Application of nomuraea sp. 18B9 in resisting pathogenic vibrio
By using Nonomura 18B9 fermentation broth to combat pathogenic Vibrio in aquaculture, the problem of effectively controlling Vibrio diseases in existing technologies has been solved. It has achieved antibacterial effects against Vibrio cannii, Vibrio mimicus, and Vibrio parahaemolyticus, demonstrating its potential to replace traditional antibiotics.
Patent Information
- Application Number
- CN202511495003.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-20
- Publication Date
- 2026-02-13
AI Technical Summary
In existing technologies, vibrio diseases commonly found in Litopenaeus vannamei farming are difficult to control effectively, especially diseases caused by Vibrio cannii, Vibrio mimicus, and Vibrio parahaemolyticus, which occur frequently and result in serious economic losses.
The fermentation broth of Nonomuraea sp. 18B9 was used to antagonize pathogenic Vibrio. The fermentation broth of soybean meal-dextrin medium was used to conduct antibacterial experiments against pathogenic Vibrio such as Vibrio cannii, Vibrio mimicus and Vibrio parahaemolyticus, and verified that its antibacterial effect was better than that of common antibiotics.
Nonomura 18B9 fermentation broth exhibits superior antibacterial ability against pathogens compared to traditional antibiotics to some extent, particularly demonstrating potential application value in controlling diseases caused by Vibrio parahaemolyticus and possessing the potential to replace traditional antibiotics.
Smart Images

Figure SMS_5 
Figure SMS_6
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of microorganisms, in particular to the use of Nonomuraea sp. 18B9 against pathogenic Vibrio. BACKGROUND
[0002] Litopenaeus vannamei is one of the three most cultivated shrimp species in the world. The artificial culture of Litopenaeus vannamei in China began in the 1980s. However, with the expansion of the scale of intensive and high-density culture of shrimp, shrimp diseases have frequently broken out, causing great economic losses to farmers. Many bacterial diseases of Litopenaeus vannamei are caused by bacteria of the genus Vibrio, such as Vibrio harveyi, Vibrio parahemolyticus, Vibrio campbelli, etc. [Liu P C, 1996; Haldar S, 2007; Wang L P, 2013].
[0003] Vibrio parahemolyticus CAIM 1807 was isolated from the hepatopancreas of diseased Litopenaeus vannamei and is pathogenic to post-larvae of Litopenaeus vannamei [Wang L P, 2013]. Vibrio parahemolyticus vp-HL-201910, vp-HL-202005 and vp-HL-202006 were isolated from diseased Litopenaeus vannamei larvae and can cause high-mortality vibriosis (commonly known as glass shrimp disease) in Litopenaeus vannamei [Yang F, 2022]. Vibrio campbelli CAIM 372 was isolated from the lymphoid organs of diseased Penaeus monodon in the Philippines and has virulence to Litopenaeus vannamei [Soto-Rodriguez, 2006].
[0004] Some Vibrio mimicus groups can cause gastrointestinal diseases in humans [Chitov T, 2009]. In recent years, it has been found that Vibrio mimicus is one of the most pathogenic bacteria that threaten the catfish order, causing serious economic losses to its culture [Feng Yang, 2023]. This group has been found in shellfish and water, as well as human diarrhea feces and ear infections [Davis BR, 1981]. Vibrio mimicus ATCC 33653 was isolated from the ear of a female human patient, and the serotype is 106 [Davis BR, 1981]. Key virulence factor genes such as hemolysin (vmhA) and capsular polysaccharide biosynthesis protein exist in the genome of this strain [Guardiola-Avila I, 2013].
[0005] Nonomuraea belongs to Streptosporangiales Streptosporangiaceae in Actinobacteria. It was established in 1998, and there are currently 68 validly published species names. The type species is Nonomuraea pusilla, and the corresponding model strain is isolated from soil environment [Nonomura H, 1997]. Genome mining found that Nonomuraea generally exists in aminoglycoside, beta-lactam, macrolide, glycopeptide, and macrolactam antibiotic resistance genes [Fu Mengmeng, 2025]. SUMMARY
[0006] The purpose of the present application is to provide the use of Nonomuraea sp. 18B9 for resisting pathogenic Vibrio.
[0007] Further, the Vibrio is not limited to Vibrio campbellii, Vibrio mimicus and Vibrio parahaemolyticus.
[0008] Further, the Vibrio campbellii refers to Vibrio campbellii CAIM 372; the Vibrio mimicus refers to Vibrio mimicus ATCC 33653; and the Vibrio parahaemolyticus refers to Vibrio parahaemolyticus CAIM 1807, Vibrio parahaemolyticus vp-HL-201910, Vibrio parahaemolyticus vp-HL-202005 or Vibrio parahaemolyticus vp-HL-202006.
[0009] The embodiments of the present application verify the antibacterial effect of Nonomuraea sp. 18B9. 100 μ μg dose of streptomycin. In Vibrio mimicus ATCC 33653 grown for 10 hours, its antibacterial ability is better than 10 μ μg dose of streptomycin and 50 μ μg dose of oxytetracycline. In Vibrio parahaemolyticus CAIM 1807 grown for 10 hours, its antibacterial ability is better than 10 μ μg dose of streptomycin and 50 μ μg dose of oxytetracycline. In Vibrio parahaemolyticus vp-HL-201910 grown for 10 hours, its antibacterial ability is better than 10 μ μg dose of streptomycin and 50 μ μg dose of oxytetracycline. In Vibrio parahaemolyticus vp-HL-202005 grown for 10 hours, its antibacterial ability is better than 10 μ μg dose of streptomycin and 50 μ μg dose of oxytetracycline. In Vibrio parahaemolyticus vp-HL-202005 grown for 10 hours, its antibacterial ability is better than 10 μOxytetracycline at a dose of 50 μg / mL. The antibacterial ability of the strain was better than that of 10 μ μg / mL streptomycin, 50 μ μg / mL oxytetracycline, and 5 μ μg / mL rifampicin. DETAILED DESCRIPTION
[0010] Embodiments of the present application are described in detail below, examples of which are intended to explain the present application and are not to be understood as limiting the present application. When a specific technique or condition is not mentioned in the embodiments, the technique or condition described in the literature in the art or according to the product manual is used. When a reagent or instrument is not mentioned by the manufacturer, it is a conventional product that can be obtained on the market.
[0011] Example 1: Isolation and identification of N. sp. 18B9 1. Isolation technique: The sample was collected from the surface sediment of 0-3 cm in the northern South China Sea basin, the water depth was 3300 meters, the collection time was October 2016, and the sample was stored in a 4 ℃ refrigerator by a sterile sampling bag. After being transported back to the laboratory, the sample was suspended with sterile seawater, and gradient dilution method was used to spread it on R2A and 2216E agar media, and cultured at 28 ℃ for 2-15 days, and the growth of colonies in each dilution gradient was observed at any time. For the dilution gradient that can form single colonies, according to the colony diversity, the plate was appropriately spread. Single colonies were picked and purified by at least 3 times of streaking to obtain pure culture strains. The purified strains were stored in 20% glycerol solution, mixed thoroughly, and then transferred to a cryogenic tube and stored in a -80 ℃ ultra-low temperature refrigerator for standby.
[0012] 2. Sequence determination and analysis of 16S rDNA The obtained strain was cultured in the corresponding medium at 28 ℃ for 2 weeks, and the bacterial cells were collected by centrifugation at 160,000 r / min for 30 s. The genomic DNA of the bacteria was extracted using a QIAGEN silica gel membrane type TM bacterial genomic DNA extraction kit according to the instruction method. μ L of DNA template, i.e., the collected bacterial cell DNA (~50 ng), 1 μ L of forward primer (10 μ M), 1 μ L of reverse primer (10 μ M), 25 μ L of premix, 22 μ L of deionized water as the reaction system for PCR amplification. The forward primer is 27F (5′ AGAGTTTGATCCTGGCTCAG 3', SEQ ID NO: 1), and the reverse primer was 1492R (5'- ACGGCTACCTTGTTACGACT 3', SEQ ID NO: 2). The 16S rDNA gene fragments were amplified from the genomic DNA, and the PCR products were sent to Shanghai Meiji Biomedicine Technology Co., Ltd. for sequencing. After the sequencing, the sequences were subjected to head and tail low-quality base removal and sequence splicing to obtain the 16S rRNA gene sequence.
[0013] After removing the same sequence strains, 56 strains of different sequences were obtained from the sample.
[0014] The 16S rRNA gene sequences of the 56 different strains were subjected to blast comparison in the Korean EzBiocloud database (https: / / www.ezbiocloud.net / ). The analysis results showed that the 56 strains belonged to 20 genera. The most were Paenibacillus (21 strains), and there was only one strain of each of the other 8 genera. Through subsequent analysis of the antagonistic experiment, Nonomuraea 18B9 had good resistance to aquatic pathogenic microorganisms. The strain had a similarity of 99.21% with the model strain Nonomuraea aurantiaca NEAU-L178, and the identification result was Nonomuraea aurantiaca. The identification sequence is shown as SEQ ID NO: 3. The strain was preserved in the China Center for Type Culture Collection. The detailed information is as follows: Paenibacillus Strain name: Nonomuraea sp. 18B9 Preservation center: China Center for Type Culture Collection.
[0015] Preservation address: China. Wuhan. Wuhan University. China Center for Type Culture Collection.
[0016] Preservation time: August 14, 2025.
[0017] Preservation number: CCTCC NO: M 20251827.
[0018] The 16S rRNA gene sequence (1934 bp) of strain 18B9 is as follows:
[0019] 3. Strain morphology Nonomuraea sp. 18B9 was grown on 2216E medium at 28°C, with aerial hyphae orange-pink and subterranean hyphae light orange-pink, producing white spores.
[0020] 4. Whole genome analysis of the strain According to the results of genome annotation, the genome of Nonomuraea sp. 18B9 contains 15 new gene clusters with similarity to known biosynthetic clusters (BGC) below 50%. They are non-ribosomal peptides (NRP), polyketides, alkaloids, terpenes, and other natural products (see Table 1 for details).
[0021] Table 1. Similarity of new biosynthetic gene clusters of Nonomuraea sp. 18B9
[0022] Example 2: Resistance experiment The pathogenic bacteria antagonism test used the punch method.
[0023] After activation of the test strain Nonomuraea sp. 18B9, the bacterial mass was scraped from the plate and cultured in 5 mL 2216E liquid medium for 4 days as seed liquid. The seed liquid was inoculated into a 250 mL conical flask containing 50 mL soybean cake-pullulan liquid medium (for example, 1 L soybean cake-pullulan liquid medium contains 30.0 g glucose, 9.0 g yeast extract powder, 5.0 g peptone, 15.0 g soybean cake powder, 12.0 g pullulan, 1.0 L distilled water or (RO water), pH 7.0) at 25°C, 150 r / min for 21 days to reach the late logarithmic growth phase, and then used as the test bacteria liquid for antagonism test.
[0024] (2) The test pathogenic strain such as Vibrio campbellii CAIM 372, etc. (see Table 2) was cultured on 2216E agar plates at 28°C, and fresh bacterial cells activated for about 1 day were scraped into the corresponding liquid medium, and the OD 600 value was adjusted to about 0.4 ~ 0.5 (concentration about 1 × 10 8 ~ 4 × 10 8 cfu / mL). The test bacteria liquid with adjusted OD 600 was diluted 1000 times, and 100 μL was uniformly coated on the corresponding plate medium.
[0025] (3) The plate medium was punched with a 1 mL sterile pipette tip (diameter about 8 mm), and then 100 μ L of the test bacteria solution was added to the medium hole.
[0026] (4) The antibiotic control was tested by paper disc method, and the diameter of the paper disc was 6 mm. The doses of each antibiotic were chloramphenicol 30 μ g / disc, novobiocin 30 μ g / disc, ciprofloxacin 5 μ g / disc, furazolidone 100 μ g / disc, streptomycin 10 μ g / disc, erythromycin 15 μ g / disc, terramycin 50 μ g / disc.
[0027] (5) After 10 h of incubation in a 28°C incubator, the test bacteria solution grew on the entire plate, and the inhibition zone was observed and measured. The antagonistic effect results are shown in Table 2.
[0028] Table 2. Inhibition zone diameter test of fermentation broth of N. nomurai 18B9 on test bacteria (unit: mm)
[0029] Note: C: chloramphenicol; NV: novobiocin; CIP: ciprofloxacin; FZ: furazolidone; S: streptomycin; OT: terramycin; E: erythromycin; RA: rifampicin; T1: Vibrio campbellii CAIM 372; T2: Vibrio mimicus ATCC 33653; T3: Vibrio parahaemolyticus CAIM 1807; T4: Vibrio parahaemolyticus vp-HL-201910; T5: Vibrio parahaemolyticus vp-HL-202005; T6: Vibrio parahaemolyticus vp-HL-202006.
[0030] No inhibition zone was observed.
[0031] § There was a small amount of test bacteria growing in the inhibition zone (the density of test bacteria in the inhibition zone was about 30 ~ 50 % of the density of test bacteria outside the inhibition zone).
[0032] The inhibition index was calculated by using the following formula to evaluate the resistance of the fermentation broth and antibiotics to the pathogenic bacteria.
[0033] Inhibition index = (inhibition zone diameter - agar hole diameter) / agar hole diameter x 100 % or (inhibition zone diameter - test paper disc diameter) / test paper disc diameter x 100 %.
[0034] The following two cases are judged as the fermentation broth has better antibacterial ability than antibiotics or both have equivalent effects: (1) When there are certain test bacteria growing in the inhibition zone, the fermentation broth has higher inhibition index than antibiotics; (2) There is no test bacteria growing in the antibiotic inhibition zone, while there is a certain amount of test bacteria growing in the fermentation broth inhibition zone, and the fermentation broth inhibition index is more than one time higher than that of antibiotics.
[0035] The soybean cake powder-dextrin fermentation broth of Nonomuraea sp. 18B9 showed certain resistance activity to the above 6 test pathogenic strains, and the inhibition ability to some pathogenic bacteria was better than that of antibiotics or both had equivalent effects. Although it was not as good as antibiotics in some cases, it can be improved in the future by increasing the yield or genetic modification to enhance the potency, and it has potential to replace antibiotics. This strain has application value in controlling Vibrio disease in aquaculture, especially the disease caused by Vibrio parahaemolyticus. The antibacterial ability of the fermentation broth of this strain to each of the test strains is as follows: (1) For Vibrio campbellii CAIM 372, the soybean cake powder-dextrin fermentation broth of Nonomuraea sp. 18B9 could produce an inhibition zone with a diameter of 12.8 mm, and the inhibition index was 60%, with a certain amount of test bacteria growing in the inhibition zone, indicating that it could play a certain role in the early growth of the pathogenic bacteria. The positive control antibacterial situation was as follows: chloramphenicol antibacterial rate was 352%; neomycin inhibition index was 168%; ciprofloxacin inhibition index was 85%; furazolidone inhibition index was 152%; streptomycin inhibition index was 37%; oxytetracycline inhibition index was 0%; erythromycin inhibition index was 110%; rifampicin inhibition index was 203%, with a small amount of test bacteria growing in the inhibition zone. Compared with the above, the 100 μ L soybean cake powder-dextrin fermentation broth had better antibacterial ability than 10 μ g dose of streptomycin in the 10-hour growth stage of Vibrio campbellii CAIM 372.
[0036] (2) For Vibrio mimicus ATCC 33653, an inhibition zone with a diameter of 17.0 mm could be produced, and the inhibition index was 113%, with a certain amount of test bacteria growing in the inhibition zone, indicating that it could play a certain role in the early growth of the pathogenic bacteria. The positive control antibacterial situation was as follows: chloramphenicol antibacterial rate was 383%, with a small amount of test bacteria growing in the inhibition zone; neomycin inhibition index was 183%, with a small amount of test bacteria growing in the inhibition zone; ciprofloxacin inhibition index was 317%, with a small amount of test bacteria growing in the inhibition zone; furazolidone inhibition index was 333%; streptomycin inhibition index was 0%; oxytetracycline inhibition index was 83%, with a small amount of test bacteria growing in the inhibition zone; erythromycin inhibition index was 150%; rifampicin inhibition index was 133%. Compared with the above, the 100 μL-bean cake powder-dextrin fermentation broth at the 10-hour stage of Vibrio mimicus ATCC 33653 growth was better than 10 μ g doses of streptomycin and 50 μ g doses of terramycin.
[0037] (3) Against Vibrio parahaemolyticus CAIM 1807, it could produce an inhibition zone with a diameter of 10.7 mm and an inhibition index of 34%, and a certain amount of test bacteria grew in the inhibition zone, indicating that it could play a certain role in the early growth of the pathogenic bacteria. The antibacterial situation of the positive control was as follows: the chloramphenicol antibacterial rate was 358%, and a small amount of test bacteria grew in the inhibition zone; the neomycin inhibition index was 172%; the ciprofloxacin inhibition index was 48%; the furazolidone inhibition index was 142%; the streptomycin inhibition index was 17%; the terramycin inhibition index was 0%; the erythromycin inhibition index was 93%, and a small amount of test bacteria grew in the inhibition zone; and the rifampicin inhibition index was 200%. By comparison, the 100 μ L-bean cake powder-dextrin fermentation broth at the 10-hour stage of Vibrio parahaemolyticus CAIM 1807 growth was better than 10 μ g doses of streptomycin and 50 μ g doses of terramycin.
[0038] (4) Against Vibrio parahaemolyticus vp-HL-201910, it could produce an inhibition zone with a diameter of 9.0 mm and an inhibition index of 13%, and a certain amount of test bacteria grew in the inhibition zone, indicating that it could play a certain role in the early growth of the pathogenic bacteria. The antibacterial situation of the positive control was as follows: the chloramphenicol antibacterial rate was 400%, and a small amount of test bacteria grew in the inhibition zone; the neomycin inhibition index was 200%; the ciprofloxacin inhibition index was 47%; the furazolidone inhibition index was 150%; the streptomycin inhibition index was 33%; the terramycin inhibition index was 50%, and a small amount of test bacteria grew in the inhibition zone; the erythromycin inhibition index was 152%, and a small amount of test bacteria grew in the inhibition zone; and the rifampicin inhibition index was 258%, and a small amount of test bacteria grew in the inhibition zone. By comparison, the 100 μ L-bean cake powder-dextrin fermentation broth at the 10-hour stage of Vibrio parahaemolyticus vp-HL-201910 growth was better than 10 μ g doses of streptomycin and 50 μ g doses of terramycin.
[0039] (5) The vp-HL-202005 can produce an inhibition zone with a diameter of 13.3 mm and an inhibition index of 66%, and a certain amount of the tested bacteria grow in the inhibition zone, indicating that it can play a certain role in the initial growth of the pathogenic bacteria. The positive control antibacterial situation is as follows: the chloramphenicol antibacterial rate is 393%, and a small amount of the tested bacteria grow in the inhibition zone; the newgenomycin inhibition index is 173%; the ciprofloxacin inhibition index is 87%; the furazolidone inhibition index is 115%; the streptomycin inhibition index is 25%, and a small amount of the tested bacteria grow in the inhibition zone; the terramycin inhibition index is 0%; the erythromycin inhibition index is 103%, and a small amount of the tested bacteria grow in the inhibition zone; the rifampicin inhibition index is 212%, and a small amount of the tested bacteria grow in the inhibition zone. By comparison, the soybean cake powder-dextrin fermentation broth of Nomuraea 18B9 has better antibacterial ability than 10 μ g doses of streptomycin, 50 μ g doses of terramycin and 5 μ g doses of rifampicin on the vp-HL-202005 in the 10-hour growth stage.
[0040] (6) The vp-HL-202006 can produce an inhibition zone with a diameter of 12.2 mm and an inhibition index of 53%, and a certain amount of the tested bacteria grow in the inhibition zone, indicating that it can play a certain role in the initial growth of the pathogenic bacteria. The positive control antibacterial situation is as follows: the chloramphenicol antibacterial rate is 240%; the newgenomycin inhibition index is 210%; the ciprofloxacin inhibition index is 118%; the furazolidone inhibition index is 183%; the streptomycin inhibition index is 0%; the terramycin inhibition index is 0%; the erythromycin inhibition index is 77%, and a small amount of the tested bacteria grow in the inhibition zone; the rifampicin inhibition index is 45%, and a small amount of the tested bacteria grow in the inhibition zone. By comparison, the soybean cake powder-dextrin fermentation broth of Nomuraea 18B9 has better antibacterial ability than 10 μ g doses of streptomycin, 50 μ g doses of terramycin and 5 μ g doses of rifampicin on the vp-HL-202006 in the 10-hour growth stage.
[0041] Although the embodiments of the present application have been shown and described above, it should be understood that the above-described embodiments are exemplary and should not be construed as limiting the present application, and those skilled in the art can make changes, modifications, replacements and variations to the above-described embodiments without departing from the principles and purposes of the present application within the scope of the present application.
Claims
1. Nonomuraea sp. 18B9 has been shown to be effective against pathogenic Vibrio.
2. The use as described in claim 1, characterized in that, The Vibrio species are not limited to Vibrio cannibalusae, Vibrio mimicus, and Vibrio parahaemolyticus.
3. The use as described in claim 1, characterized in that, The Vibrio cannibalus refers to Vibrio cannibalusca CAIM 372; Vibrio mimicus refers to Vibrio mimicus ATCC 33653; Vibrio parahaemolyticus refers to Vibrio parahaemolyticus CAIM 1807, Vibrio parahaemolyticus vp-HL-201910, Vibrio parahaemolyticus vp-HL-202005, or Vibrio parahaemolyticus vp-HL-202006.