Method for screening chicken individuals with high flavor and quality by detecting genotype of specific SNP (Single Nucleotide Polymorphism) site, related kit and application thereof

By screening four SNP sites in the chicken KCNS3 gene region, a molecular marker combination for MAS breeding was developed, which solved the problem of precise selection in chicken flavor breeding, achieved efficient and early breeding results, and significantly improved breeding efficiency and accuracy.

CN121496067APending Publication Date: 2026-02-10JIANGSU INST OF POULTRY SCI +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511736519.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-25
Publication Date
2026-02-10

AI Technical Summary

Technical Problem

Existing technologies are difficult to use for precise selection in chicken flavor breeding. Traditional methods are time-consuming and inefficient, and the predictive power and stability of existing SNP marker combinations are limited, making them difficult to apply directly to breeding practices.

Method used

Four specific SNP loci (chr3:100011635, chr3:100011636, chr3:100011645, chr3:100011656) located in the chicken KCNS3 gene region were screened through genome-wide association analysis. These loci were developed for marker-assisted selection (MAS) breeding, providing specific primer pairs for genotyping and enabling early and efficient breeding of high-flavor-quality chickens.

Benefits of technology

It significantly improves breeding efficiency, shortens the breeding cycle, enables early selection of live organisms, and has simple and efficient detection methods that are easy to promote and apply, thereby improving the accuracy and efficiency of breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121496067A_ABST
    Figure CN121496067A_ABST
Patent Text Reader

Abstract

The invention discloses a method for screening high-flavor-quality chicken individuals by detecting specific SNP locus genotypes, a related kit and application thereof, and belongs to the technical field of molecular breeding. The SNP molecular marker combination comprises four specific sites, namely, chr3: 100011635 (G / A), chr3: 100011636 (T / C), chr3: 100011645 (C / T) and chr3: 100011656 (A / T), which are positioned in a chicken KCNS3 gene region. The invention also provides a specific primer pair for detecting the molecular marker combination and a kit containing the primer. By detecting the genotypes of chicken individuals to be detected at the sites, excellent individuals with high volatile flavor substance content can be quickly and accurately screened out. According to the method, high-quality chicken breeds can be accurately screened, the flavor quality of meat products is improved, the problems that high-quality chicken breeding is long in period, low in efficiency and poor in selection accuracy are solved, an efficient and reliable molecular technical means is provided for early breeding of chicken flavor characters, and the breeding process is remarkably accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for screening high-flavor-quality chicken individuals by detecting the genotype of specific SNP loci, related reagent kits, and their applications, belonging to the field of molecular breeding and genetic improvement of food flavor technology. Background Technology

[0002] Chicken flavor is a crucial quality trait influencing consumer purchasing intentions and market competitiveness, especially the composition and content of volatile flavor compounds, which directly determine the aroma characteristics and eating experience of the meat. Currently, the improvement of chicken flavor mainly relies on traditional breeding methods, gradually accumulating superior traits through phenotypic selection and pedigree selection. However, flavor traits are mostly quantitative traits, regulated by multiple genes and easily influenced by the environment. Traditional methods are time-consuming, inefficient, and difficult to achieve precise selection.

[0003] With the development of molecular biology techniques, marker-assisted selection (MAS) has become an important tool in animal breeding to improve selection accuracy and accelerate genetic progress. Single nucleotide polymorphism (SNP) markers, due to their abundance, wide distribution, high detection throughput, and good stability, have been widely used in elucidating the genetic mechanisms of economically important traits and in breeding practices. Especially in the study of chicken meat quality traits, several SNP markers related to meat color, pH value, and water-holding capacity have been reported. However, research on marker development for volatile flavor compounds is still limited, and stable marker combinations suitable for breeding have not yet been identified.

[0004] Existing studies, though few, focus on association analyses between single genes or a few loci and flavor, exhibiting limited predictive power and stability, making them difficult to directly apply to breeding practices. Therefore, developing a combination of SNP molecular markers that are significantly correlated with the volatile flavor of chicken and can be used for efficient auxiliary selection has significant theoretical and practical value. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a method, related kits, and applications for screening high-flavor-quality chicken individuals by detecting specific SNP locus genotypes. The core contribution of this invention lies in the first discovery of a highly significant association between a combination of four specific SNP loci located in the chicken KCNS3 gene region and volatile flavor traits in chicken meat, and the first development of its application in marker-assisted selection (MAS) breeding.

[0006] This invention uses genome-wide association analysis (GWAS) to screen for four SNP sites located in the KCNS3 gene region, which are highly significantly associated with the content of key volatile flavor compounds in chicken. Furthermore, stable differences were observed among individuals with different genotypes. Population genotype-phenotype association analysis further confirmed the effectiveness of this marker combination in distinguishing individuals with high and low flavor compound content. The SNP molecular marker combination provided by this invention can be used for early selection, population typing, and genetic assessment of chicken flavor traits, significantly improving breeding efficiency and shortening the breeding cycle, and has broad application prospects.

[0007] The four SNP loci chr3:100011635 (G>A), chr3:100011636 (T>C), chr3:100011645 (C>T), and chr3:100011656 (A>T) were specifically selected and combined for use in assisted breeding of chicken flavor traits. This invention is the first to discover and validate, through genome-wide association analysis (GWAS), a highly significant association between this specific SNP combination and the content of key volatile flavor compounds in chicken. This led to the development of molecular marker methods and application systems for the early and efficient breeding of high-flavor-quality chicken strains.

[0008] The technical solution of the present invention is as follows:

[0009] 1. A method for screening chicken individuals with high volatile flavor compound content, comprising detecting the genotypes of the following four SNP loci in the chicken genome: a) the SNP locus located at position 3:100011635 of chicken chromosome 3, with a base mutation of G>A; b) the SNP locus located at position 3:100011636 of chicken chromosome 3, with a base mutation of T>C; c) the SNP locus located at position 3:100011645 of chicken chromosome 3, with a base mutation of C>T; d) the SNP locus located at position 3:100011656 of chicken chromosome 3, with a base mutation of A>T; wherein the method comprises the following steps: (1) obtaining the genomic DNA of the chicken individual to be tested; (2) detecting the genotypes of the genomic DNA at the four SNP loci; (3) Based on the detection results of step (2), individuals with genotypes AA, CC, TT and TT at four loci were selected, and the content of volatile flavor compounds in these individuals was significantly higher than the average level of the population.

[0010] Furthermore, the SNP site is located within the chicken KCNS3 gene region.

[0011] Further, the detection in step (2) is performed by amplifying the genomic DNA fragment containing the four SNP sites using specific primer pairs, and then sequencing or genotyping the amplified product; the specific primer pair sequence is shown in SEQ ID NO: 1.

[0012] 2. A kit for assisting in the selection of volatile flavor traits in chicken meat according to the present invention, the kit comprising components for performing the method described in item 1 above.

[0013] Preferably, the kit includes the specific primer pair described above. Furthermore, the kit also includes one or more reagents for PCR amplification, enzyme digestion, or sequencing.

[0014] 3. A method for breeding high-flavor-quality chicken strains according to the present invention includes using the method described in item 1 above to screen individuals with high volatile flavor substance content as parents for breeding.

[0015] 4. The application of the kit described in item 2 above in screening chicken individuals with high levels of volatile flavor compounds.

[0016] The beneficial effects of the technical solution described in this invention are as follows:

[0017] High significance and strong association: The four SNP molecular markers provided in this invention were all obtained through rigorous screening using genome-wide association analysis (GWAS), and their association with the content of key volatile flavor compounds in chicken reached a highly significant level. This indicates that these markers are strongly genetically linked to flavor traits, laying a solid theoretical foundation for their use in assisted selection.

[0018] High accuracy and clear application results: Validation experiments showed highly significant differences in flavor compound content among individuals with different genotypes (P<0.01), with consistent effects. For example, individuals carrying the dominant genotype (such as the TT genotype at the chr3:100011645 locus) had significantly higher flavor compound content than individuals with other genotypes. This clear genotype-phenotype correspondence makes breeding selection based on this marker combination highly accurate and reliable.

[0019] This invention enables early selection, significantly improving breeding efficiency: Traditional flavor assessment requires slaughter and is conducted using instruments or sensory evaluation, making live selection of breeding stock impossible. This invention allows for genotyping of DNA extracted from blood or feather samples during the early stages of chicken growth and development (e.g., the chick stage), enabling early prediction of flavor potential. This allows for live early selection of breeding roosters and hens, shortening the breeding cycle by 2-3 generations compared to traditional progeny testing, significantly reducing feeding costs, and accelerating genetic progress.

[0020] The detection method is simple, efficient, and easy to promote and apply: This invention provides specific PCR primers for the aforementioned marker combination, with well-defined sequences that can stably amplify the target fragment. PCR-based detection technologies (such as fluorescent probe methods, sequencing methods, and enzyme digestion methods) are mature, efficient, and inexpensive, making them very easy to promote and apply on a large scale in conventional breeding laboratories, and possessing extremely strong prospects for industrial application.

[0021] The significant advancement and inventiveness of this invention compared to existing technologies lies in providing a specific combination that has been optimized, screened, and validated, rather than simply listing multiple SNP sites. All four SNP sites in this combination are located within the same tightly linked region of the KCNS3 gene, forming a specific haplotype block. Validation experiments show that individuals carrying the dominant haplotype (e.g., H1: ACTT) have significantly higher levels of flavor compounds than individuals carrying only partial dominant genotypes or neutral haplotypes. This synergistic effect is far superior to the effect of selecting using any single site, demonstrating the non-obviousness and technical superiority of the combination.

[0022] The primer pairs are specifically designed to amplify genomic fragments containing all four target SNP sites in a single, efficient manner. This feature is crucial for achieving simultaneous multi-site detection in this invention.

[0023] In summary, this invention provides for the first time a set of fully validated SNP molecular marker combinations closely related to the volatile flavor traits of chicken meat and their application schemes, effectively overcoming the shortcomings of existing technologies and providing a revolutionary technical tool for chicken flavor breeding. This is of great significance for improving the quality of chicken meat and the core competitiveness of breeding in my country. Attached Figure Description

[0024] Figure 1 This is the Manhattan diagram of chicken flavor-related molecular markers of the present invention.

[0025] Figure 2 This is a detailed information table of the four SNP molecular markers provided by this invention.

[0026] Figure 3 This is a table showing the association analysis results between different genotypes of four SNP molecular markers and the content of flavor compounds in chicken meat.

[0027] Figure 4 A typing table for restriction endonucleases. Detailed Implementation

[0028] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, but the embodiments of the present invention are not limited thereto. Those skilled in the art should understand that any modifications and changes made to these embodiments without departing from the spirit and principles of the present invention fall within the protection scope of the present invention.

[0029] Invention Mechanism

[0030] Although the four SNP sites involved in this invention are all located in the intron region of the KCNS3 gene, rather than in the coding region that directly alters the amino acid sequence, the genome-wide association analysis (GWAS) showed extremely significant associations. This strongly suggests a functional link between these sites and flavor traits. The mechanism of action may be as follows:

[0031] The KCNS3 gene encodes a voltage-gated potassium channel subunit that is widely expressed in nerve and muscle tissue. Potassium channels influence cellular excitability, secretion, and metabolic activity by regulating cell membrane potential. In muscle cells, potassium channel function may indirectly affect metabolic pathways related to the generation of flavor precursors, such as lipid oxidation and amino acid degradation.

[0032] SNPs located in intron regions of genes, although not directly encoding proteins, regulate gene function in the following ways:

[0033] Affecting transcription factor binding: These SNP sites may be located in or in close linkage disequilibrium with gene regulatory elements (such as enhancers or silencers). Specific base variations (such as C>T in chr3:100011645) may create or disrupt a transcription factor binding site, thereby altering the transcriptional efficiency or expression level of the KCNS3 gene.

[0034] Impact on mRNA splicing: Intron sequences are crucial for proper mRNA splicing. SNP variations may affect the binding of splicing regulators (such as SR proteins and hnRNPs), leading to alternative splicing events, producing different isotypes of KCNS3 protein, and potentially altering channel function.

[0035] Alterations in the expression or function of the KCNS3 gene may further affect the electrophysiological properties and calcium signaling homeostasis of muscle cells, ultimately regulating downstream biological processes such as mitochondrial function and lipid metabolism rate. This may lead to differences in the accumulation levels of volatile flavor precursors (such as fatty acids and amino acids), resulting in different types and amounts of flavor compounds during post-mortem maturation and cooking.

[0036] The four SNP sites (chr3:100011635, 100011636, 100011645, 100011656) provided in this invention are all located within the third intron region of the chicken KCNS3 gene. The KCNS3 gene encodes a voltage-gated potassium channel subunit, which is expressed in nerve and muscle tissues (including cardiac and skeletal muscle). Although the sites discovered in this application are located in an intron region and are not missense mutations that directly cause amino acid changes, genome-wide association studies (GWAS) and validation experiments have shown that they are significantly associated with the content of volatile flavor compounds in chicken meat. It is speculated that these SNP sites may be in linkage disequilibrium with KCNS3 gene expression regulatory elements (such as enhancers or silencers), thereby indirectly affecting muscle physiological metabolic processes (such as lipid metabolism or amino acid degradation), ultimately leading to differences in the content of volatile flavor precursors. This strong correlation makes them excellent molecular markers for assisted breeding.

[0037] The primer pair used to detect this marker combination was designed using Primer Premier 5.0 software. Using the chicken reference genome Galgal6 as a template, specific primers were designed for genomic regions containing the aforementioned four SNP sites. The upstream primer F: 5'-CCTTCCTGTGCCAGCTGAG-3' and the downstream primer R: 5'-AGAGAGGGCAATGGCAAGAT-3' amplified a fragment of 498 bp. This primer pair spans intron regions within the gene sequence, specifically amplifying genomic DNA and avoiding false positives caused by genomic DNA contamination. BLAST validation confirmed that this primer sequence has high specificity in the chicken genome.

[0038] Primer design and validation:

[0039] The specific primer pair (F: 5′-CCTTCCTGTGCCAGCTGAG-3′; R: 5′-AGAGAGGGCAATGGCAAGAT-3′) was designed using Primer Premier 5.0 software. To verify its specificity, the primer sequences were aligned using NCBI's BLAST tool (database: Chicken genomic + transcript, nr). The alignment results showed that the primer pair had 100% complementarity only with a single target region (location: 100011538 - 100012035) on chromosome 3 of the chicken (Gallus gallus) reference genome (Assembly: GRCg6a), with an expected amplified fragment length of 498 bp. No significant homology was found with other genomic regions or common contaminants (such as E. coli), indicating that the primer pair has high species and site specificity.

[0040] To further optimize amplification conditions, an annealing temperature gradient (56℃ to 64℃) was established for PCR testing. The results showed that bright, single, specific bands were obtained at annealing temperatures ranging from 58℃ to 62℃, with the highest amplification efficiency at 60℃. Therefore, 60℃ was selected as the optimal annealing temperature for all subsequent experiments.

[0041] The nucleotide sequence of the amplified fragment is shown in SEQ ID NO: 1, and its length is 498 bp. The specific locations of the four target SNP sites in this sequence are as follows:

[0042] chr3:100011635 (G / A) is located at position 100 of SEQ ID NO: 1;

[0043] chr3:100011636 (T / C) is located at position 101 of SEQ ID NO: 1;

[0044] chr3:100011645 (C / T) is located at position 110 of SEQ ID NO: 1;

[0045] chr3:100011656 (A / T) is located at position 121 of SEQ ID NO: 1.

[0046] In addition to sequencing, the detection can also be performed using restriction fragment length polymorphism (PCR-RFLP). For each SNP site, the following restriction endonucleases can be used for genotyping (see...). Figure 4 ).

[0047] Brief description of enzyme digestion and genotyping procedure: Take 5-10 μL of the above PCR product. Add 1 μL of the corresponding restriction endonuclease (10 U / μL) and 2 μL of the corresponding 10× buffer. Add sterile ddH2O to a total volume of 20 μL. Incubate for 1 hour at the temperature recommended in the table above. Perform 2-3% agarose gel electrophoresis on all digested products, observe and record the enzyme fragment length polymorphism under UV light, and determine the genotype based on the band size.

[0048] Example 1: Detection of SNP molecular markers and genotyping.

[0049] 1. Sample Collection and DNA Extraction: 247 healthy individuals of a commercial broiler breed, raised under consistent conditions, were selected. 2 mL of blood was collected from the subwing vein and anticoagulated with EDTA. Genomic DNA was extracted from the blood samples using the conventional phenol-chloroform method or a commercially available genomic DNA extraction kit (e.g., TIANGEN DP304). The concentration and purity of the DNA were determined using a Nanodrop micro-spectrophotometer. All DNA samples were diluted to 50 ng / μL and stored at -20°C for later use.

[0050] 2. PCR amplification: PCR amplification was performed using the specific primer pairs provided in this invention. The primer sequences are as follows (see the sequence list in the instruction manual): upstream primer F: 5'-CCTTCCTGTGCCAGCTGAG-3'; downstream primer R: 5'-AGAGAGGGCAATGGCAAGAT-3'.

[0051] The PCR reaction system (25 μL) is shown in the table below:

[0052] Table 1 PCR reaction system (25 μL)

[0053] The PCR reaction program was as follows: pre-denaturation at 94℃ for 5 min; followed by 35 cycles: denaturation at 94℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 45 s; after the cycles, final extension at 72℃ for 10 min, and storage at 4℃.

[0054] 3. Amplification product validation and sequencing

[0055] Five μL of the PCR product was taken and detected by 1.5% agarose gel electrophoresis, confirming the amplification of a specific band of approximately 500 bp (see [link to PCR product]). Figure 1(The image shows the electrophoresis results of the amplified products). The remaining PCR products were purified and sent to a sequencing company for bidirectional Sanger sequencing. The nucleotide sequence of the amplified products used for sequencing is as described in the instructions (SEQ ID NO: 1), specifically: GCTGCCACTGCGGCTGTGTGCTGGGAGCCGGGTGCAGCCCTTCCTGTGCCAGCTGAGCGCGCTGAGCCCCACATGCTCCCAGGTGTAGCAAATGCCAGCTAGCAAGGAGTGCATGTGAAGGACAGATGCTCTGTGTAGGCTGACCTGAGCTGGGGTTGGAGTGAGCAGCAGAGTTGGGCAGCATCTTTCCTAGCAGCCTGTCCATCCTCCCGGTTACTTGCAAGTGGGTTGGCCAGGTTTGCTTATTCTCCTGGAATCCCTCTCTGGCTCTCCCTAAGCCCATTTGTTTGCAGCATACGTCCTAA AGGCCTCTTGGTTTAAAGAACTTGTTTACTTGCTACGGGGGCACATATATTAAAAAGCCCTGCCCAAGGCTAATGACTAGAAACAAGACTCAAGTCTCCAAACTCACATCATTCTCTGCTTTGCAAATTTTCAGTTACGGGATCCCTGCCAAGGACAC ATAATAAAACAGAGCTCATGAATAAATGAAATGTATTCCACTAACCTGTGGATATTTTCTTCTAATCTTGCCATTGCCCTCCTATATATTCTTTCCTCTTGTCCTTCCATTCTTTTCTGTTTAGCTTCTTTCTTCTTTTCTGGAATTTGCATTCCCC

[0056] Figure 1 This is a Manhattan diagram of chicken flavor-related molecular markers in an embodiment of the present invention.

[0057] 4. Genotyping: The SeqMan software in the DNASTAR Lasergene package was used to compare the sequencing peaks with the chicken reference genome (Galgal6), focusing on the analysis of four target SNP sites (see...). Figure 2 The genotype (and the instruction manual table) is as follows:

[0058] chr3:100011635 (G / A, rs3385719582)

[0059] chr3:100011636 (T / C, rs1058582816)

[0060] chr3:100011645 (C / T, rs740157190)

[0061] chr3:100011656 (A / T, rs735404250)

[0062] Figure 2 This is a detailed information table of the four SNP molecular markers provided by this invention. The table lists the SNP locus number, chromosomal physical location, ID (rs number) in the dbSNP database, candidate gene, reference genome base, mutant base, minimum allele frequency (MAF), and p-value of association analysis with chicken flavor compounds, demonstrating that these loci are highly significantly associated with the target trait.

[0063] Results: Genotyping was successfully completed for 247 samples. The genotype distribution frequencies of the four SNP loci were... Figure 3 Consistent with the results shown, all loci conformed to Hardy-Weinberg equilibrium (P > 0.05), and the minimum allele frequency (MAF) was greater than 0.05, indicating good locus polymorphism and suitability for population genetic analysis and assisted selection.

[0064] Example 2: Correlation analysis between SNP molecular markers and the content of chicken flavor compounds.

[0065] 1. Phenotypic Data Determination: From the same batch of 247 broiler chickens that underwent genotyping in Example 1, breast meat samples were collected after slaughter under identical conditions. The total content (μg / g) of volatile flavor compounds in the muscle was determined using headspace solid-phase microextraction combined with gas chromatography-mass spectrometry (HS-SPME-GC-MS) according to GB / T 22210-2008. Each sample was repeated three times, and the average value was taken.

[0066] 2. Statistical analysis: SPSS 26.0 software was used to perform one-way ANOVA with SNP locus genotype as the grouping variable and flavor substance content as the dependent variable. Duncan's method was used for multiple comparisons, and P < 0.01 was considered highly significant.

[0067] 3. Results: The results are as follows Figure 3 As shown in the correlation analysis table with the instruction manual, there were extremely significant differences in the content of flavor compounds among different genotypes of the four SNP sites (P < 0.01), indicating that these SNP sites are significantly associated with the volatile flavor content of chicken and can be used for molecular marker-assisted selection of flavor traits.

[0068] Figure 3 This table shows the association analysis results between different genotypes of four SNP molecular markers and the content of flavor compounds in chicken meat. The table displays the different genotypes at each locus, the corresponding sample size, the flavor compound content (mean ± standard deviation), and the statistical significance (P < 0.01). It clearly shows that the flavor compound content of individuals with the dominant genotype (labeled A) is significantly higher than that of individuals with other genotypes (labeled B), providing a direct basis for marker-assisted selection.

[0069] Multiple comparison results of flavor compound content of different genotypes at each SNP locus (Tukey HSD, P < 0.01) Locus chr3:100011635 (G>A) (see Table 2):

[0070] Table 2

[0071] Locus chr3:100011636 (T>C) (see Table 3);

[0072] Table 3

[0073] Locus chr3:100011645 (C>T) (see Table 4):

[0074] Table 4

[0075] Locus chr3:100011656 (A>T) (see Table 5):

[0076] Table 5

[0077] Note: Different letters (A, B, C) in the same column indicate highly significant differences at the 0.01 level. There are no significant differences among genotypes sharing the same letter.

[0078] As shown in the table above, for each locus, the flavor compound content of homozygous individuals (AA, CC, TT, TT) was significantly higher than that of heterozygous individuals (AG, TC, CT, AT), while the heterozygous individuals were significantly higher than another homozygous individual (GG, TT, CC, AA). Therefore, defining the dominant genotypes for these four loci as AA, CC, TT, and TT has sufficient statistical basis. Selecting individuals carrying all four dominant genotypes for breeding can achieve the greatest selection intensity and genetic progress.

[0079] Example 3: Application in chicken flavor-assisted breeding.

[0080] Based on the association analysis results of Example 2, the following auxiliary breeding method was established. The "dominant genotype" refers to a genotype that is significantly positively correlated with the content of volatile flavor compounds at a specific SNP locus, specifically:

[0081] For the locus chr3:100011635 (G>A), the dominant genotype is AA;

[0082] For the locus chr3:100011636 (T>C), the dominant genotype is CC;

[0083] For the locus chr3:100011645 (C>T), the dominant genotype is TT;

[0084] For the locus chr3:100011656 (A>T), the dominant genotype is TT.

[0085] In practical breeding applications, the following two strategies can be used for priority selection:

[0086] Multi-locus comprehensive selection (preferred approach): All four loci are mandatory markers. Individuals with dominant genotypes at all four loci are preferentially selected. This strategy offers the strongest selection intensity, the fastest genetic progress, and most significantly improves the average level of flavor traits in the offspring population.

[0087] The specific operation steps are as follows: (1) Extract genomic DNA from candidate breeding chickens (such as roosters and hens in the core breeding group) (the source can be blood, feathers or tissue); (2) Amplify the genomic fragment containing the 4 SNP sites using the primer pairs and PCR method provided in Example 1; (3) Sequencing the PCR products to determine the genotype of each candidate individual at the 4 sites; (4) Prioritizing the selection of individuals with the target genotype according to the above selection strategy and the "dominant genotype" standard; (5) Using the selected superior individuals as parents for breeding, thereby continuously breeding chicken strains with high flavor quality.

[0088] This method allows for accurate assessment of a chick's flavor potential in the early stages of chick development and before slaughter, enabling live selection, shortening the breeding cycle by 2-3 generations, and significantly improving breeding efficiency.

[0089] The "high volatile flavor content" of this invention refers to the total content of volatile flavor compounds in muscle, as determined by gas chromatography-ion mobility spectrometry (GC-IMS), being at least 20% higher than the average value of its group.

[0090] Chicken individuals with high flavor quality refer to individuals with genotypes AA, CC, TT, and TT, respectively, based on the detection of the four SNP loci (chr3:100011635, chr3:100011636, chr3:100011645, chr3:100011656) described in this invention. Their volatile flavor compound content is verified to be significantly higher than the average level of the population (P<0.01), and is more than 20% higher than the average value in actual measurements.

[0091] Example 4: Validation of multi-site combination effect (haplotype analysis and multigene scoring).

[0092] To verify the synergistic effect of the SNP molecular marker combination provided by the present invention, we performed haplotype construction and polygenic score (PGS) analysis on the genotype data of 247 individuals in Example 1.

[0093] Haplotype analysis: The haplotypes formed by the four SNP loci were inferred using PHASE software (v2.1). Five major haplotypes were identified (frequency > 1%), with haplotype H1 (ACTT) being the dominant haplotype. Individuals were grouped according to the haplotype combinations they carried, and then subjected to analysis of variance. The results are shown in Table 6. Individuals carrying two copies of the H1 haplotype (H1 / H1) had the highest content of flavor compounds, which was significantly higher than that of individuals with other haplotype combinations (P < 0.001). This clearly demonstrates that the specific haplotypes formed by the combination of the four loci have a synergistic effect, and their predictive accuracy is far superior to that of any single locus.

[0094] Table 6: Correlation analysis between different haplotype combinations and flavor compound content

[0095] Note: Different letters in the same row indicate highly significant differences (P < 0.01). H1: ACTT; H2: GTCA;

[0096] Polygenic Score (PGS) Analysis: To further quantify the combined effects of multiple loci, we constructed a polygenic score model based on the genotypes of four SNP loci and their effect values ​​(β) in the association analysis. The PGS value for each individual was calculated and regressed with flavor compound content. The results showed a highly significant positive correlation between PGS and flavor compound content (R² = 0.47). The prediction accuracy using PGS (0.68) was significantly higher than that using the single locus with the highest effect value (chr3:100011656, R² = 0.31). This indicates that joint selection using the multi-locus combination provided by this invention can significantly improve the efficiency and accuracy of breeding selection.

[0097] Conclusion: The above results fully demonstrate that the specific combination of 4 SNP sites provided by this invention solves the problems of insufficient prediction ability and unstable selection effect of single markers through its synergistic effect.

[0098] Example 5: Kit composition and detection example.

[0099] The present invention also provides a kit for detecting the SNP molecular marker combination. The kit comprises the following components:

[0100] Table 7 Reagent Kit Composition

[0101] Reagent kit usage procedure (taking sequencing genotyping as an example):

[0102] PCR reaction system preparation: Take a sterile PCR tube and prepare the reaction solution according to the system shown in the table. Table 8 PCR reaction system

[0104] PCR amplification: Place the prepared reaction tubes in a PCR instrument and run the following program: 94℃ pre-denaturation for 5 min; 35 cycles (94℃ 30 s, 60℃ 30 s, 72℃ 45 s); 72℃ final extension for 10 min; store at 4℃.

[0105] Detection of amplified products: 5 μL of PCR product was subjected to 1.5% agarose gel electrophoresis to verify whether a specific band of about 500 bp was successfully amplified.

[0106] Purification and sequencing: The remaining PCR products were sent to a professional sequencing company for purification and bidirectional Sanger sequencing.

[0107] Genotyping analysis: SeqMan and other software were used to align the sequencing peak diagram with the reference sequence to determine the genotypes of the four SNP loci.

[0108] The SNP site coordinates are based on the chicken reference genome Galgal6 version, and its corresponding amplified fragment sequence is shown in SEQ ID NO: 1. If other genome versions are used, the same sites can be located through sequence alignment.

[0109] Sequence list: SEQ ID NO: 1: Amplified fragment sequence (498 bp) GCTGCCACTGCGGCTGTGTGCTGGGAGCCGGGTGCAGCCCTTCCTGTGCCAGCTGAGCGCCTGAGCCCCACATGCTCCCAGGTTGTAGCAAATGCCAGCTAGCAAGGAGTGCATGTGAAGGACAGATGCTCTGTGTAGGCTGACCTGAGCTGGGG TTGGAGTGAGCAGCAGAGTTGGGCAGCATCTTTCCTAGCAGCCTGTCCATCCTCCCGGTTACTTGCAAGTGGGTTGTGGCCAGGTTTGCTTATTCTCCTGGAATCCCTCTCTGGCTCTCCCTAAGCCCATTTGTTTGCAGCATACGTCCTAAAGGC TCTTGGTTTAAAGAACTTGTTTACTTGCTACGGGGCACATATATTAAAAAGCCCTGCCCAAGGCTAATGACTAGAAACAAGACTCAAGTCTCCAAACTCACATCATTCTCTGCTTTGCAAATTTTCAGTTACGGGATCCCTGCCAAGGACACAT AATAAAACAGAGCTCATGAATAAATGAAATGTATTCCACTAACCTGTGGATATTTTCTTCTAATCTTGCCATTGCCCTCCTATATATTCTTTCCTCTTGTCCTTCCATTCTTTTCTGTTTAGCTTCTTTCTTCTTTTCTGGAATTTGCATTCCCC

[0110] SNP locus location:

[0111] - chr3:100011635: Located at position 100 of SEQ ID NO: 1

[0112] - chr3:100011636: Located at position 101 of SEQ ID NO: 1

[0113] - chr3:100011645: Located at position 110 of SEQ ID NO: 1

[0114] - chr3:100011656: Located at position 121 of SEQ ID NO: 1.

[0115] This invention can accurately screen high-quality chicken breeds, improve the flavor and quality of meat products, and solve the problems of long breeding cycles, low efficiency and poor selection accuracy of high-quality chickens. It provides an efficient and reliable molecular technology for the early selection of chicken flavor traits, and significantly accelerates the breeding process.

Claims

1. A method for screening chicken individuals with high levels of volatile flavor compounds, characterized in that, This was performed by detecting the genotypes of the following four SNP loci in the chicken genome: a) The SNP site located at position 100011635 on chicken chromosome 3 has a base mutation of G>A; b) The SNP site located at position 100011636 on chicken chromosome 3 has a base mutation of T>C; c) The SNP site located at position 100011645 on chicken chromosome 3 has a base mutation of C>T; d) The SNP site located at position 100011656 on chicken chromosome 3 has a base mutation of A>T; The method includes the following steps: (1) Obtain the genomic DNA of the chicken individual to be tested; (2) Detect the genotype of the genomic DNA at the four SNP loci; (3) Screening based on the detection results of step (2): Select individuals with genotypes AA, CC, TT and TT at 4 loci, whose volatile flavor content is significantly higher than the average level of the population.

2. The method according to claim 1, characterized in that, The SNP site is located within the chicken KCNS3 gene region.

3. The method according to claim 1 or 2, characterized in that, The detection described in step (2) is performed in the following manner: Genomic DNA fragments containing the four SNP sites were amplified using specific primer pairs, and then the amplified products were sequenced or genotyped by enzyme digestion. The specific primer pair sequences are as follows: Upstream primer F: 5′-CCTTCCTGTGCCAGCTGAG-3′; Downstream primer R: 5′-AGAGAGGGCAATGGCAAGAT-3′.

4. A kit for assisting in the selection of volatile flavor traits in chicken meat, characterized in that, The kit includes the specific primer pair as described in claim 3.

5. The reagent kit according to claim 4, characterized in that, The kit also includes one or more reagents for PCR amplification, enzyme digestion, or sequencing.

6. A method for breeding high-flavor-quality chicken strains, characterized in that, This includes using the method described in any one of claims 1 to 3 to screen individuals with high volatile flavor compound content as parents for breeding.

7. The use of the kit according to claim 4 or 5 in screening chicken individuals with high levels of volatile flavor compounds.

Citation Information

Patent Citations

  • HRM (high resolution melting) joint detection method for ADSL (adenylosuccinate lyase) and LPL (lipoprotein lipase) genes related to meat quality and flavor of chicken

    CN102154504A

  • Primer combination for detecting Langya chicken specific genetic loci and application

    CN112626226A

  • Molecular marker related to chicken slaughtering and meat quality traits and breeding method of high-quality and slaughtering processing type new strain

    CN116179714A