Oat KASP markers, fingerprints and applications

By constructing a fingerprint map of oat varieties and utilizing KASP marker combinations of 96 SNP loci and gene chips, the problem of confusion and doubt about the authenticity of oat seed varieties in the market has been solved, achieving efficient and accurate variety identification and screening, and supporting the high-quality development of the oat industry.

CN121496100BActive Publication Date: 2026-04-24INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2026-01-14
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

The oat seed market suffers from confusion in variety identification and doubts about seed authenticity, which limits the development of the oat industry. Existing technologies lack efficient and accurate methods for variety identification.

Method used

A set of KASP marker combinations containing 96 SNP loci was developed to construct a characteristic fingerprint map of oat varieties. Through gene chip detection and primer combination, varieties can be identified, screened, traced, and identified in terms of phylogenetic relationships, providing support for the protection and improvement of oat germplasm resources.

Benefits of technology

It enables precise identification and screening of oat varieties, solves the problems of variety confusion and doubts about seed authenticity, and supports the standardized development of the oat industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121496100B_ABST
    Figure CN121496100B_ABST
Patent Text Reader

Abstract

The application discloses an oat KASP marker, a fingerprint and application, and relates to the technical field of molecular breeding. The KASP marker comprises 96 SNP sites, the position information and polymorphism of which are shown in Table 1. The application further provides a gene chip for analyzing the KASP marker and an oat variety characteristic fingerprint constructed by using the KASP marker. The KASP marker, the gene chip and the oat variety characteristic fingerprint provided by the application can be used for screening, identifying and tracing oat quality, identifying the authenticity of seeds and the genetic relationship between oat parents and offspring, and have important significance for the protection and improvement of oat germplasm resources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular breeding technology, specifically to a KASP marker combination for constructing characteristic fingerprint profiles of feed oat varieties and its application. Background Technology

[0002] Oats (Avena sativa L.) are annual herbaceous plants belonging to the genus Avena in the subfamily Pooideae of the family Poaceae. They are an important crop globally, serving both food production and forage supply. Among them, forage oats, due to their high biomass yield, excellent nutritional value, and strong stress resistance, have become one of the key forage resources for addressing the shortage of forage in northern winter and spring pastures, and hold an irreplaceable position in the optimization of the forage industry structure and the process of sustainable development.

[0003] In recent years, with the accelerated development of large-scale and intensive animal husbandry, the planting area of ​​oat hay has shown a year-on-year increasing trend, and the industry scale has continued to expand. However, the problems of chaotic variety identification and doubtful seed authenticity at the upstream of the oat hay production chain have become increasingly prominent, specifically manifested in two core irregularities: "different names for the same species" (seeds of the same genotype corresponding to different variety names) and "different species with the same name" (seeds of different genotypes corresponding to the same variety name). This phenomenon directly leads to an imbalance in the oat seed market order, which not only restricts the standardized promotion and application of high-yield and high-quality oat varieties, but also forms a significant bottleneck for the high-quality development of the oat industry.

[0004] Oats are allohexaploid self-pollinating crops with a large genome and a high proportion of repetitive sequences, which has significantly hampered the development of molecular breeding technologies for oats compared to major food crops. With the iteration and widespread adoption of high-throughput sequencing technology, a large number of single nucleotide polymorphisms (SNPs) have been discovered in the oat genome. These SNP sites are characterized by low mutation rates, genetic stability, high genomic density, significant specificity, and ease of automated detection, making them suitable for further development into competitive allele-specific PCR (KASP) markers. Genotypic analysis of different KASP marker combinations can enable precise differentiation and identification of different oat varieties.

[0005] Currently, in major crops such as rice, corn, wheat, and soybean, standards or technical systems for variety authenticity identification based on complete sets of KASP markers have been gradually established and applied. In contrast, a standardized KASP marker identification system has not yet been formed in the oat field. Therefore, screening core SNP sites based on oat genome variation maps and then developing a set of efficient and accurate KASP marker combinations specifically for oat variety identification has become an urgent need in the current oat industry development and molecular breeding research field. Summary of the Invention

[0006] To address the current lack of efficient and accurate methods for identifying oat varieties, this invention provides a KASP marker containing 96 SNP loci for analyzing and detecting oat varieties. In particular, the gene chip used for detecting the marker and the oat variety characteristic fingerprint map constructed using the KASP marker can be used to screen, identify, and trace the quality of oats, distinguish the authenticity of seeds, and determine the kinship between parent and offspring of oats, providing important support for the protection and improvement of oat germplasm resources.

[0007] To achieve the technical objective of this invention, the first aspect of this invention provides a molecular marker for analyzing oat varieties, comprising 96 SNP sites, the location information and polymorphism of which are shown in Table 1:

[0008] Table 1. Location information and polymorphism of oat KASP markers

[0009]

[0010] The SNP sites were determined based on comparison with the Marvellous reference genome.

[0011] To achieve the technical objective of this invention, a second aspect of this invention provides an oat gene chip for detecting the molecular markers in Table 1 above.

[0012] To achieve the technical objective of this invention, a third aspect of this invention provides a KASP marker for analyzing oat varieties, comprising primer combinations with nucleotide sequences as shown in SEQ ID NO.1-SEQ ID NO.288.

[0013] To achieve the technical objective of this invention, a fourth aspect of this invention provides a characteristic fingerprint of oat varieties, which records the genotyping results of the SNP sites shown in Table 1 of oat varieties.

[0014] In particular, the map is obtained by using the oat KASP markers mentioned above to detect multiple collected oat varieties, obtaining the genotyping results of each SNP in each oat variety, and the genotyping results of all markers of multiple oats form an oat variety characteristic fingerprint map.

[0015] To achieve the technical objective of this invention, a fourth aspect of this invention provides the application of the above-mentioned molecular markers, gene chips, KASP markers, and the above-mentioned oat variety characteristic fingerprints in any of the following:

[0016] S1. Application in oat variety identification;

[0017] S2. Application in oat variety selection;

[0018] S3. Application in oat variety traceability;

[0019] S4. Application in oat breeding;

[0020] S5. Application in the conservation of oat germplasm resources;

[0021] S6. Application in oat germplasm resource improvement;

[0022] S7. Application in oat pedigree reconstruction;

[0023] S8. Application in oat kinship identification;

[0024] S9. Application in identifying the authenticity of oat seeds.

[0025] Beneficial effects:

[0026] The SNP loci provided by this invention, along with the gene chip, KASP marker, and fingerprint spectrum prepared based on these loci, can accurately identify varieties at the forefront of the oat grass production chain, solving the problems of oat confusion and doubts about seed authenticity. This provides important support for maintaining order in the oat seed market and promoting the standardized application of high-yield and high-quality oat varieties. Attached Figure Description

[0027] Figure 1 The visualization results of the oat variety characteristic fingerprint constructed in this embodiment of the invention are shown in the figure. The vertical axis represents variety information, and the horizontal axis represents the genotyping results of 96 KASP markers. Blue squares indicate that the locus is the same as the reference genome locus and is homozygous 0 / 0. Red squares indicate that the locus is different from the reference genome locus and is homozygous 1 / 1. Green squares indicate that the locus is heterozygous 0 / 1. Gray squares represent the deletion of the locus. Detailed Implementation

[0028] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. The bioinformatics software and products used in the present invention are all commercially available. Various processes and methods not described in detail are all conventional methods known to those skilled in the art. The source of materials used, trade names, and components that need to be listed are indicated when they first appear. Unless otherwise specified, the same reagents used thereafter are the same as those initially indicated.

[0029] Example 1: Obtaining the KASP tag

[0030] A natural population of 180 oat germplasm resources was constructed. Genome sequencing was performed using simplified genome sequencing to obtain raw reads for each sample. Clean reads were then filtered and aligned to the Marvellous reference genome using BWA MEM. SNPs were called using GATK v4.1 software, and the raw SNP data underwent rigorous quality control using bioinformatics tools such as PLINK v1.9, with parameters set as follows: deletion rate ≤ 0.1%, heterozygosity ≤ 0.1%, and minimum allele frequency (MAF) ≥ 0.2. Finally, 200 high-quality SNP loci were obtained.

[0031] The sequences of the above 200 SNP sites were extracted 100 bp upstream and downstream, and the sequences were compared with the Marvellous reference genome using the software blast v2.10.1. SNP sites that could be matched to multiple locations were removed, and single matching SNP sites were retained.

[0032] Following the principles of KASP-labeled primer design, primers were designed for the retained SNP sites using the primer design software Primer3 v2.4.0. Fluorescent sequence tags “FAM” (GAAGGTGACCAAGTTCATGCT) and “HEX” (GAAGGTCGGAGTCAACGGATT) were added to the front end of the primers, respectively. The primers were then sent to Sangon Biotech (Shanghai) Co., Ltd. for primer synthesis, converting all the above SNP sites into KASP-labeled primers.

[0033] Twenty leaf DNA samples were randomly extracted from oat germplasm for KASP marker polymorphism verification. The PCR amplification system was as follows: 10 μL reaction volume, containing 5 μL of 2×KASP master mix, 20 ng of DNA, and 1 μL of primer mixture (primer mixture consisted of 6 μL of upstream primer F1, 6 μL of upstream primer F2, 15 μL of downstream primer R, and 23 μL of ddH2O). The PCR amplification program was as follows: 95℃ pre-denaturation for 15 min, 95℃ denaturation for 20 s, annealing and extension at 61℃ for 40 s, 95℃ denaturation for 20 s, repeated for 10 cycles, with the annealing temperature decreasing by 0.6℃ per cycle; followed by 55℃ annealing and extension for 40 s, for 32 cycles.

[0034] After obtaining the PCR products, fluorescence data were read using the ABI Q7 real-time quantitative PCR system to complete genotyping (genotypes stimulating FAM fluorescence were homozygous, those stimulating HEX fluorescence were homozygous, and those stimulating both FAM and HEX fluorescence were heterozygous). Marker sites showing shifts or allele frequencies less than 0.25 in the negative control (NTC) were removed, retaining 96 KASP markers with good genotyping results. The SNP site information of these markers is shown in Table 1. The corresponding KASP marker primers are shown in Table 2, and their nucleotide sequences are shown in SEQ ID NO.1-SEQ ID NO.288.

[0035] Table 1 SNP locus information

[0036] Table 2 KASP marker primer sequence information

[0037]

[0038]

[0039] Example 2: Construction of fingerprint profiles for 85 oat varieties

[0040] Eighty-five oat varieties were collected for fingerprinting. All of these oat varieties are preserved by the Forage Germplasm Resources Collection, Conservation and Utilization Science and Technology Innovation Team of Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences. Their names and sources are shown in Table 2.

[0041] Table 2

[0042]

[0043] Genomic DNA was extracted from leaves of the above 85 oat varieties, and genotyping was performed using the 96 KASP markers developed above. The PCR amplification system was as follows: 10 μL reaction volume, including 5 μL of 2×KASP master mix, 20 ng of DNA, and 1 μL of primer mixture (the primer mixture consisted of 6 μL of upstream primer F1, 6 μL of upstream primer F2, 15 μL of downstream primer R, and 23 μL of ddH2O). The PCR amplification program was as follows: 95℃ pre-denaturation for 15 min, 95℃ denaturation for 20 s, annealing and extension at 61℃ for 40 s, 95℃ denaturation for 20 s, repeated for 10 cycles, with the annealing temperature decreasing by 0.6℃ per cycle; followed by 55℃ annealing and extension for 40 s, for 32 cycles. After obtaining the PCR products, fluorescence data were read using the ABI Q7 real-time quantitative PCR system. Genotyping results for 96 KASP markers were obtained for each oat variety, resulting in a fingerprint library containing characteristics of 85 oat varieties. The visualization results are shown below. Figure 1 As shown in the figure, the vertical axis represents variety information, and the horizontal axis represents the genotyping results of 96 KASP markers. Blue squares indicate that the locus is the same as the reference genome locus, which is homozygous (0 / 0); red squares indicate that the locus is different from the reference genome locus, which is homozygous (1 / 1); green squares indicate that the locus is heterozygous (0 / 1); and gray squares represent the deletion of the locus.

[0044] Application Example 1: Variety Analysis of Oat Seeds

[0045] By utilizing the established KASP molecular marker system and fingerprint database of 85 oat varieties, oat seeds can be identified, screened, bred, and used in the conservation of oat germplasm resources. The following describes the use of the 96 KASP molecular marker system and fingerprint database of 85 oat varieties provided by this invention to perform genotyping on oat seed samples, match varietal fingerprint characteristics, identify the variety to which the sample belongs, or exclude non-target varieties, thus achieving precise variety identification and screening. Specific implementation methods are as follows:

[0046] Ten oat seeds from each of 15 unknown varieties were collected. A small tissue sample was cut from the embryo or endosperm of the oat seed for DNA sample extraction. Genotyping of 150 DNA samples from the 15 varieties was performed using 96 developed KASP molecular markers, following the same method as in Example 1. The genotyping results of the 15 unknown varieties were compared one by one with the standard fingerprints of 85 varieties established in Example 2, and the matching rate (number of matching sites / total number of marker sites × 100%) was calculated.

[0047] The judgment criteria can be adjusted according to different analytical purposes. In one embodiment of the present invention, the following criteria can be used to determine whether the varieties are the same: Complete match: Match rate = 100%, and all heterozygous / homozygous loci are completely identical; the unknown sample is determined to be the standard variety. High match: Match rate ≥ 98%, and the number of differing loci ≤ 2; after verification with agronomic traits, it is determined to be the standard variety. Partial match: Match rate 90%-97%, and the number of differing loci 3-9; it is determined to be a closely related variety. No match: Match rate < 90%, and the number of differing loci > 9; the unknown sample does not belong to any of the 85 standard varieties. Based on the above judgment results, the oat variety identification results are shown in Table 3.

[0048] Table 3

[0049]

[0050] As shown in the table, the KSAP markers and fingerprints provided by this invention can accurately identify the 85 varieties covered by this invention, as well as closely related varieties and new varieties. This enables the screening and identification of oat varieties, which is beneficial for oat breeding and the protection of oat germplasm resources.

[0051] Application Example 2: Authenticity Identification of Hybrid F1 Generation

[0052] In oat breeding, identifying the authenticity of F1 hybrids is crucial. Traditional methods rely on whether the F1 generation exhibits phenotypes distinct from the parents or on phenotypic segregation in the F2 generation, which are costly and inaccurate. However, the 96 KASP molecular markers provided in this invention can identify the authenticity of F1 hybrids at the seedling stage (or other stages where biological samples are available, such as seeds). The specific implementation method is as follows:

[0053] Genomic DNA was extracted from leaves of the maternal parent, paternal parent, and hybrid F1 generation, and genotyping was performed on the above samples using 96 developed KASP molecular markers, following the same method as in Example 1. After obtaining the genotyping results of the above three samples at 96 loci, the authenticity was determined according to the F1 generation inheritance law (i.e., the true hybrid F1 generation should show a heterozygous genotype at the parental polymorphic marker loci).

[0054] The criteria for determining true hybrids are as follows: true hybrids: heterozygosity of effective marker loci ≥ 95%, and no five or more consecutive loci completely identical to the genotype of the father / mother; suspected hybrids: heterozygosity of 85%-94%, with three to five loci identical to the father / mother, requiring re-extraction of DNA from the sample for secondary verification; false hybrids: heterozygosity < 85%, or ≥ 10 loci completely identical to the genotype of the mother (or father), and are determined to be non-true F1 generation (possibly self-crossed offspring or mixed samples).

[0055] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of 96 SNP loci in oat variety analysis: The location information and polymorphism of the 96 SNP loci are shown in the table below: ; The SNP sites were determined based on comparison with the Marvellous reference genome.

2. Analyze the KASP marker primer combinations for oat varieties, which include primer combinations with nucleotide sequences as shown in SEQ ID NO.1-SEQ ID NO.

288.

3. A method for constructing a characteristic fingerprint map of oat varieties, comprising using the KASP marker primer combination described in claim 2 to detect the 96 SNP sites described in claim 1 in multiple collected oat varieties, obtaining the genotyping results of each SNP in each oat variety, and forming an oat variety characteristic fingerprint map by genotyping results of all markers in multiple oat varieties.

4. The application of the 96 SNP sites described in claim 1, the primer combination described in claim 2, or the fingerprint spectrum described in claim 3 in oat variety identification.

5. The application of the 96 SNP sites described in claim 1, the primer combination described in claim 2, or the fingerprint spectrum described in claim 3 in oat variety screening.

6. The application of the 96 SNP sites described in claim 1, the primer combination described in claim 2, or the fingerprint pattern described in claim 3 in oat breeding.

7. The application of the 96 SNP sites described in claim 1, the primer combination described in claim 2, or the fingerprint pattern described in claim 3 in the identification of kinship in oats.

8. The application of the 96 SNP sites described in claim 1, the primer combination described in claim 2, or the fingerprint spectrum described in claim 3 in identifying the authenticity of oat seeds.

Citation Information

Patent Citations

  • KASP primer group and method for distinguishing and identifying oat varieties

    CN118421826A

  • SNP (Single Nucleotide Polymorphism) molecular marker combination for constructing oat DNA (Deoxyribonucleic Acid) fingerprint spectrum and application

    CN120041595A