Multi-MATE family gene mutation material for improving tillering capability and yield of rice under nitrogen reduction condition and application of multi-MATE family gene mutation material

Abstract

The invention discloses a multi-MATE family gene mutation material for improving tillering capability and yield of rice under a nitrogen reduction condition and application of the multi-MATE family gene mutation material. The multi-MATE family gene mutation material is rice with the OsMATE1 / 2 / 3 gene knocked out, the OsMATE1 gene, the OsMATE2 gene and the OsMATE3 gene in rice are knocked out at the same time, the nucleotide sequence of the OsMATE1 is shown as SEQ ID NO.2, the nucleotide sequence of the OsMATE2 is shown as SEQ ID NO.1, and the nucleotide sequence of the OsMATE3 is shown as SEQ ID NO.3. A CRISPR / Cas9 system is used for mediating gene knockout, a recombinant vector pUbi-H:: Osmate1 / 2 / 3 is constructed, the recombinant vector is used for editing OsMATE1 / 2 / 3 to generate a three-sudden variant plant, and agronomic characters such as the tiller number, the single plant yield, the thousand seed weight and the yield of a knockout mutant strain are analyzed. Research results show that by knocking out OsMATE1 / 2 / 3, the tiller number of rice can be increased, the yield of a single plant can be remarkably increased, the plant height can be reduced, and meanwhile, no adverse effect is generated on the maturing rate.

Description

Technical Field

[0001] This invention relates to methods for genetic improvement of rice, and more particularly to a multi-MATE family gene mutant material that enhances tillering ability and yield of rice under nitrogen reduction conditions and its application. Background Technology

[0002] Rice ( Oryza sativa L. As one of the world's most important food crops, rice's yield potential is mainly determined by three key agronomic traits: number of panicles, number of grains per panicle, and grain weight. Among these, the number of panicles is mainly regulated by the plant's tillering ability, that is, the inherent potential of rice to form effective tillers.

[0003] Multidrug and toxic compound efflux (MATE) proteins are a class of transmembrane transport proteins widely found in bacteria, plants, and animals. Their main function is to actively expel drugs, toxins, or metabolites from cells, maintaining cellular homeostasis. Studies have shown that plant MATEs are located on various cellular biomembranes, such as the plasma membrane, vacuolar membrane, Golgi membrane, and vesicle membrane. Furthermore, the expression of some MATEs exhibits tissue specificity, and the substrates they transport also demonstrate diversity and specificity, resulting in a variety of biological functions. They play important roles in the excretion of exogenous substances, the transport and accumulation of secondary metabolites, iron transport, aluminum detoxification, plant hormone signal transduction, and plant disease resistance. Therefore, in-depth analysis of MATEs is crucial. MATE The molecular function of transport proteins and their role in rice tillering development will provide theoretical support and genetic resources for optimizing tillering traits, increasing panicle number, and final yield through molecular breeding. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a multi-MATE family gene mutant material that enhances the tillering ability and yield of rice under nitrogen reduction conditions, so as to increase the number of tillers and the yield of rice.

[0005] The objective of this invention is achieved through the following technical solution: a multi-MATE family gene mutant material that enhances tillering ability and yield in rice under nitrogen-reduced conditions, providing a means to simultaneously knock out the MATE family gene mutation in rice. OsMATE1 Gene 、OsMATE2 Gene and OsMATE3 Knockout of genes OsMATE1 / 2 / 3 Genetically modified rice varieties result in increased tiller number, increased number of primary branches, increased number of grains per panicle, and / or increased yield.

[0006] OsMATE1 The nucleotide sequence is shown in SEQ ID NO.2. OsMATE2 The nucleotide sequence is shown in SEQ ID NO.1. OsMATE3 The nucleotide sequence is shown in SEQ ID NO.3.

[0007] This invention uses CRISPR / Cas9 technology to simultaneously knock out [the virus] in rice. OsMATE1 Gene 、OsMATE2 Gene and OsMATE3 Gene.

[0008] Furthermore, the CRISPR / Cas9 technology includes the following steps: S1. According to OsMATE1 Gene 、OsMATE2 Gene and OsMATE3 Specific sgRNA targets were designed based on the nucleotide sequences of the genes, and specific sgRNAs were constructed. OsMATE1 Gene 、OsMATE2 Gene and OsMATE3 The sgRNA expression cassettes corresponding to the genes are then assembled into plant gene editing vectors containing Cas9 expression cassettes to obtain recombinant vectors; S2. The recombinant vector is transformed into callus tissue via Agrobacterium-mediated transformation. After screening for resistant callus tissue and plant regeneration, the knockout vector is obtained. OsMATE1 / 2 / 3 Genetically modified rice.

[0009] Furthermore, the sgRNA target includes: OsMATE1 Target: 5'-GCTGCGGAACGTGGTGCAGA-3' OsMATE2 Target: 5'-AGGATGCAGCTGGCCACGAT-3' OsMATE3 Target: 5'-AAGAAGCTGTGGCGCGTCGT-3'.

[0010] Furthermore, the plant gene editing vector is a pYLCRISPR / Cas9 multi-target binary vector; preferably pYLCRISPR / Cas9pUbi-H.

[0011] Furthermore, the specific steps for constructing the sgRNA expression cassette and assembling it into the plant gene editing vector are as follows: 1) The first round of PCR was performed using the SgRNA intermediate vector as a template. OsMATE1 Gene 、OsMATE2 Gene and OsMATE3 The gene target sequence was introduced downstream of the corresponding promoter and upstream of the sgRNA backbone sequence, respectively, resulting in three independent fusion fragment products: OsMATE1 Fusion fragment of gene target sequence with U3 promoter OsMATE2The fusion fragment of the gene target sequence with the U6a promoter OsMATE3 The fusion fragment of the gene target sequence with the U6b promoter; The primer sequences (5'-3') are as follows: gRT1: 5'-AGGATGCAGCTGGCCACGATgttttagagctagaaat-3', OsU6aT1: 5'-ATCGTGGCCAGCTGCATCCTCggcagccaagccagca-3', gRT2: 5'-AAGAAGCTGTGGCGCGTCGTgttttagagctagaaat-3', OsU6bT2: 5'-ACGACGCGCCACAGCTTCTTCaacacaagcggcagc-3', gRT3: 5'-GCTGCGGAACGTGGTGCAGAgttttagagctagaaat-3', OsU3T3: 5'-TCTGCACCACGTTCCGCAGCTgccacggatcatctgc-3', UF: 5'-CTCCGTTTTACCTGTGGAATCG-3', gR-R: 5'-CGGAGGAAAATTCCATCCAC; 2) Using the three independent fusion fragment products as templates, perform a second round of PCR to obtain... OsMATE1 Gene sgRNA expression cassette 、OsMATE2 Gene sgRNA expression cassette and OsMATE3 Gene sgRNA expression cassette; 3) Assemble the above OsMATE1 Gene sgRNA expression cassette 、OsMATE2 Gene sgRNA expression cassette and OsMATE3 Gene sgRNA expression cassettes were translated into the pYLCRISPR / Cas9 multi-target binary vector.

[0012] Furthermore, the Agrobacterium is Agrobacterium EHA105.

[0013] Another objective of this invention is to provide the application of ascending MATE family gene mutant materials in the creation of rice with tillering ability under nitrogen reduction conditions.

[0014] The present invention has the following advantages and effects compared with the prior art: This invention utilizes the CRISPR / Cas9 system to mediate gene knockout and construct recombinant vectors.pUbi-H::Osmate1 / 2 / 3 Used for editing OsMATE1 / 2 / 3 Triple-mutant plants were generated, and agronomic traits such as tiller number, number of primary branches, number of grains per panicle, and yield were analyzed in transgenic rice. The results showed that knockout... OsMATE1 / 2 / 3 It can increase the number of tillers, primary branches, and grains per panicle in rice, significantly improving the yield per plant. Attached Figure Description

[0015] Figure 1 yes OsMATE1 / 2 / 3 Agronomic trait analysis diagram of the three-mutant mutant; Figure 2 yes OsMATE1 / 2 / 3 Tri-mutant yield analysis diagram. Detailed Implementation

[0016] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0017] Unless otherwise defined, all scientific and technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art at the time of invention.

[0018] The following are the culture media involved in the examples: YEP (100mL) liquid culture medium: 0.5g beef extract peptone, 0.1g yeast extract, 0.5g peptone, 0.5g sucrose, 0.5g magnesium sulfate heptahydrate, 1.5g agar.

[0019] AAM liquid medium: 5.4 g / L rice transgenic AAM medium (Kulaibo), 68 g / L sucrose, 36 g / L glucose, and 10-20 mg / L acetylsyringone.

[0020] Solid co-culture medium: Rice transgenic N6D medium base salt 4.39 g / L (Cooler), glucose 10 g / L, glucose 10 g / L, acetylsuccinone 10-20 mg / L, cryogel 4 g / L (Sigma).

[0021] Liquid co-culture medium: AAM liquid medium.

[0022] Selective culture medium: Rice transgenic N6D medium with base salts of 4.39 g / L (Cooler), sucrose of 30 g / L, 2,4-D of 2.8 mg / L, hygromycin B of 50 mg / L, carboxypenicillin of 400 mg / L, and cryogel of 4 g / L (Sigma).

[0023] Differentiation medium: sorbitol 30 mg / L, hydrolyzed casein 2 g / L, MS base salt 4.4 g / L, inositol 100 mg / L, nicotinic acid 0.5 mg / L, vitamin B6 0.5 mg / L, vitamin B1 0.1 mg / L, glycine 2 mg / L, sucrose 30 g / L, cryogel 4 g / L (Sigma), hygromycin B 50 mg / L, carboxypenicillin 400 mg / L, NAA 1 mg / L, 6BA 3 mg / L.

[0024] Rooting medium: MS base salt 4.4 g / L, inositol 100 mg / L, nicotinic acid 0.5 mg / L, vitamin B6 0.5 mg / L, vitamin B1 0.1 mg / L, glycine 2 mg / L, sucrose 30 g / L, cryogel 4 g / L (Sigma), carboxypenicillin 400 mg / L, NAA 1 mg / L.

[0025] The genes involved in the following examples OsMATE1, OsMATE2, OsMATE3 The nucleotide sequences are shown in SEQ ID NO. 1 to 3, respectively.

[0026] OsMATE2 cDNA sequence (SEQ ID NO.1): ATGGCCGCCGCCGCCGTCCACGAGCCGCTTCTCGCGGCGGCGCCGCCAACGCCCGGCAAG GCCGCCGACGGCGACGGTCCGGAGGAGGGGCGCCGGCTCGCCTCCGCGGAGGCGAAGCGG CTGCTGCGGCTGGCCGGGCCGATCGTGGCCAGCTGCATCCTGCAGTGCGTGGTGAACATG GTGTCCGTCATGTTCGTCGGCCACCTCGGTGAGCTCCCCCTCGCCGGCGCCTCCCTCGCC ACCTCCCTCGCCAACGTCACCGGCTACAGCCTCCTCACGGGCATGGCGACGGCGATGGAC ACGCTGTGCGGGCAGGCGTACGGGGCGAGGCAGTACCACCTGCTGGGCGTGTACAAGCAG CGCGCCATGGTGGTGCTCGCGGCGGCGTGCGTCCCCATCGCGCTGGTCTGGGCGTCCGCG GGGCGGATCCTGCTGCTCCTCGGCCAGGACGCGGGCATCGCCGCCGAGGCCGGCGCGTAC GCGCGGTGGATGCTCCCGTCGCTCGCCGCCTACGTGCCGCTCCAGTGCCACATCCGGTTC CTGCAGACGCAGACCGTCGTGCTCCCCGTCACGGCGAGCTCCGCCGCCACCGCGCTCCTC CACCCGCTCGTGTGCTGGCTGCTCGTGTTCAGGGCCGGCATGGGGAGCAAGGGAGCCGCG CTCGCCAACGCCATCTCCTACGCCGTCAACCTCGCCATACTCGCCGTCTACGTCAGGGCG TCCAACACCTGCAAGGGCAGGTGGAGCGGCTTCTCCGGCGAGGCCTTCAAGGAGCTCCGC CAGTTCGCCGCGCTCGCCATGCCCTCCGCCATGATGATCTGCTTGGAGTGGTGGTCATTT GAAATCCTTGTGCTGCTCTCTGGACTTCTGCCTAATCCTCAGCTTGAGACATCAGTGCTG TCAATATGCTTGAACACTGGGGCTCTGCTGTACATGGTACCATTGGGTCTATGCTCTTCT ATAAGCACGCGTGTTTCGAACGAAATTGGAGCCGGGCAGCCTCAAGCAGCGAAGCGAGCA ACGCGAGTGGTGATGTATATGGCTTTGTCCGAAGGATTGGTGATAAGCTTTACCATGTTC TTGCTTCGCAATGTCTGGGGGTACATGTACAGCAACGAGCAGGAAGTTGTGACATACATT GCTAGGATGCTGCCGATTCTCGACATATCTTTCTTCATAGATGGGCTTCACAGTTCTCTG TCAGGCGTGCTCACGGGTTGTGGCAAGCAGAAAATTGGTGCAGCCGTGAACCTCGGGGCA TTCTACCTTGTAGGCATTCCGGTGGCTGTTCTGCTTGCATTCTACCTCCATCTGAATGGA ATGGGCCTGTGGCTTGGCATCGTCTGCGGCAGCATCATCAAACTACTGGTGCTTATAATT GTCTCGTGTTGCATAGACTGGGAAAAGGAGGCGATCTTGGCAAAGGACAGGGTCTTCAGC TCATCTCTTCCAGTAGCATGA。

[0027] OsMATE1 cDNA sequence (SEQ ID NO.2): ATGGAGAAGCCGGCGGCGAGCGTGGAGGAGCCGCTGCTTGTTGGCGCTGGCGAGAAGAAG GGCGAGAGCGCGGCCGCGGCGGAGCTGAAGCGGCTGCTCCGGCTGGCGGGGCCGCTGGTG GCGAGCGGCGTGCTGCGGAACGTGGTGCAGATGGTGTCCGTCATGTTCGTCGGCCACCTC GGCGAGCTCCCCCTCGCCGGCGCCTCCCTCGCCACCTCCCTCGCCAACGTCACCGGCTTC AGCCTGCTCTTCGGCATGGCGAGCGCGCTGGACACGCTGTGCGGGCAGGCGTACGGCGCG CGCCAGCACCACCTCCTCGGCGTCTACAAGCAGCGCGCCATGCTGGTGCTCGCCGTGGCC GCCGTGCCCATCGCGCTCGTCTGGGCCAGCGCCGGCGAGATCCTCCTCCTGTTCGGCCAG GACCCGGCCATCGCCGCCGAGGCCGGCGCGTACGCGCGGTGGCTGATCCCGTCGCTCGTC CCGTTCGTGCCGCTGGTGTGCCACATCCGGTTCCTGCAGGCGCAGAGCGCCGTGCTGCCG GTGATGGCGAGCTGCGGCGTCACGGCGGCGAGCCACGTGGCCGTGTGCTGGGCGCTGGTG CGCAAGGCCGGCATGGGCAGCAGGGGCGCCGCGCTGGCGAACGCCGTCTCCTATGGCGTC AACCTCACCATAATGTCTCTCTATGTCAGGCTGTCGCGCTCCTGCGAGAAGACATGGACT GGCTTCTCCATGGAGGCCTTCAGGGAGCTCCGCCAGTATGCGGAGCTCGCCATCCCCGCG GCAATGATGGTCTGTTTGGAGTGGTGGTCATTTGAATTTCTTGTGATGCTCTCTGGTCTT CTGCCCAATCCTAAACTTGAAACCTCAGTGTTGTCGATATGTCTCAACACTGGTGCTCTG CTGGTCATGGTTCCAATTGGTCTCAGCACAGCTATAAGCACGCGTGTTTGGAACGAACTA GGTGCCGGCAATCCCCAGGCAGCGAAGCTGGCAACTCGAGTGGTCATATGTATGGCCATG ACCGAAGGCTCGGTGGTTGCGTTTACGATGATTCTGTTGCGCAATTCCTGGGGTCACATG TACAGTGATGAGGCTGAAGTTGTCACCTACATTGCTCGTATGATACCTGTTCTAGCCATA TCATTCTTCATTGATGGGATGCACAGCGCTCTTTCAGGAGTGCTCACTGGATGTGGCAAG CAGAAGATCGGCGCACGGGTAAATCTTGGCGCATTTTACTTGGCAGGCATTCCTATGGCC GTCTTTCTTGCATTTGTGCTACATCTGAATGGAATGGGCCTTTGGCTTGGCATCGTTTGC GGGAGCCTCAGCAAGCTTATCTTGCTCTTTTGGATCACAATGAGTATAAACTGGGAGAAG GAATCAACCAGGGCGAAAGAATTGGTGTTCAGTTCATCTCTTCCTGTAGCATGA。

[0028] OsMATE3 cDNA sequence (SEQ ID NO.3): ATGGAGGACGAGGCGACGTCGGTGGCGGCGCCGCTGCTGCGGCCGCGCGGCGGCGTTGAC GCGGAGGCGGTGAAGCAGCAGCTGTGGCCGGCCGGCGCGAGGGTGGCGGGGGAGTGGTGG GTGGAGTCGAAGAAGCTGTGGCGCGTCGTCGGGCCGGCCATCTTCCAGCGGATCGCGCTG TACGGGATCAACGTCGTCTCGCAGGCGTTCATCGGCCACATGGGCGACCTCGAGCTTGCC GCCTTCTCCATCGCCTCCACCGTCGTCGCCGGCTTCAACTTCGGTTTCCTGCTGGGCATG GCGAGCGCGCTGGAGACGCTGTGCGGGCAGGCGTTCGGCGCCAAGAAGTACCACATGCTG GGCGTGTACCTGCAGCGGTCGTGGCTGGTGCTCCTCATGTTCGCCGTCGCGCTGACGCCG ACGTACGTGCTCATGGAGGACCTGCTGCTGCTGATCGGGCAGCCGGCCGACCTCGCCAGC CTCGCCGGCAAGATGAGCGTCTGGCTGCTGCCGCAGCACTTCGCCATGGCGATGCTGCTC CCGCTCACGCGGTTCCTGCAGTCCCAGCTCAAGAACTGGGTCACCGCGGTCACCGCCGGC GTCGCGCTCGCGCTCCACCTCGTGATCACCTACCTGCTCGTCAACACCCTCCACCTGGGC CTCCTCGGCGCCGTCGCCGCCGCCAACGTGGCGTGGTGGATCGTCGTGCTGGGGCAGTTG GTCTACGTCGTCGGCGGCTGGTGCCCGCTGTCGTGGAAGGGATTCTCCATGGAAGCGTTC GCCGACTTCTGGGAGTTCATCAAGCTCTCCTCGGCCTCCGGGGTGATGCTTTGCTTGGAG AACTGGTACTACAGGGTGTTGGTGTTGCTTACAGGGTACCTGAATAACGCTGAAATCGCT GTGGATGCACTCTCCATATGCTTGACGATCAACGGATGGGAGATGATGATTCCTTTTGGC TTCTTGGCTGCAACTGGCGTGCGGGTGGCAAACGAGCTCGGCGCCGGCAGCGGCAAGGGC GCGCGGTTCGCCATCGTGGTGTCCGTCACCACCTCCGTGGCGATCGGCCTCGTCTTCTGG TGCCTCATCATTGCCTACAACGACAAGATCGCTCTCCTCTTCTCGTCGAGCAAGGTGGTG CTCGACGCCGTCAGCGACCTGTCCGTGCTGCTCGCCTTCACCGTCCTCCTCAACAGCGTG CAGCCCGTCCTCTCAGGTGTGGCCATTGGCTCAGGGTGGCAAGCACTCGTAGCCTACGTC AACGTCGGTAGCTACTACTTGGTCGGAGTTCCCATCGGTGCCATATTGGGCTGGCCATTG CATTTCGGAGTTGGGGGAATTTGGTCCGGGTTGATTGGTGGCACAGCTGTTCAGACACTG ATATTAGCCTATCTCACTATCAGCTGTGATTGGGATGAAGAGGCAAAGAAAGCAAGTACA AGGATGGAAGTATGGGCCAGTCAAAATGA.

[0029] The pYLCRISPR / Cas9 multi-target binary vector pYLCRISPR / Cas9pUbi-H and the intermediate vector YLgRNA-OsU6a / OsU6b / OsU3 used in the following examples have been disclosed in the literature “Zeng Dongchang, Ma Xingliang, Xie Xianrong, et al. Operational methods for construction and mutation analysis of plant CRISPR / Cas9 multi-gene editing vectors [J]. Science in China: Life Sciences, 2018, 48(7):12.DOI:CNKI:SUN:JCXK.0.2018-07-008.”

[0030] The YLgRNA- / U6a / U6b / U3 used in the following examples has been disclosed in the literature “Zeng Dongchang, Ma Xingliang, Xie Xianrong, et al. Operational methods for construction and mutation analysis of plant CRISPR / Cas9 multi-gene editing vectors [J]. Science in China: Life Sciences, 2018, 48(7):12.DOI:CNKI:SUN:JCXK.0.2018-07-008.”

[0031] Example 1 1.1 Plant materials Using mature seeds of a japonica rice variety, Zhonghua 11 (ZH11), as material, callus tissue was induced for genetic transformation.

[0032] 1.2 Rice Osmate1 / 2 / 3 Obtaining the hexamutant vector: Gene knockout mediated by CRISPR / Cas9 system to construct recombinant vectors pUbi-H::Osmate1 / 2 / 3 (Vector eukaryotic resistance: hygromycin; vector prokaryotic resistance: kanamycin), used for editing. OsMATE1 / 2 / 3 The plant produced a triple mutant.

[0033] (1) Three target sites (5'-3') were designed and selected using GRSPR-GE software (http: / / skl.scau.edu.cn / ) (Target 1: GCTGCGGAACGTGGTGCAGA; Target 2: AGGATGCAGCTGGCCACGAT; Target 3: AAGAAGCTGTGGCGCGTCGT, target primers were synthesized by Shanghai Sangon Biotech Co., Ltd.).

[0034] sgRNA targets include: OsMATE1Target: 5'-GCTGCGGAACGTGGTGCAGA-3' OsMATE2 Target: 5'-AGGATGCAGCTGGCCACGAT-3' OsMATE3 Target: 5'-AAGAAGCTGTGGCGCGTCGT-3'.

[0035] 1) The first round of PCR was performed using the SgRNA intermediate vector as a template. OsMATE1 Gene 、OsMATE2 Gene and OsMATE3 The gene target sequence was introduced downstream of the corresponding promoter and upstream of the sgRNA backbone sequence, respectively, ultimately yielding three independent fusion fragment products: OsMATE1 The fusion fragment of the gene target sequence with the U3 promoter (U3 promoter- OsMATE1 Target sequence - sgRNA backbone), OsMATE2 The fusion fragment of the gene target sequence with the U6a promoter (U6a promoter- OsMATE2 Target sequence - sgRNA backbone), OsMATE3 The fusion fragment of the gene target sequence with the U6b promoter (U6b promoter- OsMATE3 Target sequence - sgRNA backbone.

[0036] First round of PCR: The target sequence was introduced downstream of the U6a / U6b / U3 promoter and upstream of the sgRNA sequence, respectively. The templates were plasmids YLgRNA-OsU6a, YLgRNA-OsU6b, and YLgRNA-OsU3, with a template concentration of 2–5 ng each. Program: 25–26 PCR cycles: 95℃ for 10 s, 58℃ for 15 s, and 72℃ for 15 s.

[0037] The primer sequences (5'-3') are as follows: gRT1: AGGATGCAGCTGGCCACGATgttttagagctagaaat OsU6aT1:ATCGTGGCCAGCTGCATCCTCggcagccaagccagca gRT2: AAGAAGCTGTGGCGCGTCGTgttttagagctagaaat OsU6bT2: ACGACGCGCCACAGCTTCTTCaacacaagcggcagc gRT3:GCTGCGGAACGTGGTGCAGAgttttagagctagaaat OsU3T3:TCTGCACCACGTTCCGCAGCTgccacggatcatctgc UF:CTCCGTTTTACCTGTGGAATCG gR-R: CGGAGGAAAATTCCATCCAC.

[0038] Second round PCR: Constructing the promoter, target site, and sgRNA into a complete expression cassette: Take 1 µL of each of the 6 fusion fragments from the first round PCR and add them to 54 µL of ddH2O, diluting 10-fold. Use 1 µL as the template for the second round PCR. Program: 25–28 PCR cycles: 95℃ for 10 s, 58℃ for 15 s, 72℃ for 20 s. Perform electrophoresis on 3 µL of the PCR product to check and estimate the approximate concentration of the sample. The final result is... OsMATE1 Gene sgRNA expression cassette 、OsMATE2 Gene sgRNA expression cassette and OsMATE3 Gene sgRNA expression cassette.

[0039] The primer sequences (5'-3') are as follows: Pps-R:TTCAGAGGTCTCTACCGACTAGTCACGCGTATGGAATCGGCAGCAAA Pgs-2: AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC Pps-2:TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG Pgs-3: AGCGTGGGTCTCGTCTTCACTCCATCCACTCCAAGCTC Pps-3:TTCAGAGGTCTCTAAGACTTTGGAATCGGCAGCAAAGG Assembled using the "cut-and-connect" method OsMATE1 Gene sgRNA expression cassette 、OsMATE2 Gene sgRNA expression cassette and OsMATE3Gene sgRNA expression cassettes into the pYLCRISPR / Cas9 multi-target binary vector pYLCRISPR / Cas9pUbi-H: A 15 µL reaction mixture was prepared with: 1.5 µL of 10×CutSmart Buffer; 1.5 µL of 10 mmol / L ATP (or 1.5 µL of 10×T4 DNA ligase buffer instead of ATP); 60–80 ng of pYLCRISPR / Cas9 pUbi-H plasmid; 10–15 ng of purified mixed sgRNA expression cassettes per cassette; 10 U of Bsa I-HF; 35 U of T4 DNA ligase; and ddH2O to a final volume of 15 µL. A PCR reaction was performed with simultaneous digestion and ligation for 35 cycles (37℃ for 5 min, 10℃ for 5 min, 20℃ for 5 min); the final incubation was at 37℃ for 5 min.

[0040] (2) The obtained ligation product was purified and introduced into *E. coli* using the DH5α method at 37°C for 12 h. Single colonies were subjected to colony PCR using the universal vector primers SP-L1 / SP-L2. Positive single colonies were identified and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. After successful sequencing, the plasmid was extracted and transformed into *Agrobacterium tumefaciens* EHA105. Single colonies of *Agrobacterium tumefaciens* were picked for colony PCR identification. After successful identification, the colonies were stored in 25% glycerol at -80°C.

[0041] 1.3 Rice genetic transformation Rice seed disinfection: Select mature, plump, and disease-free Zhonghua 11 (ZH11) rice seeds, remove the husks using a dehulling machine, and disinfect the dehulled rice seeds in a clean bench. The specific operation is as follows: First, add 75% alcohol to the seeds and disinfect with alcohol for 2-3 minutes, then rinse 1-2 times with sterile distilled water; then add 25% sodium hypochlorite and 1 mL of glycerin, mix and disinfect for 30 minutes, pour off the disinfected water, and rinse again with sterile distilled water 3 times to remove the disinfectant (repeat twice); after disinfection, pour off all the water, take out sterile filter paper to absorb the moisture on the rice seeds, and finally use sterile tweezers to place the seeds on a callus culture medium and incubate at 28℃ in the dark for about 7 days.

[0042] Rice callus induction: After sterilization, rice seeds are placed on a callus induction culture plate and cultured at 28°C for about a week. The resulting yellow callus can then be used for Agrobacterium infection experiments.

[0043] Agrobacterium infection of rice callus: Agrobacterium was collected by centrifugation at 4700 rpm for 10 min in a shaker at 37℃. The supernatant was discarded, and the bacterial cells were resuspended in AAM liquid medium containing an equal volume of 20 μg / mL acetylsylgenone using a pipette tip. The mixture was then incubated in a shaker at 28℃ for 2-3 h. The OD value was measured. When the OD value was prepared to 0.1, selected light yellow, plump, and well-preserved callus was immersed in Agrobacterium and gently shaken for 1-3 min. The bacterial solution was then discarded, and the callus was placed on sterile paper to filter out the water. The callus was then placed on a co-culture medium and incubated in the dark at 28℃ for 48-72 h.

[0044] Selection and culture of rice resistant callus: After incubation in a dark culture chamber for 2 days, infected callus tissue was rinsed with sterile water containing carbenicillin in a laminar flow hood to remove Agrobacterium, with each rinsing session lasting 20 minutes (repeated once). After rinsing, the callus tissue was removed and blotted dry on sterile paper before being placed on selection medium. The medium was then cultured alternately in the dark and light at 28℃ for 2 weeks. The medium was changed every 10-12 days.

[0045] Differentiation culture of rice resistant callus: After Agrobacterium infection, callus tissue was cultured on a selection plate. Once bright yellow, fluffy, and brittle callus tissue had grown, it was transferred to differentiation medium and cultured alternately in the dark and light at 28℃ for 2 hours, with the plate being changed every 10-12 days. The callus tissue differentiated and grew rapidly on the differentiation plate. Green spots appeared on the yellow callus tissue, and the callus tissue with green spots quickly differentiated into seedlings.

[0046] Rooting culture: Seedlings differentiated from callus tissue are transferred to rooting culture medium bottles. After 7-19 days of growth, the root culture pad is removed for hardening-off. Hardening-off makes newly isolated transgenic seedlings more likely to survive. The roots are then rinsed with distilled water to remove the culture medium, and finally placed in a climate incubator. Once they reach 10-15cm in length, leaf DNA is extracted for testing. After completion, they are transplanted into paddy fields.

[0047] 1.4 Rice Osmate1 / 2 / 3 Identification of Tri-mutants In order to detect Osmate1 / 2 / 3 The target mutation status of the three-mutant positive seedlings was observed in... OsMATE1 / 2 / 3 Design the target site location (including the target site and at least 300 bp upstream and downstream), design specific primers, amplify the target fragment by PCR, and send the PCR product to a sequencing company for routine Sanger sequencing. The primer sequences (5'-3') are as follows: OsMATE2-F:GCCGTCCACGAGCCGCTTCT OsMATE2-R: TAAACGGTTTGGTTGAAGCATAG OsMATE3-F:GGCGGTGAAGCAGCAG OsMATE3-R:GCAGCACATACCAGGAAA OsMATE1-F:GAGGAGCCGCTGCTTGTTGG OsMATE1-R: TTGTAGACGCCGAGGAGGTGG 1.5 Analysis of agronomic traits of rice Wild-type (WT) of Zhonghua 11 and Osmate1 / 2 / 3 The three-mutant plants were planted in the experimental field of South China Agricultural University and cultivated under the same growth conditions, with nitrogen fertilizer reduced by 30%.

[0048] The growth conditions are: Nitrogen environment: 100 kg / ha; Plant 8 seedlings per row, spaced 20 centimeters apart.

[0049] After the rice matures, agronomic traits such as plant height, effective tillering, grain length, grain width, and seed setting rate are statistically analyzed.

[0050] Experimental results: To explore novel regulatory mechanisms of rice tillering, a CRISPR / Cas9 system was constructed in the wild-type (WT) background of Zhonghua 11. Osmate1 / 2 / 3 Tri-mutants are used for detection Osmate1 / 2 / 3 Sequencing alignment results showed that the target mutation status of the three-mutant positive seedlings was determined. Osmate1 / 2 / 3 Tri-mutant OsMATE1 An A base was added at position 152 in the coding region. OsMATE2 A T base was inserted at position 146 in the coding region. OsMATE3 An additional C base was added at position 148 in the coding region, which resulted in a frameshift mutation, and it was a homozygous mutation.

[0051] Phenotypic analysis showed that, compared to WT, Osmate1 / 2 / 3 The number of tillers is significantly increased in the triple mutant. Figure 1 Compared to WT, Osmate1 / 2 / 3 The number of tillers in the triple knockout mutant line increased by 1.58 times. Figure 1 Subsequently, we further analyzed plant height and yield per plant, and the results showed that, compared with WT, Osmate1 / 2 / 3 The knockout mutant lines showed a 25.3% decrease in plant height and a 47.8% increase in yield per plant. Figure 2 Furthermore, there were no significant differences in seed setting rate, thousand-grain weight, and grain length, while the mutant grain width was slightly lower than the WT (wt). Figure 1 Based on the above results, Osmate1 / 2 / 3Knockout mutants significantly increase yield per plant compared to WT. Osmate1 / 2 / 3 The single-plant yield of the knockout mutant line increased by approximately 1.48 times. Figure 2 ).

[0052] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A multi-MATE family gene mutant material for improving tillering ability and yield in rice under nitrogen reduction conditions, characterized in that, To simultaneously knock out rice OsMATE1 Gene OsMATE2 Gene and OsMATE3 Gene knocked out OsMATE1 / 2 / 3 The genetically modified rice, as described OsMATE1 The nucleotide sequence is shown in SEQ ID NO.

2. OsMATE2 The nucleotide sequence is shown in SEQ ID NO.

1. OsMATE3 The nucleotide sequence is shown in SEQ ID NO.

3.

2. The multi-MATE family gene mutant material for improving tillering ability and yield of rice under nitrogen reduction conditions according to claim 1, characterized in that, The CRISPR / Cas9 technology was used to simultaneously knock out rice OsMATE1 Gene OsMATE2 Gene and OsMATE3 Gene.

3. The multi-MATE family gene mutant material for improving tillering ability and yield of rice under nitrogen reduction conditions according to claim 1, characterized in that, The CRISPR / Cas9 technology includes the following steps: S1. According to OsMATE1 Gene OsMATE2 Gene and OsMATE3 Specific sgRNA targets were designed based on the nucleotide sequences of the genes, and specific sgRNAs were constructed. OsMATE1 Gene OsMATE2 Gene and OsMATE3 The sgRNA expression cassettes corresponding to the genes are then assembled into plant gene editing vectors containing Cas9 expression cassettes to obtain recombinant vectors; S2. The recombinant vector is transformed into callus tissue via Agrobacterium-mediated transformation. After screening for resistant callus tissue and plant regeneration, the knockout vector is obtained. OsMATE1 / 2 / 3 Genetically modified rice.

4. The method based on claim 3 MATE A method for regulating rice tiller number and yield using genes, characterized in that, The sgRNA targets include: OsMATE1 Target: 5'-GCTGCGGAACGTGGTGCAGA-3' OsMATE2 Target: 5'-AGGATGCAGCTGGCCACGAT-3' OsMATE3 Target: 5'-AAGAAGCTGTGGCGCGTCGT-3'.

5. The method based on claim 3 MATE A method for regulating rice tiller number and yield using genes, characterized in that, The plant gene editing vector is a pYLCRISPR / Cas9 multi-target binary vector.

6. The multi-MATE family gene mutant material for improving tillering ability and yield of rice under nitrogen reduction conditions according to claim 5, characterized in that, The plant gene editing vector described is pYLCRISPR / Cas9pUbi-H.

7. The multi-MATE family gene mutant material for enhancing tillering ability and yield of rice under nitrogen reduction conditions according to claim 3, characterized in that, The specific steps for constructing the sgRNA expression cassette and assembling it into the plant gene editing vector are as follows: 1) The first round of PCR was performed using the SgRNA intermediate vector as a template. OsMATE1 Gene OsMATE2 Gene and OsMATE3 The gene target sequence was introduced downstream of the corresponding promoter and upstream of the sgRNA backbone sequence, respectively, resulting in three independent fusion fragment products: OsMATE1 Fusion fragment of gene target sequence with U3 promoter OsMATE2 The fusion fragment of the gene target sequence with the U6a promoter OsMATE3 Fusion fragment of gene target sequence with U6b promoter; The primer sequences (5'-3') are as follows: gRT1: 5'-AGGATGCAGCTGGCCACGATgttttagagctagaaat-3', OsU6aT1: 5'-ATCGTGGCCAGCTGCATCCTCggcagccaagccagca-3', gRT2: 5'-AAGAAGCTGTGGCGCGTCGTgttttagagctagaaat-3', OsU6bT2: 5'-ACGACGCGCCACAGCTTCTTCaacacaagcggcagc-3', gRT3: 5'-GCTGCGGAACGTGGTGCAGAgttttagagctagaaat-3', OsU3T3: 5'-TCTGCACCACGTTCCGCAGCTgccacggatcatctgc-3', UF: 5'-CTCCGTTTTACCTGTGGAATCG-3', gR-R: 5'-CGGAGGAAAATTCCATCCAC; 2) Using the three independent fusion fragment products as templates, perform a second round of PCR to obtain... OsMATE1 Gene sgRNA expression cassette OsMATE2 Gene sgRNA expression cassette and OsMATE3 Gene sgRNA expression cassette; 3) Assemble the above OsMATE1 Gene sgRNA expression cassette OsMATE2 Gene sgRNA expression cassette and OsMATE3 Gene sgRNA expression cassettes were translated into the pYLCRISPR / Cas9 multi-target binary vector.

8. The multi-MATE family gene mutant material for improving tillering ability and yield of rice under nitrogen reduction conditions according to any one of claims 3-7, characterized in that, The Agrobacterium mentioned is Agrobacterium EHA105.

9. The application of the multi-MATE family gene mutant material according to any one of claims 1-8 in the creation of rice with tillering ability under nitrogen reduction conditions.

Images