AGT gene targeting gRNA and application thereof

Abstract

The invention provides gRNA (guide Ribonucleic Acid) of a targeted AGT gene and application of the gRNA. The AGT gene comprises a human-derived AGT gene and a rat-derived AGT gene; wherein the sequence of the gRNA of the targeted human AGT gene is selected from any one of the following sequences: SEQ ID NOs: 64-105; the gRNA sequence of the AGT gene of the targeted rat source is selected from any one of the following sequences: SEQ ID NOs: 1-63. The gRNA can reduce the expression of the human / rat AGT gene through a CRISPR-Cas (clustered regularly interspaced short palindromic repeats-associated proteins) gene editing system. The gRNA is used for preparing medicines for treating hypertension or diseases (such as hypertensive heart disease, coronary heart disease, cerebral apoplexy, hypertensive nephropathy and hypertensive retinopathy) caused by hypertension, and has the advantages of lasting and stable curative effect, small adverse reaction, low treatment frequency, good patient compliance and low long-term treatment cost.

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, and more specifically, to a gRNA targeting the AGT gene and its application. Background Technology

[0002] Hypertension is a significant public health problem worldwide, especially given the rising incidence of cardiovascular disease and chronic kidney disease. Globally, an estimated 1.13 billion people are affected, and this number is projected to increase by 15% to 20% by 2025. More than 60% of people aged 60 and older have hypertension, making it a leading cause of cardiovascular disease and premature death globally. The prevalence of hypertension increases with age. Studies have shown that a 10 mmHg reduction in systolic blood pressure or a 5 mmHg reduction in diastolic blood pressure can reduce the relative risk of cardiovascular events by 20%. Therefore, controlling blood pressure to reduce the incidence and mortality of cardiovascular disease and minimize end-organ damage is the goal of antihypertensive treatment.

[0003] Currently, despite the availability of various antihypertensive drugs, sustained blood pressure control in patients still faces numerous obstacles, including poor treatment adherence, the need for multidrug combination therapy, difficulty in maintaining a healthy lifestyle, and economic burden. Furthermore, over 10% of hypertensive patients develop drug resistance to existing medications, which is related to imprecise regulation of the renin-angiotensin system and compensatory mechanisms following inhibition of a single pathway. This system plays a crucial role in long-term blood pressure control and is a primary target for antihypertensive therapy.

[0004] The AGT gene encodes angiotensinogen, a glycoprotein secreted by hepatocytes. Angiotensinogen is cleaved by renin to produce angiotensin I, which is further cleaved to produce angiotensin II. Angiotensinogen is the rate-limiting factor in the production of angiotensin II. Studies have shown that a higher copy number of the angiotensinogen gene is associated with higher blood pressure; plasma angiotensinogen levels are correlated with blood pressure in hypertensive patients; therefore, inhibiting angiotensinogen (the most immediate component of the renin-angiotensin system) is an ideal method for lowering blood pressure.

[0005] The rise of CRISPR-Cas9 base editing technology has provided a new pathway for gene therapy of cardiovascular diseases, especially in the precise editing of the AGT gene. However, current technologies lack highly efficient gRNAs that target the AGT gene to induce base editing, which limits the application of gene editing in gene therapy for cardiovascular diseases. Therefore, it is necessary to address these issues by screening for a gRNA that targets the AGT gene and using it in CRISPR gene editing therapy. This would allow for sustained and stable therapeutic effects through gene-level manipulation, reducing adverse reactions caused by long-term administration, simplifying treatment methods, and lowering the cost of long-term treatment. Summary of the Invention

[0006] The main objective of this invention is to provide a gRNA targeting the AGT gene and its application, in order to solve the problem of the inability to maintain blood pressure control in hypertensive patients in the prior art.

[0007] To achieve the above objectives, according to a first aspect of the present invention, a gRNA targeting an AGT gene is provided, the AGT gene comprising a human AGT gene and a rat AGT gene; the sequence of the gRNA targeting the human AGT gene is selected from any one of the following: SEQ ID NOs: 64-105; the sequence of the gRNA targeting the rat AGT gene is selected from any one of the following: SEQ ID NOs: 1-63.

[0008] To achieve the above objectives, according to a second aspect of the present invention, a gRNA expression vector for targeted editing of the AGT gene is provided, the gRNA expression vector comprising a nucleotide sequence encoding the aforementioned gRNA.

[0009] To achieve the above objectives, according to a third aspect of the present invention, a CRISPR base editing system for targeted editing of the AGT gene is provided, the CRISPR base editing system comprising the aforementioned gRNA.

[0010] To achieve the above objectives, according to a fourth aspect of the present invention, a composition for targeted editing of the AGT gene is provided, the composition comprising: a gRNA system and a CRISPR base editing system; wherein the gRNA system is selected from any one or more of the following: the gRNA described above, or a nucleic acid encoding the gRNA described above, or the gRNA expression vector described above.

[0011] Furthermore, the aforementioned CRISPR base editing system includes: i) a Cas enzyme or a nucleic acid encoding the aforementioned Cas enzyme, and ii) a base deaminase or a nucleic acid encoding the aforementioned base deaminase.

[0012] Further, the above-mentioned base deaminase is selected from any one or more of the following: adenosine deaminase or cytidine deaminase; preferably, the above-mentioned Cas enzyme is selected from any one or more of the following: SpCas9, SaCas9, Nme2Cas9, Nme3Cas9, CjCas9, NmCas9, FnCas9, slugcas9 or SpeCas9.

[0013] To achieve the above objectives, according to a fifth aspect of the present invention, an adeno-associated virus (AAV) targeting the AGT gene is provided, the AAV targeting the AGT gene comprising an active ingredient and an AAV vector loaded with the active ingredient, wherein the active ingredient comprises the aforementioned gRNA, or the aforementioned gRNA expression vector, or the aforementioned CRISPR base editing system, or the aforementioned composition.

[0014] To achieve the above objectives, according to a sixth aspect of the present invention, an LNP targeting the AGT gene is provided, the LNP targeting the AGT gene comprising an active component and a lipid carrier loading the active component, wherein the active component comprises the above-described gRNA, or the above-described gRNA expression vector, or the above-described CRISPR base editing system, or the above-described composition.

[0015] To achieve the above objectives, according to a seventh aspect of the present invention, the use of the above-described gRNA, the above-described gRNA expression vector, the above-described CRISPR base editing system, the above-described composition, the above-described adeno-associated virus targeting the AGT gene, or the above-described LNP targeting the AGT gene in the preparation of a medicament for treating hypertension or secondary lesions caused by hypertension is provided.

[0016] Furthermore, the aforementioned hypertension includes primary hypertension and secondary hypertension; preferably, the secondary lesions caused by the aforementioned hypertension include hypertensive heart disease, coronary heart disease, stroke, hypertensive nephropathy, hypertensive retinopathy, arteriosclerosis, heart failure, or sexual dysfunction; preferably, the aforementioned drug includes a preparation administered intravenously.

[0017] By applying the technical solution of this invention and utilizing the above-mentioned gRNA targeting the AGT gene, precise binding to the AGT gene can be achieved, improving the efficiency of subsequent gene editing, increasing specificity and gene editing accuracy, and greatly increasing the potential for drug development. Attached Figure Description

[0018] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0019] Figure 1 A gene editing diagram of gRNA and SpRY-ABE8 base editor targeting rat-derived AGT gene or human-derived AGT gene according to Example 1 of the present invention is shown; Figure 1 The A in the diagram represents a gRNA targeting the rat AGT gene; Figure 1In the sequence B, the editing efficiency of gRNA targeting the rat AGT gene in BRL cells is indicated; the sequences of gRNA1, gRNA2, and gRNA3 are shown in SEQ ID NO: 38, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 7, SEQ ID NO: 9, and SEQ ID NO: 10. Figure 1 In the diagram, C represents the sequencing data of the AGT gene in rat hepatocytes (BRL) after editing with rat-derived gRNA2 (SEQ ID NO: 37); Figure 1 The "D" in the diagram represents a gRNA targeting the human AGT gene. Figure 1 The letter E indicates the editing efficiency of gRNA targeting the human AGT gene in 293T cells; wherein, the sequence of gRNA1 is shown in SEQ ID NO: 64, the sequence of gRNA2 is shown in SEQ ID NO: 66, the sequence of gRNA3 is shown in SEQ ID NO: 67, the sequence of gRNA4 is shown in SEQ ID NO: 90, the sequence of gRNA5 is shown in SEQ ID NO: 97, the sequence of gRNA6 is shown in SEQ ID NO: 85, the sequence of gRNA7 is shown in SEQ ID NO: 76, and the sequence of gRNA8 is shown in SEQ ID NO: 79. Figure 1 In the diagram, F represents the sequencing data of the AGT gene in humanized hepatocellular carcinoma cells (HepG2) after editing with human gRNA1 (SEQ ID NO: 64).

[0020] Figure 2 The following are examples of protein expression of the rat-derived AGT gene in rat hepatocytes (BRL) and rat cardiomyocytes (H9C2) after combined editing with gRNA and the ABE system (SpRYCas9-ABE8e) according to Example 1 of the present invention, as well as protein expression of the human-derived AGT gene in humanized hepatocellular carcinoma cells (HepG2). Figure 2 In this context, A represents rat hepatocytes; Figure 2 In this context, B represents rat cardiomyocytes; Figure 2 In this context, C represents humanized liver cancer cells.

[0021] Figure 3 This demonstrates the in vivo editability of AAV-encapsulated gRNA and SpRYCas9-ABE8e according to Embodiment 2 of the present invention. Figure 3 In the figure, A and B represent the in vivo editing efficiency of liver tissue in two rats after tail vein injection of AAV (31% and 24%, respectively).

[0022] Figure 4Organ targeting and dose dependence of LNP in vivo delivery of gRNA and SpRYCas9-ABE8e in rats according to Embodiment 2 of the present invention are shown.

[0023] Figure 5 The intervention treatment according to Example 2 of the present invention has a long-term blood pressure control effect (lasting 20+ weeks) on SHR rats. Figure 5 In this diagram, A represents the experimental design schematic. Figure 5 In this context, B represents the blood pressure measurement of male SHRs after LNP-coated rat-derived gRNA2 (SEQ ID NO: 37) and SpRYCas9-ABE8e were delivered to them. Figure 5 In this context, C represents the blood pressure measurement of female SHRs after LNP-coated rat-derived gRNA2 (SEQ ID NO: 37) and SpRYCas9-ABE8e were delivered to them. Figure 5 D, E, and F in the figure represent the long-term effects of LNP-coated rat-derived gRNA2 (SEQ ID NO: 37) and SpRYCas9-ABE8e on serum AGT, ANGⅠ, and ANGⅡ, respectively.

[0024] Figure 6 This diagram illustrates the effect of SpRYCas9-ABE8e and rat-derived gRNA2 (SEQ ID NO: 37) on hypertensive cardiac injury in SHR rats after interventional treatment according to Example 2 of the present invention. Figure 6 In the figure, A represents the representative images of the three groups (WKY group, SHR group and SHR-LNP group) after 16 weeks of LNP treatment using M-mode echocardiography, HE staining, WGA staining, Masson staining and Oil Red staining. Figure 6 In this context, B represents the ratio of heart weight to body weight (HW / BW) in each group after 16 weeks of LNP treatment. Figure 6 In this context, C represents the left ventricular shortening fraction (FS%) in each group after 16 weeks of LNP treatment. Figure 6 In this context, D represents the diastolic interventricular septal thickness (IVSd) in each group 16 weeks after LNP treatment. Figure 6 In this context, E represents the diastolic posterior wall thickness of the left ventricle (LVPWd) in each group after 16 weeks of LNP treatment. Figure 6 In this context, F represents the left ventricular diastolic diameter (LVIDd) in each group after 16 weeks of LNP treatment. Figure 6 In this context, G represents the ascending aortic diameter (AOD) of each group 16 weeks after LNP treatment.

[0025] Figure 7The illustration shows the renal function test of SHR rats after intervention treatment according to Example 2 of the present invention, to evaluate the improvement of hypertensive kidney by SpRYCas9-ABE8e and rat-derived gRNA2 (SEQ ID NO: 37); A in 7 represents hematoxylin-eosin (H&E) staining of the kidney; Figure 7 In this text, B indicates oil red staining of the kidney; Figure 7 In this text, C represents the Marson trichrome staining of the kidney. Figure 7 In the diagram, D represents periodic acid Schiff (PAS) staining of the kidney; the scale bars are 500 μm (H&E), 200 μm (Sirius Red), 5000 μm (Mason), and 500 μm (PAS). Figure 7 In this context, E represents the ratio of kidney mass to body weight (KW / BW) in each group (WKY group, SHR group, and SHR-LNP group) after 16 weeks of LNP treatment. Figure 7 In this context, F represents the estimated glomerular filtration rate (eGFR) in each group after 16 weeks of LNP treatment. Figure 7 In this context, G represents the serum creatinine level (CREA-S) in each group after 16 weeks of LNP treatment. Figure 7 In this context, H represents the difference in renal blood urea nitrogen (UREA) among the groups after 16 weeks of LNP treatment.

[0026] Figure 8 This illustrates that, according to Example 2 of the present invention, after interventional treatment, rats were euthanized at the observation endpoint, and samples were collected for DNA sequencing and protein detection to evaluate the in vivo targeting of SpRYCas9-ABE8e and rat-derived gRNA2 (SEQ ID NO: 37). Figure 8 In this context, A represents the editing status of different organs after treatment; Figure 8 B and C in the figure represent the expression of AGT gene in different organs after treatment.

[0027] Figure 9 A schematic diagram illustrating the editing capability of gRNA on the humanized AGT gene in Rosa26-hAGT mice according to Example 3 of the present invention is shown. Figure 9 In this diagram, A represents the experimental design in Rosa26-hAGT mice; Figure 9 In this context, B represents the editing efficiency and organ specificity of LNP delivery of human gRNA1 (SEQ ID NO: 64)-SpRYCas9-ABE8e; Figure 9 In this context, C represents the effect of LNP delivery of human gRNA1 (SEQ ID NO: 64)-SpRYCas9-ABE8e on the expression of AGT protein in mouse liver; Figure 9The "D" in the diagram represents a quantitative illustration of the effect of LNP delivery of human gRNA1 (SEQ ID NO: 64)-SpRYCas9-ABE8e on the expression of AGT protein in the liver of mice. Figure 9 The "E" in the figure represents the ELISA results of LNP delivery of human gRNA1 (SEQ ID NO: 64)-SpRYCas9-ABE8e to detect human AGT in mouse serum.

[0028] Figure 10 The following describes the long-term blood pressure monitoring (continuous observation for 8+ weeks) of Rosa26-hAGT mice after intervention treatment according to Example 3 of the present invention. Figure 10 In this context, A indicates the effect of LNP delivery of human gRNA1 (SEQ ID NO: 64)-SpRYCas9-ABE8e on systolic blood pressure (SBP) in mice; Figure 10 In this context, B indicates the effect of LNP delivery of human gRNA1 (SEQ ID NO: 64)-SpRYCas9-ABE8e on diastolic blood pressure (DBP) in mice; Figure 10 In this context, C indicates the effect of LNP delivery of human gRNA1 (SEQ ID NO: 64)-SpRYCas9-ABE8e on relative mean arterial pressure (ΔMBP) in mice.

[0029] Figure 11 The liver damage and inflammation changes of human gRNA1 (SEQ ID NO: 64)-SpRYCas9-ABE8e delivered by LNP according to Example 3 of the present invention were observed one day after the procedure in Rosa26-hAGT mice; Figure 11 In this context, A represents the expression of aspartate aminotransferase (AST) in each group (B6-Rosa26-hAGT and B6-Rosa26-hAGT-LNP) one day after LNP injection. Figure 11 B in the figure indicates the expression of alanine aminotransferase (ALT) in each group one day after LNP injection. Figure 11 In the figure, C indicates the expression of IL-1β (Interleukin-1 beta) in each group one day after LNP injection.

[0030] Figure 12 The off-target detection of rat-derived gRNA2 (SEQ ID NO: 37)-SpRYCas9-ABE8e in SHR rats according to an embodiment of the present invention is shown. Figure 12 Bases in the yellow background indicate bases that are different from those in sgRNA2 (SEQ ID NO: 37); Figure 12 In this context, A represents the target sequence and the top 8 predicted off-target sequences; Figure 12In this context, B represents the proportion of each target sequence detected and the predicted off-target sequences through deep sequencing. Detailed Implementation

[0031] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will now be described in detail with reference to the embodiments.

[0032] Terminology Explanation:

[0033] Base editors are gene editing tools that can directly and precisely replace single bases without cutting the DNA double strand. They typically consist of a CRISPR-Cas protein (such as nCas9, responsible for targeting) that has lost its cutting activity and an enzyme that catalyzes the base chemical reaction (such as a deaminase, responsible for editing). The main types include: 1) Cytosine base editors (CBE base editors): converting C·G base pairs on DNA to T·A base pairs; 2) Adenine base editors (ABE base editors): converting A·T base pairs on DNA to G·C base pairs. Compared to traditional gene editing technologies, base editors are characterized by high precision, high efficiency, and good safety because they avoid the risk of random mutations caused by DNA double-strand breaks. Base editors are mainly used in gene therapy (correcting point mutations that cause genetic diseases), basic scientific research, and crop breeding.

[0034] CRISPR-ABE base editor: A genome editing tool that can directly convert a specific single base A (adenine) to G (guanine), or T (thymine) to C (cytosine) on a DNA sequence without cutting the DNA double strand. It combines the precise targeting capabilities of the CRISPR system with the function of artificially designed base deaminases, making it a powerful technology for achieving precise single-base editing.

[0035] ABE is mainly composed of three fused parts: 1) A catalytically deficient Cas9 protein: This is the "navigation head" of the CRISPR system. It is genetically engineered so that its DNA-cutting activity is "abolished," thus it does not cut the DNA double strand. However, it can still precisely bind to the target DNA sequence under the guidance of guide RNA and bring other functional domains to the designated location. 2) Adenine deaminase: This is the "executor" of the editing function. It can specifically catalyze chemical changes on adenine. 3) Guide RNA: Like the CRISPR-Cas9 system, this is an artificially designed RNA sequence that acts like "GPS coordinates," precisely guiding the entire ABE complex to the specific location on the genome that needs editing.

[0036] The working principle of ABE includes: 1) Targeted localization: Guide RNA guides the nCas9-deaminase fusion protein to bind to the target DNA site. dCas9 causes local unwinding of the DNA double strand, exposing a single-stranded DNA (called the "R-loop" region). 2) Chemical transformation (core step): The adenine deaminase fused to nCas9 acts on specific adenine on this single-stranded DNA, directly deaminating it and converting it into a molecule called hypoxanthine. 3) Cellular misreading and repair: During subsequent cellular DNA replication or repair, the cell's DNA polymerase recognizes hypoxanthine as guanine. Therefore, it pairs with it on the complementary strand, introducing a cytosine. 4) Base conversion: Ultimately, the original AT base pair is permanently and efficiently replaced with a GC base pair.

[0037] The CRISPR-CBE base editor is an innovative genome editing tool that can directly convert a specific single base C (cytosine) to T (thymine) or G (guanine) to A (adenine) in a DNA sequence without cutting the DNA double strand. It was among the first successful technologies to achieve precise single-base editing and, complementing ABE, forms the core of base editing technology.

[0038] CBE mainly consists of three parts: 1) Catalytically defective Cas9 protein: Usually, a nicking enzyme version of Cas9 is used, which can only cut the DNA strand containing the target base without causing double-strand breaks. Its main function is to act as a "navigation head," precisely delivering the entire editor to the target site on the genome under the guidance of guide RNA. 2) Cytosine deaminase: This is the "executor" of the editing function. It can specifically catalyze chemical changes on cytosine. The initially commonly used version is the APOBEC1 enzyme derived from rats. 3) Uracil glycosylase inhibitor: This is a key safety component used to improve editing efficiency and reduce unwanted byproducts.

[0039] The working principle of CBE includes: 1) Targeting and unwinding: gRNA guides the CBE complex to bind to the target DNA site. nCas9 locally unwinds the DNA, exposing a single-stranded DNA "editing window" of about 5 nucleotides. 2) Chemical transformation (core step): Cytosine deaminase on the fusion protein acts on cytosine within the editing window, directly deaminating it to uracil. In DNA, uracil is not a normal base and will be recognized as an error by the cell. 3) Uracil processing and strand cleavage: The UGI component inhibits intracellular uracil glycosylase, preventing it from removing uracil to initiate error-prone repair pathways, thus ensuring that uracil is preserved; nCas9 creates a "cut" on the non-editing strand, which misleads the cell into thinking that a strand containing uracil is needed for repair. 4) Cellular repair and base conversion: During DNA replication or repair, the cell's DNA polymerase recognizes uracil on the template strand as thymine and introduces an adenine on its complementary strand accordingly. 5) Final result: In the end, the original CG base pairs were permanently and efficiently replaced with TA base pairs.

[0040] Base editing system: A precision gene editing tool developed based on CRISPR technology. This system consists of guide RNA (gRNA) and a base editor (a modified Cas protein fusion protein with a deaminase). It can achieve efficient and precise conversion of specific bases (such as C→T or A→G) without breaking the DNA double strand. Its core advantage lies in its single-base-level editing capability, avoiding DNA double-strand breaks caused by traditional gene editing. It has broad application prospects in fields such as genetic disease treatment, gene function research, and crop breeding.

[0041] dCas9, short for inactivated Cas9, is a core component of the CRISPR-Cas9 system that has been genetically engineered to lose its DNA-cutting activity but retain its DNA-binding ability. Its core mechanism involves site-directed mutations (such as the D10A and H840A mutations in Streptococcus pyogenes SpCas9) to inactivate its two catalytic domains, thus preventing it from cleaving double-stranded DNA. However, dCas9 can still precisely locate and bind to specific genomic sequences under the guidance of guide RNA.

[0042] dCas9 itself does not edit gene sequences, but rather acts as a "programmable molecular platform" that achieves various regulatory functions by fusing with other functional domains. Its main applications include: 1) gene expression regulation: binding to gene promoter regions to physically inhibit transcription and achieve gene knockdown; 2) epigenetic editing: fusing activation / repression domains to precisely regulate the on and off of genes; 3) base editing: fusing with deaminases as a scaffold to achieve precise single-base replacement; and 4) genome imaging: labeling fluorescent proteins for real-time observation of genomic sites in living cells.

[0043] nCas9: The full name is Cas9, a genetically engineered CRISPR-Cas9 variant that can only cleave one strand of a DNA double helix. Its core characteristic is that by site-directed mutation (such as the D10A mutation against Streptococcus pyogenes SpCas9), one of its catalytic domains (usually RuvC) is inactivated, thus losing the ability to cleave the double helix, but the other domain (HNH) remains active, which can create a "single-strand break" or "nick" at the target site.

[0044] The main value and application of nCas9 lies in its unique mechanism of action: 1) Improved editing safety: Compared with traditional Cas9, which causes double-strand breaks, single-strand cuts can be repaired more reliably by the cell's high-fidelity repair mechanism, significantly reducing side effects such as chromosomal translocation and large fragment deletions caused by DNA double-strand breaks; 2) Core component of base editors: It is key to constructing cytosine base editors (CBE) and adenine base editors (ABE). The single-strand cuts generated by nCas9 at the target site can both promote cell repair using the edited strand to improve editing efficiency and avoid the risk of double-strand breaks; 3) Mediating homologous recombination: When an exogenous DNA repair template is provided, relatively controllable single-strand cuts can also initiate homologous targeted repair (HDR) pathways to a certain extent, achieving precise gene insertion or replacement.

[0045] The pCMV-T7-ABE8e-nSpRY-P2A-EGFP (KAC1069) plasmid is a mammalian cell expression plasmid whose core function is to express an adenine base editor (ABE). This editor can efficiently convert AT base pairs on genomic DNA into GC base pairs without cutting the DNA double strand. Other components on the plasmid are responsible for controlling its expression, localization, and tracking.

[0046] CBEmax plasmid: A plasmid expressing the CBEmax editor for cell transfection, enabling C-to-T base substitution.

[0047] The slugCas9-HF-ABE8e plasmid is a combination of slugCas9 (an optimized version of Cas9) and ABE8e. SlugCas9 reduces off-target effects and increases editing specificity, while HF (High Fidelity) further enhances the fidelity of Cas9 and reduces non-specific splicing. It is used for cell transfection to express the high-fidelity Cas9-ABE8e complex, enabling A-to-G base editing while minimizing off-target effects.

[0048] The AG-GT sequence is a key sequence in the splicing mechanism of pre-mRNA in eukaryotes, located at the junction of exons and introns. Targeting and editing this sequence can interfere with the normal splicing process, causing exon skipping or altering the splicing pattern, thereby affecting the structure of the final mRNA and the sequence of the protein it encodes.

[0049] Stop codon introduction: In gene editing, stop codon introduction refers to the precise editing (e.g., using a CRISPR-Cas9 base editor) of the coding region of a gene to replace the amino acid-coding codons CGA (Arg), CAG (Gln), and CAA (Gln) with stop codons TGA, TAG, and TAA, or to change TGG (Trp) to TGA, TAG, and TAA, thereby achieving gene knockout. Stop codons act as signaling molecules during protein synthesis, indicating where translation should stop. Therefore, introducing a stop codon prematurely terminates protein synthesis, resulting in truncated or non-functional protein products.

[0050] SBP, DBP, and ΔMBP: Three abbreviations commonly used in blood pressure measurement and cardiovascular health assessment. SBP (Systolic Blood Pressure) is the higher value of blood pressure reading, reflecting the maximum pressure exerted by blood against the blood vessel walls when the heart contracts and pumps blood. DBP (Diastolic Blood Pressure) is the lower value of blood pressure reading, representing the minimum pressure exerted by blood against the blood vessel walls when the heart relaxes between heartbeats. ΔMBP (Change in Mean Blood Pressure) is the change in mean arterial pressure. MBP is short for mean arterial pressure, calculated by averaging blood pressure over a cardiac cycle, usually estimated using the formula MBP = DBP + 1 / 3(SBP - DBP). ΔMBP refers to the difference in MBP measured between groups compared to the control group.

[0051] HW / BW (Heart Weight to Body Weight Ratio): The ratio of heart weight to body weight. This is an indicator of whether the heart is enlarged and is often used in the study of cardiovascular disease, especially cardiac remodeling caused by hypertension. An elevated ratio may indicate cardiac enlargement or heart disease.

[0052] Fractional Shortening (FS): The fractional shortening is the ratio of the thickness change between the anterior and posterior walls of the left ventricle during cardiac contraction. It is an indicator of cardiac function and is commonly used to measure cardiac contractility. A high FS value indicates good cardiac pumping efficiency.

[0053] IVSd (Interventricular Septum in Diastole): Diastolic septal thickness. This is the thickness of the interventricular septum between the left and right ventricles during diastole. It is used to assess whether the heart structure and interventricular septum are abnormally thickened, and is commonly seen in hypertension and myocardial hypertrophy.

[0054] LVPWd (Left Ventricular Posterior Wall in Diastole): Diastolic thickness of the left ventricular posterior wall. This refers to the thickness of the left ventricular posterior wall during diastole and is also used to assess cardiac structure and the presence of myocardial hypertrophy.

[0055] LVIDd (Left Ventricular Internal Diameter in Diastole): Diastolic diameter of the left ventricle. This refers to the diameter of the left ventricle when the heart is in diastole, and is used to assess cardiac volume and structure.

[0056] AOD (Aortic Opening Diameter): This measures the maximum size of the aortic valve opening during diastole, reflecting the structural condition of the aorta. Under normal circumstances, the aorta should maintain a certain degree of opening; an opening that is too large or too small may indicate a pathological condition in the heart or aortic valve.

[0057] KW / BW (Kidney Weight to Body Weight Ratio): The ratio of kidney weight to body weight. This ratio helps determine whether the kidneys are enlarged or shrunken, and is often used to study the progression of kidney disease and treatment outcomes. An abnormal KW / BW ratio may indicate the presence of kidney disease, such as nephritis, glomerulonephritis, or kidney fibrosis.

[0058] eCRF (estimated Creatinine Clearance Rate): Creatinine is a metabolic waste product primarily produced by muscles and excreted through the kidneys after filtration. eCRF is a kidney function indicator estimated using serum creatinine concentration and several clinical parameters (such as age, sex, and weight), reflecting the kidneys' excretory function. A low eCRF value may indicate impaired kidney function.

[0059] CREA-S (Serum Creatinine): Serum creatinine. This is an indicator that directly measures the concentration of creatinine in the blood and is one of the standards for assessing kidney function. Elevated serum creatinine levels usually indicate decreased kidney filtration function and may be related to renal insufficiency.

[0060] UREA (Blood Urea Nitrogen, BUN): Blood urea nitrogen. Urea is a waste product of protein breakdown and metabolism, primarily excreted through the kidneys. Blood urea nitrogen (BUN) levels reflect kidney excretion function and protein metabolism. Elevated BUN levels may indicate kidney disease, heart failure, liver disease, or dehydration.

[0061] AST (Aspartate Transaminase): Also known as glutamic-glutamyl transferase. AST is mainly found in hepatocytes, cardiomyocytes, and brain cells. When these tissues are damaged, AST is released into the bloodstream. Elevated levels of AST in the blood are commonly associated with hepatitis, hepatocellular damage, myocardial infarction, or brain injury. It is an important indicator for assessing liver health, especially in the diagnosis of hepatocellular damage.

[0062] ALT (Alanine Transaminase): Alanine aminotransferase, also known as alanine aminotransferase. ALT is mainly found in hepatocytes, with smaller amounts in other tissues such as the kidneys, myocardium, and skeletal muscle. Similar to AST, elevated ALT levels indicate hepatocyte damage, but ALT is more specific and usually rises earlier and more significantly in liver diseases than AST, such as acute hepatitis, cirrhosis, or fatty liver. Therefore, ALT is another important indicator of liver function.

[0063] IL-1β (Interleukin-1 beta): Interleukin-1β is an important inflammatory mediator. IL-1β is produced by various immune cells, such as macrophages and activated T cells, and increased levels are associated with a variety of acute or chronic inflammatory states, including infections, autoimmune diseases, cancer, and various tissue injuries. IL-1β testing is commonly used to assess the intensity and course of inflammatory responses, as well as to monitor the effectiveness of treatments for inflammatory diseases.

[0064] Bystander effect: This refers to the phenomenon that gene editing tools (such as CRISPR-Cas9) not only produce expected or unexpected edits to the target sequence when acting on it, but also cause unexpected edits or functional effects on the surrounding "bystander bases" that are not directly targeted.

[0065] As mentioned in the background section, existing technologies struggle to maintain sustained blood pressure control in hypertensive patients. In this invention, the inventors attempt to screen for a gRNA capable of efficiently, accurately, and safely editing the AGT gene. This gene-level manipulation reduces AGT protein expression, thereby effectively and stably lowering blood pressure in hypertensive patients. Therefore, the protection scheme of this invention is proposed.

[0066] The AGT gene encodes angiotensinogen, a glycoprotein secreted by hepatocytes. Angiotensinogen is cleaved by renin to produce angiotensin I, which is further cleaved to produce angiotensin II. Angiotensinogen is the rate-limiting factor in the production of angiotensin II. Studies have shown that a higher copy number of the angiotensinogen gene is associated with higher blood pressure; plasma angiotensinogen levels are correlated with blood pressure in hypertensive patients; therefore, reducing AGT gene expression may help lower blood pressure in hypertensive patients.

[0067] CRISPR gene editing is permanent, offering a "one-and-done" treatment. CRISPR gene editing therapy achieves lasting and stable efficacy through gene-level manipulation, reducing adverse reactions caused by long-term administration. It is also convenient and relatively less expensive for long-term treatment. Furthermore, compared to the CRISPR / Cas9 system, the base editing system offers advantages such as known mutation sites and avoidance of DNA double-strand breaks.

[0068] This application aims to design and apply a specific gRNA capable of efficiently targeting and editing the AGT gene, thereby regulating AGT gene expression and providing an innovative gene editing strategy for treating hypertension and its complications. The AGT gene includes, but is not limited to, human or rat AGT genes, and belongs to the field of gene editing technology. The aforementioned gRNA targets the human or rat AGT gene and, by combining with the CRISPR base editing system, can reduce AGT gene expression.

[0069] To obtain gRNA capable of targeting the AGT gene, the inventors investigated, examined, and experimentally verified the rat AGT gene sequence. They discovered that the rat AGT gene is located on chromosome 19, with the sequence: NC_086037.1(69426540..69447017, complement); variant 1 has 5 exons; variants 2 and 3 have 4 exons. The inventors first selected the CRISPR-ABE base editor to target mutations based on the AG at exon 5' and the GT at exon 3'. Based on the PAM region characteristics of ABE8E-SPRY, sequences shown in SEQ ID NO: 1 to SEQ ID NO: 39 were generated; based on the PAM region characteristics of CBE-MAX, sequences shown in SEQ ID NO: 40 to SEQ ID NO: 47 were generated; based on the PAM region characteristics of slugCas9-HF-ABE8e, sequences shown in SEQ ID NO: 48 to SEQ ID NO: 53 were generated; in addition, the introduction of the stop codon produced sequences shown in SEQ ID NO: 54 to SEQ ID NO: 63.

[0070] To obtain gRNA capable of targeting the AGT gene, the inventors investigated, examined, and experimentally verified the human AGT gene sequence. They discovered that the human AGT gene is located on chromosome 1, with the sequence: NC_000001.11(230702523..230745583, complement); variants 1 and 2 consist of 5 exons and 4 introns. The inventors first selected the CRISPR-ABE base editor to target the mutation based on the AG at exon 5' and the GT at 3'. Based on the PAM region characteristics of ABE8E-SPRY, sequences shown in SEQ ID NO: 64 to SEQ ID NO: 105 were generated.

[0071] In a first typical embodiment of the present invention, a gRNA targeting the AGT gene is provided, wherein the AGT gene includes a human AGT gene and a rat AGT gene.

[0072] The sequence of the gRNA targeting the above-mentioned human AGT gene is selected from any one of the following: SEQ ID NOs: 64~105;

[0073] The sequence of the gRNA targeting the rat-derived AGT gene is selected from any of the following: SEQ ID NOs: 1~63.

[0074] The gRNAs of the present invention include, but are not limited to, disrupting the function of the corresponding sequence through base substitution and thus downregulating AGT gene expression, or repairing the AGT gene through the NHEJ or HDR pathway after introducing double-strand breaks (DSBs) and thus downregulating its expression.

[0075] In a preferred embodiment of the present invention, the gRNA of the present invention can guide a CRISPR-ABE base editor or a CRISPR-CBE base editor to target the intron-exon linking region AG-GT of mutated AGT, thereby achieving exon skipping, thus affecting the formation and function of AGT protein and exerting a therapeutic effect of lowering blood pressure.

[0076] In another preferred embodiment of the present invention, the gRNA of the present invention can also guide the CRISPR-CBE base editor to replace the codons CGA (Arg), CAG (Gln), and CAA (Gln) encoding amino acids in the translation region of the gene that mutates AGT with the stop codons TGA, TAG, and TAA, or to change TGG (Trp) to TGA, TAG, and TAA, thereby achieving gene knockout, thereby affecting the formation and function of AGT protein and exerting a therapeutic effect of lowering blood pressure.

[0077] In a preferred embodiment of the present invention, the gRNA molecule of the present invention includes a region complementary to the AGT gene sequence. The gRNA molecule of the present invention can be chemically modified on any nucleotide.

[0078] In a preferred embodiment of the present invention, the sequence of the gRNA targeting the human AGT gene is selected from any one of the following: SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 90, SEQ ID NO: 97, SEQ ID NO: 85, SEQ ID NO: 76 or SEQ ID NO: 79; and the sequence of the gRNA targeting the rat AGT gene is selected from any one of the following: SEQ ID NO: 38, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 10.

[0079] In a more preferred embodiment of the present invention, the sequence of the gRNA targeting the human AGT gene is selected from SEQ ID NO: 64; the sequence of the gRNA targeting the rat AGT gene is selected from SEQ ID NO: 37. The gRNA can significantly improve the editing efficiency of the AGT gene, especially when targeting the AG-GT sequence in the intron-exon linking region and when gene knockout is achieved by changing codons.

[0080] In a second typical embodiment of the present invention, a gRNA expression vector for targeted editing of the AGT gene is provided, the gRNA expression vector containing a nucleotide sequence encoding the above-mentioned gRNA.

[0081] The aforementioned gRNA expression vector is a specially designed vector whose core function is to carry and express the nucleotide sequence encoding the gRNA. This vector not only carries the coding sequence of the gRNA but also ensures that the gRNA is expressed efficiently and stably in the target cell, thereby achieving precise targeted editing of the AGT gene.

[0082] In a preferred embodiment of the present invention, the above-mentioned gRNA expression vector delivery strategy is selected from any one of the following: plasmid, adeno-associated virus (AAV) vector, herpes simplex virus (HSV) vector, liposome nanoparticle (LNP), extracellular vesicle (EV) or mRNA vector.

[0083] In a more preferred embodiment of the present invention, the above-mentioned gRNA expression vector delivery strategy is selected from any one of the following: adeno-associated virus (AAV) vector or liposome nanoparticles (LNP).

[0084] Among them, AAV vectors are particularly suitable for in vivo gene editing due to their high transduction efficiency and long-term gene expression capacity. By binding to specific promoters, nucleic acids can be directly and specifically delivered to various cells and specific organs, achieving continuous AGT gene editing. For example, the AAV9 vector can deliver a base editing system initiated by the cTnT promoter to the heart; the AAV8 vector can deliver a base editing system initiated by the Tbg promoter to the liver; the AAV11 vector can deliver a base editing system initiated by the RIP promoter to the spleen; and the AAV8 vector can deliver a base editing system initiated by the KSPC promoter to the kidney. In a preferred embodiment of the present invention, the base editing system of this application initiated by the liver-specific promoter TBG, delivered using the AAV8 vector, can be directly delivered to the liver, achieving continuous AGT gene editing.

[0085] LNP vectors ensure that gene-editing components can be delivered to liver cells with high efficiency, high specificity, and low side effects (due to the liver-enriched nature of LNPs themselves), enabling precise editing of the AGT gene and reducing the adverse consequences of AGT inhibition in other tissues. This demonstrates significant clinical advantages in treating hypertension and its complications. LNPs not only improve the precision and safety of gene editing but also reduce treatment costs and enhance treatment sustainability. LNP delivery allows for multiple administrations, bringing blood pressure down to an ideal level.

[0086] After the vector is constructed, it undergoes strict quality control and purification steps to ensure its high purity and activity, thereby improving in vivo editing efficiency.

[0087] In a third typical embodiment of the present invention, a CRISPR base editing system for targeted editing of the AGT gene is provided, the CRISPR base editing system comprising the above-described gRNA.

[0088] Base editors in CRISPR base editing systems (such as nCas9+ base deaminases) can recognize and bind to AGT gene targets guided by gRNA, enabling the base deaminase to edit specific bases near the target site, thereby reducing the expression level of the AGT gene.

[0089] In a preferred embodiment of the present invention, the CRISPR base editing system includes a base editor; the base editor is selected from any one or more of the following: SpRYCas9-ABE8e, CBEmax, slugCas9-HF-ABE8E or SpeCas9-ABE8e.

[0090] The aforementioned base editing system can be applied to various vectors, such as AAV, LNP, or mRNA vectors, to achieve targeted delivery to specific organs or cell types. In the treatment of hypertension and its complications, by designing specific combinations of gRNA and CRISPR base editors, precise editing of the AGT gene can be achieved in vitro in liver or kidney cells, and in vivo in liver, kidney, and myocardial tissues. This facilitates precision medicine and overcomes the limitations of traditional treatment methods.

[0091] In a fourth typical embodiment of the present invention, a composition for targeted editing of the AGT gene is provided, the composition comprising: a gRNA system and a CRISPR base editing system; the gRNA system is selected from any one or more of the following: the gRNA described above, or a nucleic acid encoding the gRNA described above, or the gRNA expression vector described above.

[0092] The aforementioned gRNAs can be synthesized chemically or produced using conventional methods such as transcription in genetic engineering. For example, when the gRNA system includes nucleic acids encoding the aforementioned gRNAs or gRNA expression vectors, the gRNAs need to be obtained through techniques such as transcription.

[0093] In a preferred embodiment of the present invention, the CRISPR base editing system comprises: i) a Cas enzyme or a nucleic acid encoding the Cas enzyme, and ii) a base deaminase or a nucleic acid encoding the base deaminase.

[0094] In a preferred embodiment of the present invention, the Cas enzyme is selected from any or more of the following: SpCas9, SaCas9, Nme2Cas9, Nme3Cas9, CjCas9, NmCas9, FnCas9, slugcas9, or SpeCas9. It should be noted that the above Cas enzyme needs to be modified to nCas9 or dCas9 before it can be used in combination with a base deaminase.

[0095] In a preferred embodiment of the present invention, the above-mentioned base deaminase is selected from any one or more of the following: adenosine deaminase or cytidine deaminase.

[0096] The aforementioned Cas enzyme is either a purified Cas protein or indirectly produced through genetic engineering. For example, when the aforementioned CRISPR base editing system includes a nucleic acid encoding the aforementioned Cas enzyme, the Cas enzyme needs to be obtained through genetic engineering. Similarly, the aforementioned base deaminase is either a purified base deaminase protein or indirectly produced through genetic engineering. For example, when the aforementioned CRISPR base editing system includes a nucleic acid encoding the aforementioned base deaminase, the base deaminase needs to be obtained through genetic engineering.

[0097] It should be noted that the Cas enzyme of the present invention also includes a fusion protein composed of multiple Cas enzymes or a mutant with Cas enzyme function. The base deaminase of the present invention also includes a fusion protein composed of multiple base deaminases or a mutant with base deaminase function.

[0098] In a fifth typical embodiment of the present invention, an adeno-associated virus (AAV) targeting the AGT gene is provided. The AAV targeting the AGT gene comprises an active ingredient and an AAV vector loaded with the active ingredient. The active ingredient includes the gRNA, or the gRNA expression vector, or the CRISPR base editing system, or the composition described above.

[0099] This application introduces an innovative gene delivery tool—an adeno-associated virus vector targeting the AGT gene. This vector system not only integrates advanced gene editing technology with a highly efficient delivery mechanism, but is also specifically designed to address the treatment needs of hypertension and its complications, enabling precise gene therapy.

[0100] Adeno-associated virus (AAV) is widely used in gene therapy due to its broad host range, high transduction efficiency, and relatively high safety. This invention provides a specially designed AAV vector that carries the nucleotide sequence encoding gRNA and key components of the CRISPR base editing system, enabling efficient delivery of these active ingredients to target tissues or cell types, such as liver, heart, kidney, and spleen tissues in vivo, and liver or kidney cells in vitro. The active ingredients in the aforementioned AAV are precisely delivered to target cells via the vector system. The gRNA guides the base editor to a specific region of the AGT gene, achieving base substitution and thereby reducing AGT gene expression.

[0101] In a sixth typical embodiment of the present invention, an LNP targeting the AGT gene is provided. The LNP targeting the AGT gene comprises an active component and a lipid carrier loaded with the active component. The active component includes the gRNA, or the gRNA expression vector, or the CRISPR base editing system, or the composition described above.

[0102] LNP delivery of the gRNA and CRISPR base editor described in this application allows for precise targeting to the liver, achieving efficient and durable AGT gene editing. This, in turn, aims to treat hypertension and its complications while minimizing side effects on non-target organs, thus increasing the safety and reliability of the treatment. This delivery method offers new possibilities for gene editing therapy, particularly in clinical applications requiring precise control of gene expression and reduced systemic side effects. LNP delivery allows for multiple administrations to lower blood pressure to an ideal level.

[0103] In a seventh typical embodiment of the present invention, the use of the above-described gRNA, the above-described gRNA expression vector, the above-described CRISPR base editing system, the above-described composition, the above-described adeno-associated virus targeting the AGT gene, or the above-described LNP targeting the AGT gene in the preparation of a medicament for treating hypertension or secondary lesions caused by hypertension is provided.

[0104] In a preferred embodiment of the present invention, the hypertension described above includes primary hypertension and secondary hypertension.

[0105] In a preferred embodiment of the present invention, the secondary lesions caused by the above-mentioned hypertension include hypertensive heart disease, coronary heart disease, stroke, hypertensive nephropathy, hypertensive retinopathy, arteriosclerosis, heart failure, or sexual dysfunction.

[0106] In a preferred embodiment of the present invention, the above-mentioned drug includes a formulation administered intravenously.

[0107] Intravenous administration is a non-invasive and easy-to-operate route of drug delivery, where medication is injected directly into a vein, allowing it to rapidly enter the bloodstream. Due to its rapid onset of action, intravenous administration is often used in emergency situations, critical care, and when a rapid achievement of effective blood drug concentrations is required. Intravenous formulations include, but are not limited to, intravenous injections, intravenous infusions, suspensions, emulsions, lyophilized powders for injection, liposomes, and nanoparticles. Each of these dosage forms has its own characteristics and is suitable for different clinical scenarios and drug properties.

[0108] The present invention will be further described in detail below with reference to specific embodiments, which should not be construed as limiting the scope of protection claimed by the present invention.

[0109] Example 1

[0110] The DNA sequence of the AGT gene in rat hepatocytes (BRL, purchased from zqxzbio, model ZQ0078), rat cardiomyocytes (H9C2, purchased from zqxzbio, model ZQ0102), human embryonic kidney cells (293T, purchased from zqxzbio, model ZQ0033), and human hepatocellular carcinoma cells (HepG2, purchased from zqxzbio, model ZQ0022) was edited using the CRISPR gene editing method.

[0111] 1. Carrier preparation.

[0112] 1) Identify the gRNA targeting domain:

[0113] Based on the DNA sequence of the rat AGT gene (Gene ID: 24179; ENSRNOG00000018445), gRNAs with a target domain length of 17nT to 24nT were designed, as detailed in Tables 1 and 2.

[0114] Based on the DNA sequence of the human AGT gene (Gene ID: 183; ENSG00000135744), gRNAs with a target domain length of 17nT to 24nT were designed, as detailed in Table 3.

[0115] Table 1. List of rat gRNA targeting domain sequences (targeting AG-GT sequences)

[0116]

[0117] Table 2. Rat gRNA Target Domain Sequence List (with Stop Codon Introduction)

[0118]

[0119] Table 3. List of human gRNA target domain sequences (targeting AG-GT sequences)

[0120]

[0121] 2) Synthesis of plasmid sequences

[0122] DNA sequences of rat-derived AGT gene (Gene ID: 24179; ENSRNOG00000018445) and human-derived AGT gene (Gene ID: 183; ENSG00000135744) were uploaded to the website (https: / / moriaritylab.shinyapps.io / splicer / ). gRNAs were designed using the base editor SpRYCas9-ABE8e, and sequences were synthesized on the PCMV-T7-ABE8e-nSpRY-P2A-EGFP(KAC1069) plasmid based on ABE scores and the structure of the AGT gene.

[0123] The rat-derived AGT gene (Gene ID: 24179; ENSRNOG00000018445) was uploaded to the website (https: / / ciccialab-database.com / istop / # / ). The gRNA was designed using the base editor CBEmax, and the sequence was synthesized on the CBEmax plasmid according to the CBE score and the structure of the AGT gene.

[0124] The sequence was synthesized on the slugCas9-HF-ABE8e plasmid according to the PAM region restriction and the structure of the AGT gene.

[0125] Based on the ABE and CBE scores mentioned above, gRNAs with higher scores (see gRNAs in bold in Table 1-3) were selected to prepare corresponding plasmids. Specifically, for the rat-derived AGT gene, when the base editor SpRYCas9-ABE8e was selected, the sequences of the gRNAs with higher scores were SEQ ID NO: 7, SEQ ID NOs: 9-10, and SEQ ID NOs: 37-39, respectively; when the editor CBEmax was selected, the sequences of the gRNAs with higher scores were SEQ ID NO: 54, SEQ ID NOs: 56-59, and SEQ ID NO: 61, respectively; and when the base editor slugCas9-HF-ABE8e was selected, the sequences of the gRNAs with higher scores were SEQ ID NOs: 48-53, respectively.

[0126] For the human AGT gene, when the base editor SpRYCas9-ABE8e was selected, the gRNA sequences with higher scores were SEQ ID NO: 64, SEQ ID NOs: 66-67, SEQ ID NO: 76, SEQ ID NO: 79, SEQ ID NO: 85, SEQ ID NO: 90 and SEQ ID NO: 97.

[0127] The sense and antisense strands of the DNA sequences corresponding to the target domains of the gRNAs described above were synthesized using conventional methods. The cloned sequences were then introduced into plasmids via enzyme digestion: PCMV-T7-ABE8e-nSpRY-P2A-EGFP(KAC1069) (Addgene, #185912); CBEmax (Addgene, #119802); slugCas9-HF-ABE8e (provided by the laboratory of Yongming Wang at Fudan University; the sequence of this plasmid can be found in Zhou, H., Tian, ​​T., Liu, J., Lu, H., Yu, Y., & Wang, Y. (2024). Efficient and markerless gene integration with SlugCas9-HF in Kluyveromyces marxianus. Communications biology, 7(1), 797.).

[0128] Specifically, the sense and antisense strands of the DNA sequence corresponding to the above gRNA target sequence are diluted and mixed, incubated at 95°C for 5 minutes in a PCR instrument, and then immediately removed and incubated on ice for 5 minutes to anneal and form double-stranded DNA with sticky ends.

[0129] Take 2 μl of the annealed product and dilute it 500 times with deionized water.

[0130] 3) T4 connection reaction

[0131] The plasmid was digested with restriction endonucleases BbsI or BspQI, and the linearized plasmid was recovered by gel excision and then ligated with annealed double-stranded DNA. The reaction system is shown in Table 4 below.

[0132] Table 4 Connection Reaction System

[0133]

[0134] The annealed product was incubated at 25°C for 10 minutes in a PCR instrument to complete the ligation of the linearized backbone, thus obtaining the ligation plasmid.

[0135] 2. Plasmid transformation and ampicillin-resistant solid culture plate coating.

[0136] 1) In a clean bench, all the reaction products of T4 ligation were quickly added into one tube (50 μL) of E. coli DH5α competent cells, and then incubated on ice for 30 minutes.

[0137] 2) Immerse competent cells in a 42°C water bath for 90 seconds for heat shock, then place them back on ice for 2-5 minutes for incubation.

[0138] 3) In a clean bench, add 400 μL of antibiotic-free LB medium, then place the bacterial culture in a bacterial shaker and incubate at 37°C and 180 rpm for 45 minutes for recovery. During recovery, turn on the biochemical incubator and place LB agar plates containing an appropriate amount of ampicillin inside to allow them to dry.

[0139] 4) Centrifuge the bacterial culture at 1000 rpm for 5 minutes at room temperature, remove most of the supernatant, retain about 50 μL, and then fully resuspend the precipitate.

[0140] 5) Pipette the bacterial culture onto an LB agar plate containing ampicillin and spread it evenly using a disposable sterile spreader. Then invert the plate and place it in a biochemical incubator, and incubate at 37°C for 12-14 hours.

[0141] 6) In the clean bench, use a 10μl pipette tip to pick up 5-10 single clones into 1mL of LB medium containing ampicillin. Mix the cells with the LB medium by pipetting several times. Incubate at 37℃ and 220rpm for 12 hours.

[0142] 7) Take 500 μL of bacterial culture and send it directly for sequencing. Store the remaining bacterial culture at 4°C.

[0143] The sequencing primers used for PCMV-T7-ABE8e-nSpRY-P2A-EGFP (KAC1069) were hU6-Promoter-F (SEQ ID NO: 106): ACGATACAAGGCTGTTAGAG. The sequencing primers used for slugCas9-HF-ABE8e and CBEmax were mU6-Promoter-F (SEQ ID NO: 107): CAGCACAAAAGGAAACTCACC.

[0144] 8) In the clean bench, add all the positive clone bacterial solution temporarily stored at 4℃ to a 50mL centrifuge tube, add 30mL of LB medium containing ampicillin, cover the tube, loosen the cap, place the centrifuge tube in a bacterial shaker and fix it at an angle, incubate at 37℃ and 220rpm for 12-16 hours.

[0145] 9) Re-extract plasmids from bacterial culture using the plasmid DNA extraction kit according to the manufacturer's instructions. During the final elution, elute the plasmids with 50 μl ddH2O.

[0146] 10) The plasmid DNA concentration was determined using a NanoDrop spectrophotometer.

[0147] 3. Transfect cells, extract genome, and identify genotypes.

[0148] BRL / 293T cells were transfected with Lipofectamine 3000. Cells were seeded in 12-well plates at 5 x 10⁶ cells per well.5 Each cell was treated with 500 ng plasmid, 1.5 μl Lipofectamine 3000, and 1.5 μl p3000. Four days post-transfection, the genome was extracted using a DNA extraction kit. Specific primers targeting the editing site were designed to amplify a genomic sequence of approximately 400 bp containing the gRNA binding site. Sequencing results were analyzed using EDITR (https: / / moriaritylab.shinyapps.io / editr_v10 / ).

[0149] The inventors first tested the base editing efficiency of gRNAs designed using three different base editors targeting the rat AGT gene, focusing on gRNAs with higher base editing scores. The results are shown in Table 5. Table 5 shows that the base editing efficiency of the base editor SpRYCas9-ABE8e is higher than that of the base editors slugCas9-HF-ABE8e and CBEmax. Therefore, in subsequent investigations of the human AGT gene, gRNAs were mainly designed based on the SpRYCas9-ABE8e base editor, and the base editing efficiency of the higher-scoring gRNAs was investigated (see Table 5). Figure 1 ).

[0150] Table 5 shows the high-scoring gRNAs designed targeting the rat-derived AGT gene.

[0151]

[0152] Based on the base editor SpRYCas9-ABE8e, high-scoring gRNAs designed targeting the rat-derived AGT gene, namely gRNA1 (SEQ ID NO: 38), gRNA2 (SEQ ID NO: 37), gRNA3 (SEQ ID NO: 39), gRNA4 (SEQ ID NO: 7), gRNA5 (SEQ ID NO: 9), and gRNA6 (SEQ ID NO: 10), are shown below. The regions targeting the rat-derived AGT gene are... Figure 1 The base editing efficiency of the above gRNAs is shown in Figure A; Figure 1 B in the middle.

[0153] Figure 1 B in the figure indicates that, in BRL cells, when using the SpRYCas9-ABE8e base editor to target and edit the rat-derived AGT gene, gRNA2 with the sequence shown in SEQ ID NO: 37 has a higher editing efficiency than gRNA1 (SEQ ID NO: 38), gRNA3 (SEQ ID NO: 39), gRNA4 (SEQ ID NO: 7), gRNA5 (SEQ ID NO: 9), and gRNA6 (SEQ ID NO: 10).

[0154] Based on the base editor SpRYCas9-ABE8e, high-scoring gRNAs designed for the human AGT gene, namely gRNA1 (SEQ ID NO: 64), gRNA2 (SEQ ID NO: 66), gRNA3 (SEQ ID NO: 67), gRNA4 (SEQ ID NO: 90), gRNA5 (SEQ ID NO: 97), gRNA6 (SEQ ID NO: 85), gRNA7 (SEQ ID NO: 76), and gRNA8 (SEQ ID NO: 79), are shown below. The regions targeting the human AGT gene are... Figure 1 The D in the above gRNA; the base editing efficiency of the above gRNA is shown in [reference needed]. Figure 1 E in the middle.

[0155] Figure 1 The E in the figure indicates that, in 293T cells, when the human AGT gene was targeted for editing using the SpRYCas9-ABE8e base editor, gRNA1, which has the sequence shown in SEQ ID NO: 64, had a higher editing efficiency than gRNA2 (SEQ ID NO: 66), gRNA3 (SEQ ID NO: 67), gRNA4 (SEQ ID NO: 90), gRNA5 (SEQ ID NO: 97), gRNA6 (SEQ ID NO: 85), gRNA7 (SEQ ID NO: 76), and gRNA8 (SEQ ID NO: 79).

[0156] Sequencing results of the rat-derived AGT gene edited with rat-derived gRNA2 (SEQ ID NO: 37) are as follows: Figure 1 As shown in C. Sequencing results of the human AGT gene edited with human gRNA1 (SEQ ID NO: 64) are shown in Figure 1. Figure 1 As shown in F in the diagram.

[0157] 4. Transfect cells, extract proteins, and identify AGT protein expression.

[0158] Rat hepatocytes (BRL), rat cardiomyocytes (H9C2), and human hepatocellular carcinoma cells (HepG2) were transfected with Lipofectamine 3000. Cells were seeded in 12-well plates at 5 × 10⁶ cells per well. 5 Cells were treated with 500 ng plasmid and 1.5 μl Lipofectamine 3000 and p3000. Four days post-transfection, proteins were extracted on ice using RIPA lysis buffer containing EDTA and protease inhibitors. Protein quantification and denaturation were performed using the BCA method.

[0159] The above proteins were subjected to electrophoresis on a 10% separating gel. After the reaction, the membrane was scanned using an Odyssey instrument. The results are as follows: Figure 2 As shown.

[0160] Figure 2 This indicates that the combination of gRNA2 (SEQ ID NO: 37) designed for the rat-derived AGT gene and the ABE system (SpRYCas9-ABE8e) can effectively edit the AGT gene in rat hepatocytes (BRL) or rat cardiomyocytes (H9C2). The protein expression levels of the AGT gene in both rat hepatocytes (BRL) and rat cardiomyocytes (H9C2) decreased after editing.

[0161] The combination of gRNA1 (SEQ ID NO: 64) and the ABE system (SpRYCas9-ABE8e) designed for the human AGT gene can effectively edit the AGT gene in humanized hepatocellular carcinoma cells (HepG2). The protein expression levels of the AGT gene in the edited humanized hepatocellular carcinoma cells (HepG2) were all decreased.

[0162] Example 2

[0163] Gene editing was performed on a spontaneously hypertensive rat model (SHR).

[0164] Considering that rat-derived gRNA2 (SEQ ID NO: 37: tgcctcaccttggaagtgaa) has the highest editing efficiency, the inventors chose gRNA2 and SpRYCas9-ABE8e to perform gene editing on a spontaneously hypertensive rat model. The experimental design is as follows: Figure 5 As shown in Figure A.

[0165] 1) Purchase spontaneously hypertensive rat models (SHR) and group them as follows:

[0166] Control group: WKY rat group;

[0167] Control group: SHR rats were treated with negative control adeno-associated virus or LNP empty vector.

[0168] Experimental group: SHR rats were treated with adeno-associated virus or LNP.

[0169] 2) Adeno-associated virus 8 (AAV8) packaging: AAV8 is used to deliver gRNA2 and SpRYCas9-ABE8e:

[0170] A. Extract the ABE plasmid pAAV-ABE and the encapsulated transfection plasmids (AAV helper-pDGM6 (addgene, #112867) and pAAV2 / 9n (addgene, #112865). Transfection with plasmids begins when the HER293T cell density in a 10cm dish reaches 40-60%. Add 10ug of the three plasmids (molar ratio 1:1:1) to 0.5mL of opti-MEM; add 37ul of the transfection reagent polyethyleneimine (PEI) to 0.5mL of opti-MEM, mix, let stand for 20 minutes, and then evenly drop the mixture into a 10cm culture dish.

[0171] B. 72 hours after transfection, collect cell lysate and culture supernatant, and centrifuge at 4,000g for 30 minutes at 4 degrees Celsius.

[0172] C. Collect the precipitate and resuspend it in a buffer solution containing 10 mM Tris-HCl (pH 8.0); freeze the suspension with dry ice / ethanol and then in a 37°C water bath for four freeze-thaw cycles.

[0173] D. The cell debris was sonicated and then digested with DNase I at 37°C (200 units in 1.5 mL) for 1 hour;

[0174] Centrifuge at 10,000g for 10 minutes at 4°C, and collect the supernatant as the crude lysate of AAV;

[0175] F. The crude lysate was diluted to 10 mL with 10 mM Tris-HCl (pH 8.0); then a discontinuous gradient of 15%, 25%, 40% and 60% iodixanol (QuickSeal, 342414) was loaded at the bottom of a 39 mL ultracentrifuge tube; and the tube was ultracentrifuged at 350,000 g for 1 hour at 18°C.

[0176] G. Collect 3 mL fraction of the lower 40% and 0.5 mL fraction of the upper 60% and then ultracentrifuge at 350,000 g for 1 hour at 18°C;

[0177] H. Collect the supernatant and desalinate it using a 100 kDa ultrafiltration tube (15 mL; Millipore, USA);

[0178] I. Viral titer was determined by SYBR Green RT-qPCR. Purified AAV was stored at -80°C.

[0179] 3) Inject N-terminal and C-terminal AAV8 virus at a 1:1 ratio via tail vein, at doses of 1x10⁻¹. 14Genome copy / kg rat body weight. The control group was transfected with control EGFP virus, and the experimental group was transfected with AAV8. One week after injection, liver tissue from the experimental group was collected for DNA sequencing. The results are as follows: Figure 3 As shown. Figure 3 The results showed that after tail vein injection of AAV, the in vivo editing efficiency of liver tissue in the two rats was 31% and 24%, respectively.

[0180] 4) LNP Packaging: Dissolve appropriate amounts of the basic liposome components—SM102, DOPE, cholesterol, and PEG2000 lipids—in HPLC-grade anhydrous ethanol, and then incubate in water at 42°C. Mix the SM102, DOPE, cholesterol, and PEG2000 lipid solutions sequentially in a molar ratio of 50:10:38.5:1.5 to prepare the LNP precursor. Using a microfluidic system, package centrifuge tubes containing the LNP precursor and plasmids dissolved in pH 5.5 PBS at a 1:1 ratio. Purify the LNPs using a GE ÄKTA avant chromatography system, and perform quality control using dynamic light scattering (DLS) to determine particle size and PDI.

[0181] 5) LNP was injected via tail vein at doses of 1 mg / kg, 2 mg / kg, and 4 mg / kg of rat body weight. The control group was transfected with control LNP-EGFP, and the experimental group was transfected with LNP-ABE8e.

[0182] The results are as follows Figure 4 As shown, the LNP delivery editing system can alter the DNA sequence of the AGT gene in the liver, while the DNA sequence of the AGT gene in other organs (e.g.) remains unchanged, and the editing efficiency is correlated with the dose of LNP.

[0183] 6) We treated the rats starting from week four and continuously observed their blood pressure and serum AGT / ANGⅠ / ANGⅡ expression levels for 24 weeks. Figure 5 As shown in B and C: gRNA2 (SEQ ID NO: 37)-SpRYCas9-ABE8e editing resulted in a sustained decrease in blood pressure in both male and female rats. Figure 5 As shown in D, E, and F: gRNA2 (SEQ ID NO: 37)-SpRYCas9-ABE8e editing resulted in a sustained decrease in serum AGT / ANGⅠ / ANGⅡ expression in male rats.

[0184] 7) After 16 weeks, the cardiac structure and function of the rats were examined by echocardiography. Ultrasound examination was used to assess the end-diastolic volume of the ventricles and the ejection fraction, a key cardiac function parameter. Results are as follows: Figure 6As shown: gRNA2 (SEQ ID NO: 37)-SpRYCas9-ABE8e editing effectively prevents cardiac hypertrophy and heart failure in SHR rats.

[0185] 8) After 16 weeks, the kidney function of the rats was tested by routine urinalysis. The results are as follows: Figure 7 As shown: gRNA2 (SEQ ID NO: 37)-SpRYCas9-ABE8e editing effectively prevents kidney damage in SHR rats.

[0186] 9) Liver samples were obtained after euthanizing rats for DNA and protein testing. The results are as follows: Figure 8 As shown, LNP can specifically reduce the expression of AGT in the liver without affecting other organs.

[0187] Example 3

[0188] Gene editing was performed on a humanized AGT mouse model (Rosa26-hAGT).

[0189] Considering that gRNA1 has the highest editing efficiency, the inventors chose human gRNA1 (SEQ ID NO: 64: ccttaccttggaagtggacg) and SpRYCas9-ABE8e to perform gene editing on the Rosa26-hAGT model. The experimental design is detailed below. Figure 9 A in the middle.

[0190] 1) Purchase 3-week-old humanized AGT mouse models (Rosa26-hAGT) and group them as follows:

[0191] Control group: Rosa26-hAGT mouse group;

[0192] Control group: Rosa26-hAGT mice treated with adeno-associated virus overexpressing human renin;

[0193] Experimental-LNP group: The gRNA1 sequence is: ccttaccttggaagtggacg (SEQ ID NO: 64);

[0194] 2) Purchase commercially available AAV-hRENIN virus. At 7 weeks of age, Rosa26-hAGT mice were injected with 100 μL of AAV-hRENIN virus to establish a hypertension model. Blood pressure was measured 2 weeks later. Mice with successfully established hypertension models were randomly divided into two groups: the experimental-LNP group and the control group.

[0195] 3) Since adeno-associated virus (AAV) was used in the model construction, to reduce the immune clearance effect of AAV, we used the LNP construction method described in Example 2 to construct LNP-sgRNA1 (SEQ ID NO: 64)-ABE8e. Following the recommendation in the reference (Qiu et al. Lipid nanoparticle-mediated codelivery of Cas9 mRNA and single-guide RNA achieves liver-specific in vivo genome editing of Angptl3. Proceedings of the National Academy of Sciences of the United States of America, 2021, 118(10), e2020401118.), LNP was injected via tail vein at a dose of 3 mg / kg. The control group was transfected with control LNP-EGFP, and the experimental group was transfected with LNP-ABE8e. The experimental steps related to LNP delivery were the same as in Example 2.

[0196] 4) One week later, the mice were euthanized, liver samples were obtained, and DNA tests were performed. The results are as follows: Figure 9 As shown. Detection of liver DNA editing efficiency ( Figure 9 (B in the text), liver AGT protein expression ( Figure 9 C and D in the middle) and serological human AGT ( Figure 9 The expression of E in the text.

[0197] 5) Purchase a new batch of humanized AGT mouse models (Rosa26-hAGT) and conduct long-term monitoring using tail vein blood pressure measurement. The results are as follows: Figure 10 As shown. Figure 10 This indicates that gRNA1 (SEQ ID NO: 64)-SpRYCas9-ABE8e-edited humanized AGT mice exhibited a long-term decrease in blood pressure (lasting 8 weeks).

[0198] Example 4: Safety Analysis of the Treatment Strategy

[0199] 1) Blood samples were collected via subbuccular blood collection or cardiac puncture. Blood was allowed to clot at room temperature for 2 hours, then centrifuged at 5400 rpm for 10 minutes. Enzyme-linked immunosorbent assay (ELISA) was performed to measure serum AST / ALT / IL-1β levels. Absorbance levels were measured using a Thermo Fisher Scientific Varioskan LUX microplate reader. Results are as follows: Figure 11As shown, no significant inflammatory response was observed one day after LNP injection, demonstrating the safety of this treatment strategy.

[0200] 2) The Cas-OFFinder online search tool (http: / / www.rgenome.net / cas-offinder / ) was used to search for potential Cas9 off-target sites in the rat genome. The unique and target-specific part of the sgRNA used (sgRNA2 (SEQ ID NO: 37): TGCCTCACCTTGGAAGTGAA) was used as the query sequence, while allowing mismatched base pairs between the sgRNA and the candidate target site.

[0201] DNA was extracted from the livers of the rats used in Example 2 above. Genomic DNA was amplified by PCR using primers specific to the target genomic sites, and then sequenced on the Illumina MiSeq instrument described above. The results are as follows: Figure 12 As shown: No off-target effects were found in the top eight sequences expected to be off-target, nor were bystander effects found in the target sequence, proving that the treatment strategy is relatively safe (the yellow highlighted sequences indicate base sequences that are mismatched with the target sequence).

[0202] As can be seen from the above description, the present invention provides a gRNA that targets the human / rat AGT gene respectively. The gRNA can reduce the expression of the human / rat AGT gene through the CRISPR-Cas gene editing system.

[0203] Using the above gRNA to prepare drugs for hypertension and hypertension-related conditions (hypertensive heart disease, coronary heart disease, stroke, hypertensive nephropathy, hypertensive retinopathy, atherosclerosis, heart failure, and sexual dysfunction) has the advantages of long-lasting and stable efficacy, few adverse reactions, low treatment frequency, good patient compliance, and low long-term treatment costs.

[0204] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A gRNA targeting the AGT gene, characterized in that, The AGT gene includes human AGT gene and rat AGT gene; The sequence of the gRNA targeting the human AGT gene is selected from any one of the following: SEQ ID NOs: 64~105; The sequence of the gRNA targeting the rat-derived AGT gene is selected from any of the following: SEQ ID NOs: 1~63.

2. A gRNA expression vector for targeted editing of the AGT gene, characterized in that, The gRNA expression vector contains a nucleotide sequence encoding the gRNA of claim 1.

3. A CRISPR base editing system for targeted editing of the AGT gene, characterized in that, The CRISPR base editing system includes the gRNA described in claim 1.

4. A composition for targeting and editing the AGT gene, characterized in that, The composition comprises: a gRNA system and a CRISPR base editing system; The gRNA system is selected from any one or more of the following: The gRNA of claim 1, or Nucleic acid encoding the gRNA of claim 1, or The gRNA expression vector according to claim 2.

5. The composition according to claim 4, characterized in that, The CRISPR base editing system includes: i) the Cas enzyme or the nucleic acid encoding the Cas enzyme, and ii) Base deaminase or nucleic acid encoding the base deaminase.

6. The composition according to claim 5, characterized in that, The base deaminase is selected from any one or more of the following: adenosine deaminase or cytidine deaminase; Preferably, the Cas enzyme is selected from any one or more of the following: SpCas9, SaCas9, Nme2Cas9, Nme3Cas9, CjCas9, NmCas9, FnCas9, slugcas9, or SpeCas9.

7. An adeno-associated virus targeting the AGT gene, characterized in that, The adeno-associated virus targeting the AGT gene comprises an active ingredient and an adeno-associated virus vector loaded with the active ingredient, wherein the active ingredient comprises the gRNA of claim 1, or the gRNA expression vector of claim 2, or the CRISPR base editing system of claim 3, or the composition of any one of claims 4-6.

8. An LNP targeting the AGT gene, characterized in that, The LNP targeting the AGT gene comprises an active component and a lipid carrier loading the active component, wherein the active component comprises the gRNA of claim 1, or the gRNA expression vector of claim 2, or the CRISPR base editing system of claim 3, or the composition of any one of claims 4-6.

9. The use of the gRNA of claim 1, the gRNA expression vector of claim 2, the CRISPR base editing system of claim 3, the composition of any one of claims 4-6, the adeno-associated virus targeting the AGT gene of claim 7, or the LNP targeting the AGT gene of claim 8 in the preparation of a medicament for treating hypertension or secondary lesions caused by hypertension.

10. The application according to claim 9, characterized in that, The hypertension mentioned includes primary hypertension and secondary hypertension; Preferably, the secondary lesions caused by hypertension include hypertensive heart disease, coronary heart disease, stroke, hypertensive nephropathy, hypertensive retinopathy, arteriosclerosis, heart failure, or sexual dysfunction; Preferably, the drug comprises a formulation administered intravenously.

Images