NO. 1, and its amino acid sequence is shown in SEQ NO. 2. The CALB mutant protein No. 2 contains an Ala and Met mutation at position 282 from the N-terminus to the C-terminus of the original CALB amino acid sequence; its amino acid sequence is shown in SEQ NO. 3. The CALB mutant protein No. 3 contains a Gln and Phe mutation at position 231 from the N-terminus to the C-terminus of the original CALB amino acid sequence; its amino acid sequence is shown in SEQ NO. 4. The CALB mutant protein number 4 contains an Ala and Lys mutation at position 89 from the N-terminus to the C-terminus of the original CALB amino acid sequence; its amino acid sequence is shown in SEQ NO. 5. The CALB mutant protein No. 5 contains an Ala and Met mutation at position 275 from the N-terminus to the C-terminus of the original CALB amino acid sequence; its amino acid sequence is shown in SEQ NO. 6. The CALB mutant protein number 6 contains an Ala and Leu mutation at position 275 from the N-terminus to the C-terminus of the original CALB amino acid sequence; its amino acid sequence is shown in SEQ NO. 7. The CALB mutant protein number 7 contains an Ile and Pro mutation at position 255 from the N-terminus to the C-terminus of the original CALB amino acid sequence; its amino acid sequence is shown in SEQ NO. 8. The CALB mutant protein number 8 contains the Val and Ile mutations at position 236 from the N-terminus to the C-terminus of the original CALB amino acid sequence; its amino acid sequence is shown in SEQ NO. 9.
[0039] Based on the aforementioned CALB mutant protein, this invention has discovered the following nucleotide mutants that affect the enzymatic activity of CALB. These nucleotide mutants include mutations at positions 844 (c.844 G> T), 845 (c.845 C> A), 846 (c.846 T> C), 844 (c.844 G> A), 845 (c.845 C> T), 846 (c.846 T> G), 691 (c.691 C> T), 692 (c.692 A> T), and 693 (c.693 G> T). One or more of the following mutations: T, G at position 265 (c.265 G > A), C at position 266 (c.266 C > A), G at position 823 (c.823 G > A), C at position 824 (c.824 C > T), T at position 825 (c.825 T > G), G at position 823 (c.823 G > C), A at position 763 (c.763 A > C), T at position 764 (c.764 T > C), T at position 765 (c.765 T > C), and G at position 706 (c.706 G > A).
[0040] Specifically, the mutant proteins encoded by the following genes exhibit significantly enhanced enzyme activity compared to the original CALB gene, including improved catalytic efficiency in the synthesis of DHA glycerol esters. The specific nucleotide sequences include: The nucleotide molecule is the coding gene for the CALB mutant protein number 1, and its sequence contains the mutations at positions 844 (G and T), 845 (C and A), and 846 (T and C) in the nucleotide sequence from the 5′ end to the 3′ end as shown in SEQ ID NO. 10; preferably, its nucleotide sequence is as shown in SEQ ID NO. 11. The nucleotide molecule is the coding gene encoding the CALB mutant protein of position 2, and its sequence contains the following mutations from the 5′ end to the 3′ end of the nucleotide sequence shown in SEQ ID NO. 10: G and A at position 844, C and T at position 845, and T and G at position 846; preferably, its nucleotide sequence is shown in SEQ ID NO. 12. The nucleotide molecule is the coding gene for the CALB mutant protein of position 3, and its sequence contains mutations at positions 691 (C and T), 692 (A and T), and 693 (G and T) in the nucleotide sequence from the 5′ end to the 3′ end as shown in SEQ ID NO. 10; preferably, its nucleotide sequence is as shown in SEQ ID NO. 13. The nucleotide molecule is the gene encoding the CALB mutant protein of position 4, and its sequence contains a mutation of G and A at position 265 and a mutation of C and A at position 266 in the nucleotide sequence shown in SEQ ID NO. 10 from the 5′ end to the 3′ end; preferably, its nucleotide sequence is shown in SEQ ID NO. 14. The nucleotide molecule is the coding gene for the CALB mutant protein number 5, and its sequence contains the mutations at positions 823 (G and A), 824 (C and T), and 825 (T and G) in the nucleotide sequence from the 5′ end to the 3′ end as shown in SEQ ID NO. 10; preferably, the nucleotide sequence is as shown in SEQ ID NO. 15. The nucleotide molecule is the gene encoding the CALB mutant protein number 6, and its sequence contains the mutations at positions 823 (G and C) and 824 (C and T) from the 5′ end to the 3′ end of the nucleotide sequence shown in SEQ ID NO. 10; preferably, the nucleotide sequence is as shown in SEQ ID NO. 16. The nucleotide molecule is the coding gene for the CALB mutant protein number 7, and its sequence contains the mutations at positions 763 (A and C), 764 (T and C), and 765 (T and C) in the nucleotide sequence from the 5′ end to the 3′ end as shown in SEQ ID NO. 10; preferably, the nucleotide sequence is as shown in SEQ ID NO. 17. The nucleotide molecule is the gene encoding the CALB mutant protein number 8, and its sequence contains a mutation of G and A at position 706 in the direction from the 5′ end to the 3′ end of the nucleotide sequence shown in SEQ ID NO. 10; preferably, the nucleotide sequence is as shown in SEQ ID NO. 18.
[0041] According to the present invention, the DNA molecule encoding the gene sequence is any one of a1 to a2: (a1) One of the DNA molecules containing the nucleotide sequences shown in SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17 or SEQ ID NO.18; (a2) The coding region includes one of the DNA molecules containing the nucleotide sequences shown in SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17 or SEQ ID NO.18; This invention also provides a recombinant vector, recombinant microorganism, and expression cassette for preparing *Candida antarcticus* lipase B mutants. The recombinant vector contains a nucleotide sequence encoding the CALB mutant protein, such as the recombinant plasmid pGAPZ(Mα)A; the recombinant microorganism contains a nucleotide sequence encoding the CALB mutant protein, such as the genetically engineered *Pichia pastoris*; and the expression cassette contains a nucleotide sequence encoding the CALB mutant protein. The vector for the recombinant expression plasmid described in this invention is pGAPZ(Mα)A (preserved in our laboratory), which is obtained by replacing the α signal peptide with the Mα signal peptide based on the pGAPZαA plasmid (BGI Genomics). The host cell described in this invention is *Pichia pastoris* X33 (purchased from the National Microbial Culture Collection). After the coding gene (cDNA) of the CALB mutant protein provided in this invention is homologously recombinated and introduced into the host cell, the resulting mutant protein is an exoprotein, which needs to be obtained by centrifugation to separate the bacterial cells.
[0042] The present invention relates to the application of the Candida antarcticis lipase B mutant in the catalytic synthesis of esters, including its application in the catalytic synthesis of DHA glycerides.
[0043] In some embodiments of the present invention, the applications include optimizing the thermal stability of CALB, improving CALB enzyme activity, and increasing the yield of DHA glycerides synthesized by catalysis.
[0044] The detection method and instruments in this invention: (1) PCR amplification was performed using a T30D gradient PCR instrument (LongGene, China). (2) PCR products were detected and separated using a MINI-SUB CELLGT POWER PAC 1000 agarose gel electrophoresis system (Bio-Rad, USA). (3) Nucleic acid concentration was determined using an N60Touch ultraviolet spectrophotometer (Implen GmbH). (4) The solubility and denaturation temperature (Tm) of the protein was accurately determined using a high-throughput protein stability analyzer NT.48 (NanoTemper, Germany). (5) The concentration of purified protein was determined using an 870 microplate reader (Thermo Fisher Scientific).
[0045] Experimental materials and reagents in this invention: Plasmids and strains: Genes were synthesized by BGI Genomics; Expression host strains and vectors: Pichia pastoris X33 and pGAPZ(Mα)A were both preserved in our laboratory and were derived from commercial sources; The site-directed mutagenesis lipase recombinant plasmid was constructed in our laboratory.
[0046] Main reagents: Yeast genome extraction kit (Bio-Tek); plasmid extraction kit (Omega); gel extraction kit (Omega); PCR product purification kit (OMEGA BIO-TEK); DNA marker / protein marker (Novizan); Coomassie Brilliant Blue (G250) (Solepro); T4 ligase / T4 ligase buffer / T4 PNK / DpnI / BstXI restriction enzyme (New England Biolabs); Gibsonase (TransGold); bleomycin (Invitrogen). Other routine reagents were domestically produced analytical grade.
[0047] Main culture media: YPD medium (10 g / L yeast extract, 20 g / L tryptone, 20 g / L glucose), YPD solid medium (10 g / L yeast extract, 20 g / L tryptone, 20 g / L glucose, 20 g / L agar powder), LB medium (5 g / L yeast extract, 10 g / L tryptone, 5 g / L NaCl), LB solid medium (5 g / L yeast extract, 10 g / L tryptone, 5 g / L NaCl, 20 g / L agar powder).
[0048] Example 1: Construction of recombinant plasmid.
[0049] The empty plasmid pGAPZ(Mα)A required for constructing the plasmid in this invention was obtained by extracting the plasmid from E. coli bacteria carrying the empty plasmid stored in the laboratory using an E. coli plasmid extraction kit; the target gene CALB was synthesized by BGI Genomics.
[0050] Using the designed primer pairs 1 and 2 as shown in SEQ ID NO. 19~22 (see Table 1), the target gene CALB (950 bp) and the empty plasmid pGAPZ(Mα)A (3900 bp) were amplified according to the PCR reaction system (see Table 2) and the PCR reaction procedure (see Table 3). The electrophoresis verification results of the PCR products are shown in Table 3. Figure 1 Analysis A showed that the target gene and plasmid amplification product bands corresponded correctly. The above fragments were ligated using Gibbs-Lysplastic ligation to obtain the recombinant plasmid pGAPZ(Mα)A-CALB, which was then chemically transformed into *E. coli* Trans 10. Recombinant strains were selected and colony PCR was performed using the colony PCR reaction system (see Table 4) for verification (see Table 5). The results are shown in Table 5. Figure 1 B; from Figure 1As shown in Figure B, the target gene fragments all conform to the validation length (1000 bp). Sequencing of the constructed plasmid and analysis indicate that the target gene fragments and plasmid vector were successfully ligated (see Figure B). Figure 2 ).
[0051]
[0052]
[0053]
[0054]
[0055]
[0056] Example 2 Prediction of mutation sites in Candida antarcticis lipase B mutant.
[0057] Obtain the crystal structure of CALB from the PDB database. Figure 3 The CALB model structure diagram was obtained using a modeller. Computer-aided protein design was employed, and the identified mutation sites are shown in Table 6.
[0058]
[0059] The primer pairs used for designing site-directed mutagenesis are as follows: sequences SEQ ID NO.23~52, as shown in Table 7.
[0060]
[0061]
[0062] Example 3 Construction of recombinant plasmid of Candida antarcticis lipase B mutant.
[0063] The experimental process and methods are explained in detail using mutant No. 1 as an example.
[0064] Primer: A282Y-fw: cggcatacgcagccatcgtggcgggtcc A282Y-rv:gatggctgcgtatgccggcgccaggagcg Using the recombinant plasmid pGAPZ(Mα)A-CALB (nucleotide sequence shown in SEQ ID NO. 55) obtained above as a template, circular PCR was performed at the corresponding sites of the constructed plasmid using the high-fidelity enzyme Primestar Max (see Tables 8 and 9); the PCR product was recovered by 5 μL Gipsyl enzyme + 5 μL, and self-ligation was performed using Gipsyl ligase (see Table 10). Subsequently, the ligation product was transformed into E. coli Trans10 competent cells by chemical transformation and plated on LB selection plates containing 1 / 1000 bleomycin. The transformants were picked, plasmids were extracted, and sequenced to identify the plasmid gene containing the mutant pGAPZ(Mα)A-A282Y.
[0065]
[0066]
[0067]
[0068] The primers synthesized based on the mutation sites are shown in Table 7. The recombinant plasmids containing the mutant gene obtained according to the above operations are pGAPZ(Mα)A-A282Y, pGAPZ(Mα)A-A282M, pGAPZ(Mα)A-V15K, pGAPZ(Mα)A-S250P, pGAPZ(Mα)A-Q231F, pGAPZ(Mα)A-T165Y, and pGAPZ(Mα)A-Q231F. α)A-A89K, pGAPZ(Mα)A-N79T, pGAPZ(Mα)A-A275M, pGAPZ(Mα)A-A275L, pGAPZ(Mα)A-S2 33A, pGAPZ(Mα)A-I255P, pGAPZ(Mα)A-G226L, pGAPZ(Mα)A-Q175V, pGAPZ(Mα)A-V236I.
[0069] Example 4: Transformation and verification of recombinant plasmid of Candida antarcticis lipase B mutant.
[0070] The recombinant plasmids were linearized using the restriction endonuclease BstXI. The linearized fragments were added to Pichia pastoris X33 competent cells, mixed thoroughly, and then transferred to pre-chilled electroporation cuvettes. Electroporation was performed using an Eppendorf electroporator. After electroporation, sterile, antibiotic-free YPD culture medium was added to the cuvettes, transferred to sterile centrifuge tubes, and incubated at 30°C and 200 rpm for 2–3 hours. The recovery solution was then plated onto YPD selection plates containing 0.5% bleomycin and incubated for 3–4 days.
[0071] Transformants were picked and inoculated into YPD medium and cultured overnight. The yeast cells were collected, and the genome was extracted using a yeast genome extraction kit. Using the genome as a template, PCR verification was performed using universal primers P-fw and P-rv (e.g., sequences SEQ ID NO. 53-54). Positive clones yielded a 1000 bp band.
[0072] The universal primers are as follows: P-fw: ccaccattgcctctattgccgctaagg (as shown in SEQ ID NO.53); P-rv: gcatctctcaggcaaatggcattctgac (as shown in SEQ ID NO.54).
[0073] Example 5: Enzyme solution was obtained by shake-flask fermentation culture.
[0074] Transformants of the validated positive clone mutants were inoculated into 4 mL of YPD medium and cultured at 30°C until the OD600 value of the culture reached 2–5. The culture was then transferred to a fungal baffle shake flask containing 100 mL of sterile, antibiotic-free fermentation medium for fermentation expression, and cultured at 30°C and 200 rpm for 1–2 days. Subsequently, 4% glycerol solution (50% glycerol concentration) was added to induce fermentation, and the mixture was cultured on a shaker at 30°C and 200 rpm for 2–3 days. After fermentation, the culture was centrifuged at 4°C and 4500 rpm for 15 min, and the fermentation broth was collected by centrifugation. The bacterial cells were discarded, and the supernatant enzyme solution was collected.
[0075] Example 6: Concentration and purification of fermentation broth.
[0076] The fermentation broth was placed in a 10kD ultrafiltration vessel for ultrafiltration concentration to 1-1.5 g / L. The concentrated enzyme solution was then washed and purified with 0.1M PBS buffer (pH 8.0) until the wash solution was colorless.
[0077] The enzyme solution was reacted with G250 Coomassie Brilliant Blue, and the absorbance at 595 nm was measured using a Thermo Fisher Scientific 870 microplate reader. The protein concentration was calculated using the standard curve equation (see Table 11).
[0078]
[0079] Example 7: Determination of Tm value for enzymatic properties.
[0080] To simplify the screening process, the thermostability of the concentrated and purified mutant enzyme protein from Example 6 was first determined. Using an NT.48 high-throughput protein stability analyzer based on fluorescent dye-based thermal denaturation monitoring, the Tm values of the eleven mutants and the wild type were measured. The results are as follows: Figure 4 As shown, compared with the wild type, the Tm values of mutants A282Y, A282M, Q231F, T165Y, A89K, A275M, A275L, I255P and V236I increased by 1.9℃, 2.8℃, 9.8℃, 12.5℃, 1.3℃, 0.7℃, 0.7℃, 0.5℃ and 1.8℃ respectively, indicating that the mutant proteins have better heat resistance.
[0081] Example 8: Assay of esterase activity.
[0082] The mutants obtained from the above screening were cultured and expressed. The resulting enzyme solution was pretreated, and the fermentation broth was placed in a 10kD ultrafiltration vessel for ultrafiltration concentration to 0.6~0.65g / L. Subsequently, the concentrated enzyme solution was washed and purified with 0.1M PBS buffer (pH 8.0) until the washing solution was colorless. The resulting enzyme solution was incubated at 40℃, 50℃, 60℃, 70℃, and 80℃ for 60 min, respectively.
[0083] Esterification reaction system: Add 20g oleic acid, 3.3mL methanol, and 2mL enzyme solution with a concentration of 0.6~0.65g / L to a 100mL sealable reaction flask and react at 40℃ and 200r / min for 24h. Pipette 1~2mL of the obtained reaction product into a centrifuge tube and centrifuge at 12000r / min to separate the oil and water phases.
[0084] Phenolphthalein indicator titration: Weigh 0.12 ± 0.01 g of the upper oil phase into a 100 mL Erlenmeyer flask, add 20–30 mL of ethanol, and use 0.05 mol / L NaOH as the standard solution. Calculate the acid value of the mixture at time zero and at the end of the reaction using phenolphthalein indicator titration. AV .
[0085] AV = ; Where V: the volume of NaOH solution used in the titration; C The concentration of the NaOH solution used in the titration; M NaOH : Relative molecular mass of NaOH; m: Mass of the sample taken before titration.
[0086] The calculation is based on: Specific esterification rate = (1 - ) / c×100%, calculate the specific esterification rate, and the specific esterification rate result is as follows: Figure 5As shown, the esterification rate is the result after comprehensively considering the enzyme concentration of the crude enzyme solution of each mutant; the enzyme activity at this point can be expressed as the esterification rate.
[0087] With improved thermostability of all mutants, after incubation at 40℃ for 60 min, the esterification ratios of A282Y, A282M, Q231F, A89K, A275M, A275L, I255P, and V236I were 1.78, 1.05, 1.05, 1.84, 1.01, 1.12, 1.25, and 1.15 times that of the wild type, respectively.
[0088] Furthermore, with the enzyme activity of the unincubated esterase solution as 100%, after incubation at 60°C for 60 min, the esterase activity retention rates of A282Y, A282M, Q231F, A89K, A275M, A275L, I255P, and V236I were 41%, 78%, 57%, 40%, 71%, 48%, 51%, and 73%, respectively, some of which were significantly higher than the wild-type enzyme activity retention rate of 60%. The remaining mutant esterase activity retention rates did not improve significantly, and some even decreased.
[0089] Example 9: Hydrolytic enzyme activity assay.
[0090] Enzyme pretreatment: The fermentation broth was concentrated by ultrafiltration in a 10kD ultrafiltration vessel to a concentration of 0.6–0.65 g / L. The concentrated enzyme solution was then washed and purified with 0.1M PBS buffer (pH 8.0) until the wash solution was colorless. The resulting enzyme solution was incubated at 40°C, 50°C, 60°C, 70°C, and 80°C for 60 min, respectively.
[0091] Dissolve 20g of polyvinyl alcohol (PVA) in 800mL of deionized water, mix thoroughly, boil until clear and transparent, and dilute to 1L. Filter through gauze and cool to obtain a 2% PVA solution. Mix olive oil and PVA solution in a 1:3 volume ratio and vortex until homogeneous as the reaction substrate. Heat the enzyme solution at 40-80℃ for 60min. Set up three replicates for both the reaction group and the control group. For the control group, add 1mL of the heat-treated enzyme solution first, then add 20mL of ethanol to terminate the activity. For the reaction group, add 1mL of the heat-treated enzyme solution and react in a 40℃ water bath for 10min, then add 20mL of ethanol to terminate the reaction. Titrate with 0.05mol / L NaOH solution using phenolphthalein indicator until a faint pink endpoint is reached. Record the data and calculate the enzyme activity of the supernatant. X .
[0092] X=(V1-V2)×C1×50×n / 0.05 / 10 Wherein, V1 and V2 are the consumption of sodium hydroxide standard solution for titrating the sample (blank / reaction shake flask); C1Concentration of sodium hydroxide standard solution; n This refers to the dilution factor of the fermentation supernatant. One unit of enzyme activity (U) is defined as: at 40°C and pH 7.5, 1 mL of liquid enzyme hydrolyzes the substrate to produce 1 μmol of titratable fatty acid in 1 min, which is 1 unit of enzyme activity, expressed as (U / ml).
[0093] The final results of the specific activity determination are as follows: Figure 6 .
[0094] After incubation at 40℃ for 60 min, the hydrolytic enzyme activities of mutants A282Y, A282M, Q231F, A89K, A275M, A275L, I255P, and V236I were 0.50, 0.26, 0.61, 0.45, 0.40, 0.38, 0.62, and 0.46 times that of the wild type, respectively. Using the unincubated enzyme solution as 100% enzyme activity, after incubation at 60℃ for 60 min, the hydrolytic enzyme activity retention rates of each mutant were 68.18%, 40.00%, 55.00%, 66.67%, 64.00%, 51.99%, 61.97%, and 74.19%, respectively, significantly higher than the wild-type enzyme activity retention rate of 23.72%. Although the hydrolytic enzyme activity of the mutants decreased, their hydrolytic enzyme activity retention rates were significantly better than those of the wild type.
[0095] Example 10 Synthesis of DHA glycerides.
[0096] The DHA glycerol ester synthesis reaction system: DHA fatty acids, glycerol, and esterification enzymes were added to a 250 mL sealable reactor and reacted for 24 h at the optimal reaction temperature of each enzyme, 250 r / min, and a vacuum of -0.09 MPa. 2-3 mL of the resulting reaction product was pipetted into centrifuge tubes, and the acid value after the reaction was measured. The experiment was conducted according to different groups of esterification enzymes, with three parallel experiments per group. The esterification enzymes used were the CLAB mutants A282Y, Q231F, A89K, I255P, and V236I obtained in Example 6, with wild-type CLAB as a control. The reaction efficiency and catalytic efficiency were calculated. The reaction efficiency was calculated as (1 - acid value after reaction / acid value before reaction) * 100%. The results are shown in Table 12.
[0097]
[0098]
[0099] Therefore, the A282Y mutant protein exhibits the highest catalytic efficiency, 4.5 times that of the wild type, while the catalytic efficiency of the other mutants is also more than twice that of the wild type. All mutant proteins demonstrate superior catalytic efficiency compared to the wild type. When the CLAB mutant of this invention is used to catalyze the synthesis of docosahexaenoic acid (DHA) glycerol, it exhibits higher catalytic efficiency, effectively increasing the yield of DHA glycerol.
[0100] The above description, in conjunction with specific preferred embodiments, provides a further detailed explanation of the present invention. However, it should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, various simple deductions or substitutions can be made without departing from the concept of the present invention, and all such modifications and substitutions should be considered within the scope of protection of the present invention.
Claims
1. A mutant of Candida antarcticis lipase B, characterized in that, The amino acid sequence of the *Candida antarcticis* lipase B mutant is based on the amino acid sequence of the parent *Candida antarcticis* lipase B, including one or more of the following mutations from the N-terminus to the C-terminus: Ala and Tyr at position 282, Ala and Met at position 282, Gln and Phe at position 231, Ala and Lys at position 89, Ala and Met at position 275, Ala and Leu at position 275, Ile and Pro at position 255, and Val and Ile at position 236. The amino acid sequence of the parent *Candida antarcticis* lipase B is shown in SEQ ID NO.
1.
2. The *Candida antarcticis* lipase B mutant according to claim 1, characterized in that, The amino acid sequence of the Candida antarcticis lipase B mutant is shown in any one of SEQ ID NO.2 to SEQ ID NO.
9.
3. The Candida antarcticis lipase B mutant according to claim 1, characterized in that, The method for preparing the Antarctic Candida lipase B mutant includes the following steps: S1. The recombinant microorganism containing the nucleotide sequence encoding the Candida antarcticis lipase B mutant is inoculated into the culture medium for fermentation culture until the OD600 value of the fermentation broth reaches 2-5, and the seed liquid is obtained. S2. The seed culture is added to the fermentation medium for fermentation and expression culture, and then glycerol is added for induced fermentation culture. S3. After fermentation, centrifuge and collect the supernatant to obtain an enzyme solution containing the Candida antarcticis lipase B mutant.
4. The *Candida antarcticis* lipase B mutant according to claim 3, characterized in that, In step S1, the culture medium is YPD medium, and the fermentation temperature is 30℃.
5. The *Candida antarcticis* lipase B mutant according to claim 3, characterized in that, Step S2 includes fermentation expression culture for 1-2 days, followed by induction with glycerol and continued induction fermentation culture for 2-3 days.
6. The *Candida antarcticis* lipase B mutant according to claim 3, characterized in that, The temperature for the fermentation expression culture and the induced fermentation culture in step S2 is 30°C.
7. A gene encoding an Antarctic Candida lipase B mutant as described in any one of claims 1 to 6, characterized in that, The nucleotide sequence of the encoding gene is shown in any one of SEQ ID NO.11 to SEQ ID NO.
18. Alternatively, the coding region of the gene may include a nucleotide sequence as shown in any one of SEQ ID NO.11 to SEQ ID NO.
18.
8. A recombinant vector, characterized in that, The recombinant vector includes the encoding gene of the Candida antarcticis lipase B mutant as described in claim 7.
9. A recombinant microorganism, characterized in that, The recombinant microorganism includes the encoding gene of the Candida antarcticis lipase B mutant as described in claim 7.
10. The use of the Candida antarcticis lipase B mutant as described in any one of claims 1 to 6 or the Candida antarcticis lipase B mutant as described in claim 7 in the catalytic synthesis of DHA glycerides.