Burkholderia diphtheria 2143-6 strain and application thereof
By inhibiting multiple fungal diseases in sugarcane using Burkholderia diphtheriae strain 2143-6, the safety and effectiveness issues of sugarcane disease control in existing technologies have been resolved, resulting in improved sugarcane yield and quality.
Patent Information
- Application Number
- CN202511763442.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-27
- Publication Date
- 2026-02-13
AI Technical Summary
Current technologies lack antagonistic strains that can effectively control various fungal diseases in sugarcane, and chemical control methods have safety and environmental issues, making it difficult to effectively control the occurrence of diseases such as sugarcane smut, leaf spot, red rot, brown streak, and ring spot.
A strain of Burkholderia diphtheriae 2143-6 was provided, which can inhibit the growth of sugarcane smut, leaf spot fungus, red rot fungus, brown streak fungus and ring spot fungus, and corresponding microbial preparations were developed for preparation and application.
It effectively reduces the incidence of sugarcane smut, increases sugarcane yield and quality, reduces the use of chemical pesticides, and provides an environmentally friendly disease control solution.
Smart Images
Figure CN121518334A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial and plant disease control technology. More specifically, it relates to a strain of Burkholderia diphtheriae (…). Burkholderia diffusa )2143-6 strain and its application. Background Technology
[0002] sugar cane( Saccharum Sugarcane (spp. hybrids) is an important sugar and energy crop, and ensuring its production is crucial for maintaining sugar security. Besides factors such as temperature and soil conditions, fungal diseases in sugarcane can also affect its growth and lead to yield reduction.
[0003] Sugarcane smut is caused by *Ustilago maydis* (Suaeda salsa). Sporisorium scitamineum Sugarcane red rot is a fungal disease caused by teliospore infection, which seriously affects the yield and quality of sugarcane. Sugarcane red rot is caused by the fungus *Saccharomyces cerevisiae* (also known as sugarcane red rot fungus). Colletotrichum falcatum This disease is caused by various pathogens, primarily affecting the sugarcane stalks and midribs of leaves, but also damaging leaf sheaths and ratoon stalks, thus impacting sugarcane yield and sugar content. Furthermore, sugarcane leaf spot, sugarcane brown streak, and sugarcane ring spot can also negatively affect sugarcane growth, adversely impacting sugarcane production. Therefore, it is necessary to develop formulations that can effectively control sugarcane fungal diseases to mitigate their impact on sugarcane yield and other aspects, ensuring sugarcane production.
[0004] Compared with chemical control methods, biological control using microorganisms has advantages such as safety, environmental friendliness, and sustainability. While there are numerous reports on antagonistic bacteria against sugarcane smut, most have only undergone antifungal efficacy testing. Their effectiveness in controlling sugarcane smut in field environments remains unclear, and not all antagonistic bacteria with significant antifungal effects are effective against the disease. Furthermore, there is a lack of antagonistic strains capable of simultaneously inhibiting multiple sugarcane fungal pathogens; continued research is needed to facilitate the development of sugarcane fungal disease control products. Summary of the Invention
[0005] To address the shortcomings of the prior art, this invention provides a Burkholderia diphtheriae strain 2143-6.
[0006] The first objective of this invention is to provide a strain of Burkholderia diphtheriae.
[0007] A second objective of this invention is to provide the application of the 2143-6 strain in inhibiting the growth of sugarcane smut, sugarcane leaf spot fungus, sugarcane red rot fungus, sugarcane brown streak fungus and / or sugarcane ring spot fungus.
[0008] A third object of the present invention is to provide the use of the 2143-6 strain in the preparation of formulations for inhibiting the growth of sugarcane smut, sugarcane leaf spot fungus, sugarcane red rot fungus, sugarcane brown streak fungus and / or sugarcane ring spot fungus.
[0009] A fourth object of the present application is to provide the use of the 2143-6 strain in the prevention and treatment of sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown stripe and / or sugarcane leaf scald.
[0010] A fifth object of the present application is to provide the use of the 2143-6 strain in the preparation of a preparation for preventing and treating sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown stripe and / or sugarcane leaf scald.
[0011] A sixth object of the present application is to provide a microbial preparation.
[0012] A seventh object of the present application is to provide the use of the microbial preparation in inhibiting the growth of S. scitamineum, Cercospora kikuchii, C. musai, C. zonata and / or C. ramienta.
[0013] An eighth object of the present application is to provide the use of the microbial preparation in the preparation of a product for inhibiting the growth of S. scitamineum, Cercospora kikuchii, C. musai, C. zonata and / or C. ramienta.
[0014] A ninth object of the present application is to provide the use of the microbial preparation in the prevention and treatment of sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown stripe and / or sugarcane leaf scald.
[0015] A tenth object of the present application is to provide the use of the microbial preparation in the preparation of a product for preventing and treating sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown stripe and / or sugarcane leaf scald.
[0016] The above objects of the present application are achieved by the following technical solutions: The present application tests the Burkholderia cenocepacia (B. cenocepacia) 2143-6 strain isolated and screened, and finds that the 2143-6 strain can inhibit the growth of S. scitamineum, reduce the incidence of sugarcane smut, and can be used for the prevention and treatment of sugarcane smut, and reduce the adverse effects of sugarcane smut on sugarcane yield and brix. In addition, the 2143-6 strain also has inhibitory effect on Cercospora kikuchii, C. musai, C. zonata and C. ramienta. Therefore, the present application claims the 2143-6 strain and its related applications. Burkholderia diffusa The present application provides a Burkholderia cenocepacia (B. cenocepacia) 2143-6 strain, which was deposited with the Guangdong Microbial Culture Collection Center on September 2, 2025, and the deposit number is GDMCC No: 66910.
[0017] Burkholderia diffusa The present application provides a Burkholderia cenocepacia (B. cenocepacia) 2143-6 strain, which was deposited with the Guangdong Microbial Culture Collection Center on September 2, 2025, and the deposit number is GDMCC No: 66910.
[0018] The application claims the use of the 2143-6 strain in inhibiting the growth of Sphacelotheca sacchari, Mycosphaerella musicola, Guignardia muscicola, Cercospora kikuchii and / or Cercospora rodmanii.
[0019] The application also claims the use of the 2143-6 strain in the preparation of a preparation for inhibiting the growth of Sphacelotheca sacchari, Mycosphaerella musicola, Guignardia muscicola, Cercospora kikuchii and / or Cercospora rodmanii.
[0020] The application also claims the use of the 2143-6 strain in the prevention and treatment of sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown stripe and / or sugarcane cercospora leaf spot.
[0021] The application also claims the use of the 2143-6 strain in the preparation of a preparation for preventing and treating sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown stripe and / or sugarcane cercospora leaf spot.
[0022] The application also provides a microbial preparation containing the 2143-6 strain and / or a fermentation broth thereof.
[0023] Specifically, the fermentation broth includes a fermentation broth containing the 2143-6 strain or a culture supernatant from which the 2143-6 strain is removed.
[0024] The application also claims the use of the microbial preparation in inhibiting the growth of Sphacelotheca sacchari, Mycosphaerella musicola, Guignardia muscicola, Cercospora kikuchii and / or Cercospora rodmanii.
[0025] The application also claims the use of the microbial preparation in the preparation of a product for inhibiting the growth of Sphacelotheca sacchari, Mycosphaerella musicola, Guignardia muscicola, Cercospora kikuchii and / or Cercospora rodmanii.
[0026] The application also claims the use of the microbial preparation in the prevention and treatment of sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown stripe and / or sugarcane cercospora leaf spot.
[0027] The application also claims the use of the microbial preparation in the preparation of a product for preventing and treating sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown stripe and / or sugarcane cercospora leaf spot.
[0028] The application has the following beneficial effects: The application provides a Burkholderia cenocepacia 2143-6 strain, which was preserved in the Guangdong Microbial Culture Collection Center on September 2, 2025, and the preservation number is GDMCC No: 66910.
[0029] The 2143-6 strain described in this invention can inhibit the growth of sugarcane smut, reduce the incidence of sugarcane smut, and can be used for the prevention and control of sugarcane smut, reducing its adverse effects on sugarcane yield and sugar content. Furthermore, the 2143-6 strain also has inhibitory effects on sugarcane leaf spot fungus, sugarcane red rot fungus, sugarcane brown streak fungus, and sugarcane ring spot fungus, and can be used to develop control products for important sugarcane fungal diseases, thus helping to ensure sugarcane yield and quality. Attached Figure Description
[0030] Figure 1 The images show screening plates for strain 2143-6; the left image shows the plate used as a control for *Ustilago maydis*, and the right image shows the screening plate used for strain 2143-6.
[0031] Figure 2 Phylogenetic tree of strain 2143-6.
[0032] Figure 3 The figures show the mycelial growth of *Ustilago maydis* infecting ROC22 sugarcane buds on day 6, in the treatments of water soaking, *Ustilago maydis* teliospore soaking, and strain 2143-6. Figures A through C represent the mycelial growth corresponding to the water soaking, *Ustilago maydis* teliospore soaking, and strain 2143-6 treatments, respectively.
[0033] Figure 4 The figure shows the mycelial growth of *Ustilago maydis* infecting Liucheng 05-136 sugarcane buds in the following treatments on day 9: water soaking, *Ustilago maydis* teliospore soaking, and strain 2143-6. Figures A through C represent the mycelial growth corresponding to the water soaking, *Ustilago maydis* teliospore soaking, and strain 2143-6 treatments, respectively.
[0034] Figure 5 The results of the inhibition test of strain 2143-6 against sugarcane leaf spot fungus, sugarcane red rot fungus, sugarcane brown streak fungus, sugarcane ring spot fungus and sugarcane slight rot fungus are presented. Detailed Implementation
[0035] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.
[0036] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0037] The 2143-6 strain described in this invention is Burkholderia diphtheriae (… Burkholderia diffusa), and was preserved in the Guangdong Microbial Digital Culture Collection Center on September 2, 2025, at 100, Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province.
[0038] The sugarcane smut fungus (Sporisporium scitamineum) used in the embodiments of the present application is a wild-type positive-negative mating type haploid, which is isolated, identified and preserved by the Sugarcane Research Room of South China Agricultural University. Sporisorium scitamineum The wild-type positive-negative mating type haploid of the sugarcane smut fungus (Sporisporium scitamineum) and the sugarcane smut winter spores are isolated, identified and preserved by the Sugarcane Research Room of South China Agricultural University; the sugarcane leaf spot fungus (Cercospora scytalidum) used, Nigrospora sphaerica the sugarcane pink rot fungus (Guignardia musae) used, Colletotrichum falcatum the sugarcane brown stripe fungus (Cochliobolus miyabeana) used, Bipolaris setariae the sugarcane ring spot fungus (Pseudocercospora scytalidicola) used, Curvularia ischaemi and the sugarcane slight rot fungus (Pseudocercospora scytalidicola) used, Fusarium verticillioides are also isolated, identified and preserved by the Sugarcane Research Room of South China Agricultural University.
[0039] Isolation, screening and identification of strains in Example 1 1. Isolation of strains Through the 5-point sampling method, 0-10 cm sugarcane rhizosphere soil was dug; 45 mL of sterile water and 5 g of rhizosphere soil sample were taken and placed in a 28℃, 280 rpm / min shaking bed to shake for 2 min to prepare a soil suspension; a certain amount of sterile water was added in proportion to perform gradient dilution, and soil suspensions with concentrations of 10 -1 , 10 -2 , 10 -3 , and 10 -4 were obtained; 100 μL of the soil suspension with a concentration of 10 -4 was added to the prepared LB solid culture medium, and a glass applicator was used to evenly spread the bacteria in the plate; the spread plate was sealed and placed in a 28℃ constant temperature incubator for 24 h; single colonies of the grown sugarcane rhizosphere soil bacteria were picked and inoculated into LB liquid culture medium, and were placed in a constant temperature shaking bed at 28℃, 280 rpm / min until the OD 600 =1.0.
[0040] 2. Screening of strains On the left side of the YePS solid culture medium, 1 μL of the wild-type positive-negative mating type haploid of the sugarcane smut fungus was inoculated every 1 cm, a total of 4 inoculations, and 10 μL of the separated rhizosphere soil bacteria liquid (OD 600=1.0), the access of the single haploid colony of the wild type of the positive and negative mating type of the sugarcane smut fungus is surrounded; the right side of the same YePS solid culture medium is inoculated with 1 μL of the wild type of the positive and negative mating type of the sugarcane smut fungus every 1 cm according to the same method, a total of 3 inoculations, and no bacterial liquid of the separated sugarcane rhizosphere soil bacteria is inoculated around, which is used as an in-plate control; and the same wild type of the positive and negative mating type of the sugarcane smut fungus is inoculated according to the above method on the left and right sides of a new YePS solid culture medium, which is used as an out-of-plate blank control (CK); each separated sugarcane rhizosphere soil bacteria is set with three repetitions (3 culture dish plates) according to the above method, and after the plates are sealed, they are placed in a 28℃ constant temperature incubator for culture for 2-3 days; whether the white mycelium of the sugarcane smut fungus grows on the left and right sides of the plate is observed to determine whether the inoculated sugarcane rhizosphere soil bacteria has an antagonistic effect on the sugarcane smut fungus, and the screened antagonistic bacteria are preserved and named.
[0041] Through separation and screening, the present application obtains a strain of sugarcane smut fungus antagonistic bacteria, named 2143-6 strain. The screening plate of the 2143-6 strain is shown in Figure 1 The left graph in the figure is a plate of the sugarcane smut fungus control, and the right graph is a screening plate of the 2143-6 strain. Figure 1 As can be seen, when cultured for 36 h, the wild type of the positive and negative mating type normally mates in the out-of-plate control plate, and more white mycelium appears at each inoculation point; while in the plate inoculated with the bacterial liquid of the 2143-6 strain, the wild type of the positive and negative mating type does not appear white mycelium on the left and right sides, indicating that the positive and negative mating types do not normally mate, that is, the 2143-6 strain can antagonize the sugarcane smut fungus, effectively inhibit the sexual mating of the haploid spores of the sugarcane smut fungus, and inhibit the growth of the mycelium of the sugarcane smut fungus, and the 2143-6 strain is further identified subsequently.
[0042] 3. Molecular identification of the 2143-6 strain The genomic DNA obtained by extraction is used as a template, the 16S rRNA of the 2143-6 strain is amplified by using the 16S rRNA gene amplification primers 338F / 806R, and sequence analysis is performed, sequence comparison is performed on NCBI, and a phylogenetic tree is constructed by using MEGA-X software according to the comparison result.
[0043] The nucleotide sequences of the amplification primers 338F / 806R are as follows: 338F: ACTCCTACGGGAGGCAGCAG; 806R: GGACTACHVGGGTWTCTAAT.
[0044] The reaction program used for amplification was as follows: pre-denaturation: 95℃ for 3 min; denaturation: 95℃ for 15 s, annealing: 55℃ for 15 s, extension: 72℃ for 30 s, for 35 cycles; and final extension: 72℃ for 5 min.
[0045] Phylogenetic tree of strain 2143-6 as follows Figure 2 As shown. By Figure 2 It can be seen that the 16S rRNA sequence of strain 2143-6 is similar to... Burkholderia diffusa The strain is highly similar to U9. That is, strain 2143-6 is *Burkholderia diphtheriae* (…). Burkholderia diffusa It is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCCNo: 66910, deposit date of September 2, 2025, and address of the 5th floor of the Experimental Building, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province.
[0046] Example 2: Effect of strain 2143-6 on the growth of *Ustilago canescens* This invention uses the sugarcane smut-susceptible varieties Xintai Sugar 22 (ROC22) and Liucheng 05-136 as test sugarcane varieties, and tests the effect of strain 2143-6 on the growth of sugarcane smut fungus.
[0047] The experiment included three treatments: CK1 (water soaking), CK2 (soaking in teliospores of *Ustilago maydis*), and T1 (CK2 + strain 2143-6). For each treatment, 20 healthy fresh seedlings of each variety were collected. CK1 seedlings were soaked in water for 30 min, while CK2 seedlings were soaked in water at a concentration of 5 × 10⁻⁶ m³ / min. 6 Soak sugarcane whip spores per mL for 30 min, then use OD... 600 Soak in a bacterial solution of strain 2143-6 with a concentration of 0.8 for 6 hours, then in a solution of 5×10⁻⁶ bacteria. 6 The teliospores of *Ustilago maydis* were soaked in a suspension of 3 spores / mL for 30 min. Each treatment was incubated in a 28℃ light incubator. Samples (sprouts) were taken on days 2, 4, 6, 9, and 12 for co-staining with WGA-AF488 and propidium iodide (PI). The staining method was performed according to the reagent instructions. The mycelial growth of *Ustilago maydis* teliospores in sugarcane sprouts under different treatments was observed and photographed using an inverted fluorescence microscope (Leica DM18).
[0048] On day 6, the mycelial growth of *Ustilago maydis* infected ROC22 sugarcane buds was observed in the following treatments: water soaking (CK1), *Ustilago maydis* teliospore soaking (CK2), and strain 2143-6 (T1). Figure 3 As shown; Figure 3A~C in the table are the mycelium growth of CK1, CK2 and T1 in turn. It can be seen from the observation results that for the ROC22 variety, no green fluorescent mycelium is found in CK1 within 12 days, green fluorescent mycelium is found in CK2 on the 4th day, and the number of mycelium increases and the length of mycelium grows with the sampling time. Green fluorescent mycelium is found in the sugarcane bud inoculated with the 2143-6 strain (T1) on the 6th day, but the number of mycelium is obviously less than that of CK2 and the length of mycelium is obviously shorter than that of CK2 Figure 3 ).
[0049] The mycelium growth of sugarcane smut on Liucheng 05-136 sugarcane buds in the water soaking (CK1), the sugarcane smut basidiospore soaking (CK2) and the 2143-6 strain (T1) treatment on the 9th day is shown in Table 3. Figure 4 Figure 4 A~C in the table are the mycelium growth of CK1, CK2 and T1 in turn. It can be seen from the observation results that for the Liucheng 05-136 variety, no green fluorescent mycelium is found in CK1 within 12 days, green fluorescent mycelium is found in CK2 on the 4th day, green fluorescent mycelium is found in the sugarcane bud inoculated with the 2143-6 strain (T1) on the 9th day, the number of mycelium is obviously less than that of CK2 and the length of mycelium is obviously shorter than that of CK2 Figure 4 ).
[0050] The above results show that the 2143-6 strain can inhibit the germination of sugarcane smut basidiospores and the growth of mycelium.
[0051] Example 3 Inhibition test of the 2143-6 strain on other pathogenic fungi In addition to the sugarcane smut, the 2143-6 strain is also tested for the inhibition effect on the pathogenic fungi of other important sugarcane diseases (sugarcane leaf spot disease, sugarcane red rot disease, sugarcane brown stripe disease, sugarcane ring spot disease and sugarcane little rot disease).
[0052] The inhibition test process is as follows: Activate the 2143-6 strain, shake the bacteria to OD 600 =0.8 and place at room temperature for standby. The sugarcane brown stripe fungus (Cochliobolus miyabeanus), the sugarcane ring spot fungus (Leptosphaeria sacchari) and the sugarcane little rot fungus (Gibasella moniliformis) are cultured in OA medium, and the sugarcane leaf spot fungus (Pseudocercospora sacchari) and the sugarcane red rot fungus (Gibasella moniliformis) are cultured in PDA medium. Bipolaris setariae ). Curvularia ischaemi ). Nigrospora sphaerica ). Colletotrichum falcatum ). Fusarium verticillioides The bacteria were pre-cultured on PDA medium at 28°C for 7 days. A 5 mm diameter mycelial disc was collected from the edge of the pathogen colony and inoculated into the center of the corresponding medium (90 mm diameter petri dish). Simultaneously, sterile filter paper discs (5 mm diameter) were symmetrically placed 30 mm to either side of the mycelial disc. 10 μL of strain 2143-6 was added to the filter paper disc, while 10 μL of LB liquid medium was added to the control group's filter paper disc. Each treatment was repeated three times, and the plates were incubated at 28°C. Once the control group colonies had fully colonized the plates, the presence of an inhibition band was observed and recorded, and the band width and colony diameter were measured. The colony growth inhibition rate was calculated. The inhibition band width is the distance between the edge of the antagonistic bacteria and pathogen colonies. The colony diameter was measured along the axis connecting the center point of the filter paper disc and the mycelial disc. The inhibition rate was calculated as follows: Inhibition rate (%) = (Control colony diameter - Treated colony diameter) / (Control colony diameter - Mycelial disc diameter) × 100%.
[0053] The antibacterial test results of strain 2143-6 against sugarcane leaf spot fungus, sugarcane red rot fungus, sugarcane brown streak fungus, sugarcane ring spot fungus, and sugarcane slight rot fungus are as follows: Figure 5 As shown. By Figure 5 It can be seen that strain 2143-6 has a certain inhibitory effect on all the pathogens mentioned above; among them, strain 2143-6 has a relatively poor inhibitory effect on sugarcane rot fungus, with an inhibition rate of 20%, while its inhibitory effect on sugarcane leaf spot fungus, sugarcane red rot fungus, sugarcane brown streak fungus and sugarcane ring spot fungus is comparable, with inhibition rates of 53.34%, 50.98%, 59.21% and 59.76% respectively.
[0054] Example 4: Test of the control effect of strain 2143-6 on sugarcane smut. 1. Experiment on the effect of biocontrol in barrel cultivation Using sugarcane smut-susceptible varieties ROC22 and Liucheng 05-136 as test sugarcane varieties, the experiment set up three treatments: CK1 (seed soaking in water), CK2 (seed soaking in teliospores of sugarcane smut), and T1 (CK2 + strain 2143-6). For each treatment, equal amounts of plump, healthy, and fresh single bud segments of sugarcane varieties ROC22 and Liucheng 05-136 were taken. CK1 was soaked in water for 30 min, CK2 was soaked in 5 × 10⁻⁶ water, and so on. 6 Soak teliospores of *Ustilago maydis* (sugarcane smut fungus) per mL for 30 min, then use OD for T1. 600 Soak the strain 2143-6 in a solution with a concentration of 0.8 for 6 hours, remove and air dry naturally in the shade, then soak in a solution with a concentration of 5×10⁻⁶. 6The two sugarcane varieties ROC22 and Liucheng 05-136 were planted in the greenhouse, and 5 sugarcane buds were planted in each barrel, 3 barrels per repeat, 3 repeats per treatment. After that, the sugarcane growth management was carried out according to the conventional method, and the sugarcane smut incidence, prevention and control effect and incubation period were determined during the period.
[0055] The incubation period of sugarcane smut is the number of days from inoculation to the first occurrence of lesions. Thereafter, the occurrence of sugarcane smut was investigated once a week, and the discovered smut plants were bagged to prevent the spread of the smut. The number of diseased plants was recorded, and the investigation was continuously carried out for 6 months to determine the incidence of sugarcane smut and the prevention and control effect.
[0056] Incidence rate = (diseased plants / total number of plants) x 100% Prevention and control effect (%) = (incidence rate of only sugarcane smut inoculation - incidence rate of treatment) / incidence rate of only sugarcane smut inoculation x 100% In the barrel planting test, the incubation period, plant incidence and control effect of CK1 (water soaking), CK2 (sugarcane smut spore soaking) and T1 (CK2 + 2143-6 strain) treatments are shown in Table 1.
[0057] As shown in Table 1, for the two tested sugarcane varieties ROC22 and Liucheng 05-136, no sugarcane smut was found in the CK1 treatment, and the incidence of sugarcane smut in the CK2 treatment was significantly higher than that in the CK1. Compared with CK2, the incidence of sugarcane smut in T1 treatment was significantly reduced, the incubation period was increased, and the prevention and control effect was significantly higher than that of CK2. Among them, the prevention and control effect of 2143-6 strain in ROC22 reached 83.36%, and the prevention and control effect in Liucheng 05-136 reached 75.01%. The results shown in Table 1 show that 2143-6 strain can significantly reduce the incidence of sugarcane smut and has the effect of preventing and controlling sugarcane smut.
[0058] Table 1 Incubation period, incidence and control effect of sugarcane smut in barrel planting test
[0059] Different letters in the table indicate significant difference, P <0.05.
[0060] 2, Field inoculation of biocontrol effect test Based on the results of the barrel planting biocontrol test, the present application further carried out field inoculation biocontrol effect test on 2143-6 strain, and the tested sugarcane varieties, test setting and treatment were the same as above.
[0061] The experiment adopts a randomized block design, and each plot (1 m / row, row spacing 1 m, 3 rows per plot, 10 single buds per row, and 30 single buds per plot) is set up with 3 repetitions. Each hectare is applied with 600 kg of 3-15 compound fertilizer produced by Guangzhou Lado Meiyuan Company, and 3% phoxim granules are not applied for insect prevention (to prevent affecting the smut fungus and biocontrol bacteria), and no mulching film is applied, and the rest of the field management is the same as the local sugarcane production. During the period, the incidence of sugarcane smut, prevention and control effect, and incubation period are determined, and the method is the same as above.
[0062] In the field inoculation experiment, the incubation period, plant incidence, and control effect of CK1 (water soaking), CK2 (sugarcane smut spore soaking), and T1 (CK2+2143-6 strain) treatments are shown in Table 2.
[0063] As shown in Table 2, compared with CK2, the incidence of sugarcane smut in T1 treatment is reduced, which reaches a significant level.
[0064] Table 2 Incubation period, incidence, and control effect of sugarcane smut in field inoculation experiment
[0065] Different letters in the table represent significant differences, P <0.05.
[0066] Example 5 Effect of 2143-6 strain on sugar degree and cane yield The planting and inoculation treatment of sugarcane are the same as those in Example 4. In the sugarcane growth stage, the sugar degree and cane yield of each treatment are determined.
[0067] The effect of 2143-6 strain on sugar degree and cane yield is shown in Table 3. As shown in Table 3, compared with CK2, T1 treatment significantly improves the sugar degree and cane yield of sugarcane, that is, inoculation of 2143-6 strain can alleviate the effect of smut spores on the sugar degree and cane yield of sugarcane to a certain extent.
[0068] Table 3 Effect of 2143-6 strain on sugar degree and cane yield
[0069] Different letters in the table represent significant differences, P <0.05.
[0070] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, which are all included in the protection scope of the present application.
Claims
1. A strain of Burkholderia diphtheriae ( Burkholderia diffusa strain 2143-6, characterized in that, The strain 2143-6 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on September 2, 2025, with accession number GDMCC No: 66910.
2. The application of strain 2143-6 of claim 1 in inhibiting the growth of sugarcane smut, sugarcane leaf spot fungus, sugarcane red rot fungus, sugarcane brown streak fungus and / or sugarcane ring spot fungus.
3. The use of strain 2143-6 of claim 1 in the preparation of formulations for inhibiting the growth of sugarcane smut, sugarcane leaf spot fungus, sugarcane red rot fungus, sugarcane brown streak fungus and / or sugarcane ring spot fungus.
4. The application of strain 2143-6 as described in claim 1 in the control of sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown streak and / or sugarcane ring spot.
5. The use of the strain 2143-6 of claim 1 in the preparation of formulations for the control of sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown streak and / or sugarcane ring spot.
6. A microbial preparation, characterized in that, Contains the 2143-6 strain of claim 1 and / or its fermentation broth.
7. The use of the microbial preparation of claim 6 in inhibiting the growth of sugarcane smut, sugarcane leaf spot fungus, sugarcane red rot fungus, sugarcane brown streak fungus and / or sugarcane ring spot fungus.
8. The use of the microbial preparation of claim 6 in the preparation of products for inhibiting the growth of sugarcane smut, sugarcane leaf spot fungus, sugarcane red rot fungus, sugarcane brown streak fungus and / or sugarcane ring spot fungus.
9. The use of the microbial preparation of claim 6 in the prevention and control of sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown streak and / or sugarcane ring spot.
10. The use of the microbial agent of claim 6 in the preparation of products for the prevention and control of sugarcane smut, sugarcane leaf spot, sugarcane red rot, sugarcane brown streak and / or sugarcane ring spot.