Method for quickly verifying availability of PCR (Polymerase Chain Reaction) primer

Abstract

The invention discloses a method for quickly verifying the availability of PCR (Polymerase Chain Reaction) primers. Compared with a computer simulation method, the method provided by the invention has the advantages that a verification result of a real experiment is higher in credibility; compared with a conventional qPCR (quantitative polymerase chain reaction) or agarose gel electrophoresis method, the method has the advantages that species sources of genes do not need to be determined, tissues, cells or thalli of the species do not need to be obtained, and the primer pair can be conveniently and quickly evaluated; meanwhile, an NGS sequencing method is combined, so that the flux of primer evaluation is improved.

Description

Technical Field

[0001] This invention belongs to the field of PCR primer availability verification technology. Specifically, this invention relates to a method for rapidly verifying the availability of PCR primers. Background Technology

[0002] Polymerase Chain Reaction (PCR) is a core molecular biology technique for rapidly amplifying specific DNA fragments in vitro. It achieves exponential replication of target DNA through a cycle of three steps: high-temperature denaturation (separating the DNA double strand), low-temperature annealing (primer binding to the template), and optimal-temperature extension (DNA polymerase synthesizing a new strand). This technology is widely used in gene cloning, pathogen detection, genetic disease diagnosis, forensic identification, and species evolution analysis, and is hailed as a "cornerstone tool" of modern life sciences. PCR primer design is crucial for experimental success and requires consideration of multiple factors, such as sequence characteristics (primer length is typically 18-25 bp, GC content 40%-60%, avoiding consecutive repetitive bases); thermodynamic parameters (Tm values ​​of the forward and reverse primers must match (difference ≤2°C), and the 3' end should be stable (preferably ending with G / C); and specificity (homology with non-target sequences is eliminated through BLAST alignment, avoiding primer dimers and hairpin structures (ΔG value must be higher than the threshold)). Even rationally designed primer sets, especially multiplex amplification primer sets, still need to be verified through bioinformatics tool simulation analysis and wet experiments to determine the usability and optimal combination of the primer set.

[0003] Currently, there are two main strategies for verifying PCR primer availability: computer simulation and experimental verification. Computer simulation is implemented using computer programs. Typically, primer and template sequences are input, and calculations are performed to obtain results such as primer specificity, amplicon length, and primer interactions (e.g., primer dimers), thereby determining primer availability. Examples include UCSC In-Silico PCR, Electronic PCR, and Primer-BLAST. However, computer simulation only provides predictions and often deviates from actual experiments, requiring further verification through wet experiments. Common wet experimental verification methods include qPCR amplification curve analysis, melting curve analysis, and agarose gel electrophoresis. These methods typically perform a separate PCR reaction for each primer pair, using different signals (fluorescence signals, electrophoretic bands) to determine if primer amplification is normal. This is a low-throughput method and requires obtaining template nucleic acid.

[0004] Therefore, it is essential to provide a rapid, accurate, and high-throughput method for validating the availability of PCR primers. Summary of the Invention

[0005] To overcome the shortcomings of existing technologies, the purpose of this invention is to provide a rapid, accurate, and high-throughput method for verifying the usability of PCR primers.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of this invention provides a method for rapidly verifying the usability of PCR primers.

[0007] Furthermore, the method includes: 1) Connect the 3' ends of the upstream and downstream primers to be validated to the 5' ends of the upstream and downstream primers of the simulated target region (mTag) to obtain artificially lengthened primer sequences, and then synthesize primers; 2) Using the artificially lengthened primers obtained above, and using the nucleic acid of the simulated target region as a template, the intermediate sequence of the simulated target region was amplified by conventional PCR to obtain an artificially synthesized PCR template (containing the specific primer region and the intermediate sequence of the simulated target region). 3) Use the primers to be validated to perform multiplex PCR amplification on the artificially synthesized PCR simulation template, detect the amplification products, and obtain the number of amplicon corresponding to the primers to be validated, which is used to characterize and evaluate the usability of the primers to be tested.

[0008] Furthermore, the number of primers to be verified is n pairs, where n is an integer greater than or equal to 2.

[0009] In some embodiments of the present invention, the primers to be verified include multiplex PCR primers designed for the testing purpose, which may be 2 pairs, 3 pairs, 4 pairs, 5 pairs, etc.

[0010] In this invention, primers refer to short nucleic acid molecules. A hybrid can be formed between the primer and the target nucleic acid strand through nucleic acid hybridization and annealing with a complementary target nucleic acid molecule. The primer can be extended along the target nucleic acid molecule using polymerase. Therefore, primers can be used to amplify target nucleic acid molecules, wherein the primer sequence is specific to the target nucleic acid molecule.

[0011] A target nucleic acid molecule refers to a nucleic acid molecule intended for detection, quantification, qualitative analysis, or a combination thereof. The nucleic acid molecule does not necessarily have to be in purified form. Various other nucleic acid molecules can coexist with the target nucleic acid molecule. For example, the target nucleic acid molecule can be a specific nucleic acid molecule intended for amplification. If necessary, the purification or isolation of the target nucleic acid molecule can be performed using methods known to those skilled in the art, such as using commercially available purification kits. In this invention, there is no limitation on the target nucleic acid molecule / amplifier to be validated, and the method provided by this invention is effective for evaluating the primer availability of any target nucleic acid molecule.

[0012] Furthermore, the simulated target region intermediate sequence is a DNA sequence with a length of 150-350 bp and a GC content of 25%-75%.

[0013] Furthermore, the GC content difference between the simulated target region intermediate sequence and the primer amplicon intermediate sequence to be verified does not exceed 10%.

[0014] Furthermore, the intermediate sequence of the simulated target region is not homologous to the primer amplicon to be verified.

[0015] Furthermore, the base sequence of the intermediate sequence of the simulated target region is as shown in any one of SEQ ID NO:1-15.

[0016] In some embodiments of the present invention, the simulated target region intermediate sequence is a DNA sequence with a length of 190-210 bp and a GC content of 35%-70%. In a specific embodiment of the present invention, the simulated target region intermediate sequence is any of the base sequences shown in SEQ ID NO:1-15.

[0017] In this invention, the middle sequence of the simulated target region is spliced ​​into the middle of the amplicon of the primer to be verified, which can be used as an artificially synthesized PCR simulation template to complete the usability verification of the primer to be verified.

[0018] In this invention, the primer amplicon to be verified refers to the target DNA fragment amplified by a pair of specific primers. The intermediate sequence of the primer amplicon to be verified refers to the nucleic acid sequence located between the two specific primer binding sites in the amplicon to be verified.

[0019] Furthermore, the method obtains results using the following criteria: when the proportion of amplicones in the primer to be verified is less than 0.05% to 1%, the primer to be verified has poor amplification ability and is unusable; when the proportion of amplicones in the primer to be verified is greater than or equal to 0.05% to 1%, the primer to be verified has amplification ability and is usable.

[0020] In this invention, the method obtains results according to the following criteria: when the proportion of amplicones in the primer to be verified is less than 0.05% to 1%, the primer to be verified has poor amplification ability and is unusable; when the proportion of amplicones in the primer to be verified is greater than or equal to 0.05% to 1%, the primer to be verified has amplification ability and is usable.

[0021] Furthermore, the method for obtaining the number of amplicones of the primers to be verified is high-throughput sequencing.

[0022] Furthermore, the high-throughput sequencing process includes steps such as purification of the amplification products, library amplification, purification of the library amplification products, and library quantification.

[0023] In an embodiment of the present invention, the method for obtaining the number of primer amplicon numbers to be verified is high-throughput sequencing.

[0024] In some implementations, the high-throughput sequencing can be performed using various high-throughput sequencing platforms and equipment, including reversible terminal termination sequencing, semiconductor sequencing, combined probe anchoring polymerization sequencing, single-molecule real-time sequencing, single-molecule nanopore sequencing, and solid-state nanopore sequencing.

[0025] In some implementations, the high-throughput sequencing can be performed using high-throughput sequencing platforms including Illumina NovaSeq, HiSeq XTen, Illumina HiSeq, Illumina MiSeq, PacBio Sequel, 10×Genomics, and MGISEQ-2000.

[0026] In some embodiments of the present invention, a step of running a multiplex PCR library preparation procedure is included before high-throughput sequencing. Running the multiplex PCR library preparation procedure includes the steps of purifying the multiplex amplification product, amplifying the library, purifying the amplified library product, and quantifying the library.

[0027] In some implementation schemes, library amplification can be divided into two main categories: temperature-dependent amplification and temperature-dependent amplification. Temperature-dependent amplification mainly includes classic polymerase chain reaction (PCR) and ligase chain reaction (LCR), while temperature-dependent amplification includes strand displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated amplification (LAMP), helicase-dependent isothermal DNA amplification (HDA), nucleic acid sequence-based amplification (NASBA), and transcription-based amplification systems (TAS). In this specific embodiment, PCR is used as an example for library construction.

[0028] In some embodiments, primers containing a tag sequence (Index) may be used in the library amplification. By amplifying the ligation product using primers containing the tag sequence, data from different sample sources in sequencing can be distinguished, and the sample origin can be identified. The design method of the tag sequence and the design of primers containing the tag sequence (Index) are both commonly known to those skilled in the art.

[0029] Furthermore, the conventional PCR amplification or multiplex PCR amplification is performed under similar amplification conditions.

[0030] Furthermore, based on a total volume of 50 μL, the conventional PCR amplification system includes: 25 μL of PCR Mix, 5 μL of artificially lengthened primers, 2 μL of simulated target region intermediate sequence, and the remainder being water.

[0031] Furthermore, the conventional PCR amplification reaction program is as follows: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 60℃ annealing for 15s, 72℃ extension for 20s, 30 cycles of denaturation, annealing, and extension; final extension at 72℃ for 2min; and storage at 4℃.

[0032] Furthermore, based on a total volume of 30 μL, the multiplex PCR amplification system includes: 10 μL of mPCR Mix, 5 μL of primers to be validated, and 15 μL of template nucleic acid.

[0033] Furthermore, the reaction program for the multiplex PCR amplification is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 20 s, annealing at 63°C for 2 min, extension at 72°C for 5 min, followed by 23 cycles of denaturation, annealing, and extension; final extension at 72°C for 5 min; and storage at 4°C.

[0034] The embodiments section of this invention provides exemplary embodiments of amplification conditions. However, as used herein, the term "amplification conditions" refers to a temperature and / or incubation time suitable for obtaining a detectable amount of the target. Therefore, the term "similar amplification conditions" means that, if desired, targets can be assayed at similar temperatures. The term "similar amplification conditions" also means that, if desired, targets can be assayed at similar incubation times. In some cases, the term "similar amplification conditions" also refers to the number of amplification cycles. However, it is well known in the art that the number of cycles is not always strict. For example, some samples may be removed or left to undergo additional amplification cycles before other samples. In other cases, the term "similar amplification conditions" also refers to the nature of the buffer and amplification reagents (enzymes, nucleotides, salts, etc.) used. The term "similar amplification conditions" also means that conditions (e.g., time, buffer, number of cycles, temperature, etc.) may be slightly varied or may be the same.

[0035] A second aspect of the present invention provides a system.

[0036] Furthermore, the system includes a processing unit that implements the method described in the first aspect of the present invention.

[0037] A third aspect of the present invention provides a computer device and a computer-readable storage medium.

[0038] Furthermore, the computer device includes a memory and a processor, the memory being used to store program instructions; the processor being used to invoke the program instructions, which, when executed, implement the method described in the first aspect of the present invention.

[0039] Furthermore, the computer-readable storage medium stores a computer program that, when executed by a processor, implements the method described in the first aspect of the present invention.

[0040] Advantages and beneficial effects of the present invention: (1) Compared with computer simulation methods, the present invention is a verification result of real experiments, and its credibility is higher; (2) Compared with conventional qPCR or agarose gel electrophoresis, this invention does not rely on real template nucleic acid, does not require a clear species origin of the gene, and does not require obtaining the tissue, cell or bacterial body of the species, which can conveniently and quickly evaluate primer pairs; at the same time, combined with NGS sequencing, it improves the throughput of primer evaluation. Attached Figure Description

[0041] Figure 1 This shows a schematic diagram of two sets of artificially synthesized PCR simulation template settings; Figure 2 This demonstrates the uniformity of the two sets of template nucleic acid libraries constructed using three pairs of primers; Figure 3 This shows the amplification capacity of each amplicon under two different nucleic acid templates. Detailed Implementation

[0042] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments thereof. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments.

[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0044] This invention uses conventional PCR methods to ligate the primers to be validated into the middle sequence of a simulated target region, obtaining an artificially synthesized PCR template. This simulated template nucleic acid is then used instead of the real template nucleic acid to verify the usability of the PCR primers. This method eliminates the need to obtain the real template nucleic acid, improving the ease of operation.

[0045] Example 1: PCR Primer Usability Validation Method 1. Experimental materials Amplification reagent: NEBNext® High-Fidelity 2X PCR Master Mix, manufacturer: NEB, catalog number: M0541; Magnetic bead purification: Agencourt AMPure XP magnetic beads, manufacturer Beckman Coulter, catalog number A63882; anhydrous ethanol (superior grade), manufacturer Xilong, catalog number 1280340501600; Product quantification: StarLighter dsDNA HS Assay Kit, manufactured by Beijing Qihengxing Biotechnology Co., Ltd., catalog number FS-T1009; Library construction reagent: A commercially available multiplex amplification library construction kit developed for the SBS high-throughput sequencing platform; Sequencing reagents: Salus Pro sequencing reagent kit (SRM-SE75-300M), manufacturer: Shenzhen Salus Medical Technology Co., Ltd., product number: SRM-SE75-300M.

[0046] 2. Experimental Methods Step 1: Design of the intermediate sequence of the simulated target region and its primers This experiment used three pairs of primers (D1, D2, and D3) for testing. The nucleic acid sequence (GC content of 51%) located between the two specific primer binding sites in the amplicon of the primer to be validated was replaced with different simulated target region intermediate sequences. Simultaneously, to assess the impact of differences in template GC content on primer evaluation, this experiment divided the simulated target region intermediate sequences into two groups (…). Figure 1 The groups are divided into two groups: one with similar GC content and the other with different GC content. See Table 1 for details.

[0047] Table 1. Sequence and GC content information in the middle of the two simulated target regions.

[0048] Step 2: Synthesis of artificially lengthened primers Based on the simulated target region intermediate sequence designed in Step 1, mTag-specific primers were designed. Two primers were tandemly linked in the order of the primer sequence to be validated first, followed by the mTag-specific primer sequence, to form artificially extended primers. For example, if the upstream primer of the primer to be validated, D1, is AGGTGCTTTATCGCGGTGAT, and the upstream primer of mTag1 is TGATGGGGCTAGGATCAGGT, then the artificially extended primers formed are AGGTGCTTTATCGCGGTGATTGATGGGGCTAGGATCAGGT. The artificially extended primer sequences were sent to Sangon Biotech (Shanghai) Co., Ltd. for primer synthesis at 100 μM, followed by PAGE purification. Detailed sequence information for the simulated target region-specific primer sequences and the three pairs of primers to be validated is shown in Table 2.

[0049] Table 2. Information on primer sequences specific to the simulated target region and primer sequences to be validated.

[0050] Step 3: Preparation of artificially synthesized PCR templates Artificially synthesized PCR template nucleic acid was prepared by PCR amplification. The PCR amplification system consisted of 12.5 μL PCR Mix, 2.5 μL upstream artificially extended primer, 2.5 μL downstream artificially extended primer, 2 μL simulated target region intermediate sequence, and 18 μL nuclease-free water. The PCR amplification reaction program was as follows: 98℃ for 30 s; 98℃ for 10 s → 60℃ for 15 s → 72℃ for 20 s, for 30 cycles; 72℃ for 2 min; and stored at 4℃.

[0051] After the amplification reaction, the PCR product was purified using magnetic beads. The purification steps were as follows: 50 μl of AMPure XP magnetic beads were added to the PCR product, mixed thoroughly, and allowed to stand for 5 min. The PCR tube was placed in a magnetic rack to separate the magnetic beads and liquid. After the solution became clear, the supernatant was carefully removed. The PCR tube remained in the magnetic rack, and 200 μl of nuclease-free water was added to freshly prepared 80% ethanol to rinse the magnetic beads. After incubation at room temperature for 30 sec, the supernatant was carefully removed. This rinsing process was repeated once. The PCR tube remained in the magnetic rack, and the magnetic beads were dried at room temperature. 22 μl of nuclease-free water was added, and the mixture was pipetted until thoroughly mixed. The mixture was allowed to stand at room temperature for 5 min. The PCR tube was briefly centrifuged and placed in a magnetic rack to stand. After the solution became clear, 20 μl of the supernatant was carefully transferred to a new PCR tube. The concentration of the amplification product was determined using a Qubit analyzer.

[0052] Step 4: Targeted NGS (tNGS) library construction and sequencing of two sets of artificially synthesized PCR mock templates. The artificially synthesized PCR simulated template nucleic acid and its corresponding real template nucleic acid from the two groups were mixed in equal amounts and used as the template nucleic acid for tNGS.

[0053] Multiplex amplification: Multiplex PCR amplification was performed using the two sets of artificially synthesized PCR template nucleic acids and their corresponding primers obtained above. The amplification system consisted of 5 μL of amplification primers, 10 μL of amplification primer mPCR Mix, and 15 μL of a mixture of artificially synthesized PCR template nucleic acids and their corresponding real template nucleic acids. The reaction program was: 95℃ for 3 min; 95℃ for 20 s → 63℃ for 2 min → 72℃ for 5 min, repeated 23 times; 72℃ for 5 min; stored at 4℃.

[0054] After the amplification reaction, the PCR product was purified using magnetic beads. The purification steps are as follows: 1) Add 15 μL of DNA clean beads to the PCR product; vortex to mix and incubate at room temperature for 5 min; 2) Briefly centrifuge the PCR tube and place it on a magnetic rack. After the solution becomes clear (about 2 min), carefully transfer the supernatant to a new PCR tube; 3) Add 15 μL of DNA clean beads to the supernatant; vortex to mix and incubate at room temperature for 5 min; 4) Briefly centrifuge the PCR tube and place it on a magnetic rack. After the solution becomes clear (about 2 min), carefully remove the supernatant; 5) Keep the PCR tube on a magnetic rack, add 100 μL of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 s, and carefully remove the supernatant; 6) Repeat step 5); 7) Keep the PCR tube on a magnetic rack, open the cap and dry the magnetic beads (2-5 min, depending on the actual situation); 8) Add 15 μL of Nuclease-Free to the PCR tube. Water, vortex to mix, incubate at room temperature for 5 min, briefly centrifuge the PCR tube and place it in a magnetic rack to separate the magnetic beads and liquid. After the solution becomes clear (about 2 min), carefully aspirate 13 μL of the supernatant for the next round of PCR.

[0055] Library amplification: The amplification system consisted of 15 μL 2nd-PCR Mix, 13 μL multiplex PCR product, 1 μL Index-i5, and 1 μL Index-i7. The reaction program was 98℃ for 45 s; 98℃ for 15 s → 60℃ for 30 s → 72℃ for 30 s, for 11 cycles; 72℃ for 2 min; and stored at 4℃.

[0056] Library amplification product purification: After the library amplification reaction, the PCR products were purified using magnetic beads. The purification steps are as follows: 1) Add 24 μL of DNA clean beads to the PCR reaction solution; vortex to mix and incubate at room temperature for 5 min; 2) Briefly centrifuge the PCR tube and place it on a magnetic rack. After the solution becomes clear (about 2 min), carefully remove the supernatant; 3) Keep the PCR tube on the magnetic rack, add 100 μL of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 s, and carefully remove the supernatant; 4) Repeat step 3); 5) Keep the PCR tube on the magnetic rack, open the cap to dry the magnetic beads (2-5 min, depending on the actual situation). Note: Over-drying of the magnetic beads will affect the purification effect; 6) Remove the PCR tube from the magnetic rack, add 25 μL of Nuclease-Free Water, vortex to mix, and incubate at room temperature for 5 min. min; 7) Briefly centrifuge the PCR tube and place it in a magnetic rack to separate the magnetic beads and liquid. After the solution becomes clear (about 2 min), carefully aspirate the supernatant into a new centrifuge tube to complete the library construction.

[0057] Library quantification: 1) It is recommended to use the Qubit® dsDNA HS Assay Kit for library quantification. For specific instructions, please refer to the Qubit® dsDNA HS Assay Kit manual; 2) Mix 1 μL of the library with 199 μL of pre-prepared Qubit-DNA quantification working solution, perform Qubit quantification, and record the library concentration.

[0058] Sequencing data quality requirements: 1) Data volume: 500k reads / library; 2) Sequencing mode: paired-end index; single-end sequencing: 75bp.

[0059] Data Analysis: The off-sequencing data was processed and compared using a targeted high-throughput sequencing data analysis workflow developed in-house. First, sequencing data quality control was performed to remove sequencing sequences that did not meet Q20 requirements. Then, primer dimer sequence filtering was performed to remove sequencing sequences that were too short. Finally, the Bowtie2 alignment tool was used to perform sequencing sequence alignment analysis, outputting the number of sequences detected for each amplicon.

[0060] Evaluation of amplification uniformity between the two templates: The Gini coefficient and coefficient of variation of the number of amplicon reads were calculated using the numpy module of Python to evaluate whether there were differences or biases in amplification of the primer pairs after changing to different sequences.

[0061] Table 3 shows the statistical results of library construction using two sets of templates for the three primer pairs in this experiment. As can be seen from Table 3, the overall homogeneity of the three groups is good, with coefficients of variation (CV) less than 0.3 and Gini coefficients less than 0.2. This indicates that the amplification capacity of each primer pair for artificially synthesized PCR simulated template nucleic acids is almost identical, meaning that replacing the middle fragment of the template with different mTag sequences has almost no impact on primer amplification efficiency. More specifically, the groups with no difference in GC content showed better homogeneity than the groups with differences in GC content. Figure 2 This indicates that using mTag sequences with similar GC content has less impact on primer amplification.

[0062] Table 3. Statistical table of library construction results for two sets of template nucleic acids using three pairs of primers.

[0063] Example 2: Availability screening of a set of multiple primers Example 1 verified the feasibility of the present invention. To further evaluate the practicality of the method, the usability of a set of primers was screened using the method of the present invention. Specifically, this experiment used a set of multiplex primers containing 286 primer pairs for testing to remove primer pairs with poor amplification efficiency. Simultaneously, this experiment used real template nucleic acid and artificially synthesized PCR simulated template nucleic acid to evaluate the effect of artificially synthesized PCR simulated template nucleic acid. The specific experimental procedure is as follows: Step 1: Preparation of two template nucleic acids (1) Preparation of real template nucleic acid: 286 amplicon sequences were sent to Sangon Biotech (Shanghai) Co., Ltd. for DNA nucleic acid synthesis, with a required synthesis amount of 4 μg. After obtaining 286 template nucleic acids, they were mixed in equal amounts and diluted to 1000 copies / μl for later use.

[0064] (2) Preparation of artificially synthesized PCR template nucleic acid: Design of simulated target region intermediate sequences and their primers: Based on the development objectives of the corresponding multiplex PCR system, sequences with no homology to the test primer set were selected for the design of universal simulated target region intermediate sequences and their primers. This embodiment uses a pathogen multiplex primer set; therefore, sequences from Arabidopsis thaliana and some artificial sequences with no homology to clinical pathogens were selected for the design of universal simulated target region intermediate sequences. The design tool was Primer3. A total of 15 simulated target region intermediate sequences and their corresponding primers were obtained (Table 4), with fragment lengths ranging from 190 to 210 bp. The GC content of the simulated target region sequences covered 35% to 75%, and the difference in GC content between any two sequences did not exceed 4%, to meet the requirements for amplicon use with different GC contents.

[0065] Table 4 mTag sequences and their primer information

[0066] GC content was calculated for each amplicon in multiplex PCR, and an mTag sequence with the smallest GC content difference was assigned to each. Then, two primers were tandemly linked in sequence, with the multiplex primer sequence first and the mTag primer sequence second, to form artificially extended primers. The primer sequences were sent to Sangon Biotech (Shanghai) Co., Ltd. for primer synthesis at 100 μM, and purified by PAGE. Artificially synthesized PCR-simulated nucleic acids for each amplicon were prepared by PCR amplification. The amplification system consisted of: 12.5 μL PCR Mix, 2.5 μL upstream artificially extended primer, 2.5 μL downstream artificially extended primer, 2 μL mTag, and 18 μL nuclease-free water. The PCR amplification reaction program was: 98℃ for 30 s; 98℃ for 10 s → 60℃ for 15 s → 72℃ for 20 s, 30 cycles; 72℃ for 2 min; stored at 4℃.

[0067] After the amplification reaction, the PCR product was purified using magnetic beads. The purification steps were as follows: 50 μl of AMPure XP magnetic beads were added to the PCR product, mixed thoroughly, and incubated for 5 min. The PCR tube was placed in a magnetic rack to separate the magnetic beads and liquid. After the solution became clear, the supernatant was carefully removed. The PCR tube remained in the magnetic rack, and 200 μl of nuclease-free water was added to freshly prepared 80% ethanol to rinse the magnetic beads. After incubation at room temperature for 30 sec, the supernatant was carefully removed. This rinsing process was repeated once. The PCR tube remained in the magnetic rack, and the magnetic beads were dried at room temperature. 22 μl of nuclease-free water was added, and the mixture was pipetted until thoroughly mixed. The mixture was incubated at room temperature for 5 min. The PCR tube was briefly centrifuged and placed in a magnetic rack to incubate. After the solution became clear, 20 μl of the supernatant was carefully transferred to a new PCR tube. The concentration of the amplification product was determined using a Qubit analyzer.

[0068] The artificially synthesized PCR template nucleic acid of the 286 amplicon prepared above was mixed in equal amounts and diluted to 1000 copies / μl for later use.

[0069] Step 2: Equal mixing of 286 primer pairs Equal amounts of 286 multiplex primer pairs were mixed. The 286 multiplex primer pairs for this experiment were sent to Sangon Biotech (Shanghai) Co., Ltd. for primer synthesis. The required synthesis concentration was 100 μM, and purification was performed using PAGE. After obtaining the primers, equal amounts of each primer were mixed to obtain the primer set to be validated for tNGS library construction and testing.

[0070] Step 3: tNGS library preparation and sequencing test tNGS library preparation: Multiplex amplification and library preparation sequencing were performed using the two template nucleic acids obtained in step one and the set of primers to be validated obtained in step two. The specific experimental steps are the same as the library preparation step in Example 1.

[0071] Data Analysis: The off-sequencing data was processed and compared using a targeted high-throughput sequencing data analysis workflow developed in-house. First, sequencing data quality control was performed to remove sequencing sequences that did not meet Q20 requirements. Then, primer dimer sequence filtering was performed to remove sequencing sequences that were too short. Finally, the Bowtie2 alignment tool was used to perform sequencing sequence alignment analysis, outputting the number of sequences detected for each amplicon.

[0072] Primer usability evaluation: The number of reads for each amplicon of the two template nucleic acids was counted. Primer pairs with a read count of less than 0.05% were considered to have poor amplification efficiency. The differences in amplification ability between primer pairs obtained from the two templates were compared.

[0073] 3. Experimental Results This experiment used both real template nucleic acids and artificially synthesized PCR-simulated template nucleic acids. Multiplex PCR targeted sequencing was employed to evaluate a set of multiplex primers, screening out primer pairs with poor amplification capabilities. Experimental results are shown below. Figure 3 .from Figure 3 The results show that the amplicon primer pairs under the two templates exhibit highly consistent amplification capabilities, indicating that artificially synthesized PCR-simulated template nucleic acids can replace real templates to characterize the amplification capabilities of primer pairs.

[0074] Further analysis of the amplification capabilities of each primer pair was performed, classifying them as follows: primer pairs with a read count percentage less than 0.05% were considered to have poor amplification efficiency (labeled F; other primer pairs were labeled T). The differences in amplification capabilities between the two templates are shown in Table 5. Table 5 shows that the artificially synthesized PCR simulated template nucleic acid identified 26 primer pairs with poor amplification capabilities, of which 20 pairs were consistent with the classification of the real template. This further demonstrates the feasibility of the method of this invention.

[0075] Table 5. Amplification capacity classification of each primer pair for each amplicon

[0076] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A method for rapid verification of PCR primer usability, characterized in that, The method comprises: 1) connecting the 3' end of the upstream and downstream primers to be verified to the 5' end of the upstream and downstream primers of the middle sequence of the simulated target region respectively to obtain artificial lengthened primer sequences, and performing primer synthesis; 2) using the artificial lengthened primers obtained above, performing conventional PCR amplification on the middle sequence of the simulated target region using the nucleic acid of the simulated target region as a template to obtain an artificial synthetic PCR simulation template; 3) using the primers to be verified to perform multiplex PCR amplification on the artificial synthetic PCR simulation template, detecting the amplification products, and obtaining the quantity information of the amplification products corresponding to the primers to be verified, which is used to characterize and evaluate the usability of the primers to be tested.

2. The method of claim 1, wherein, The number of primers to be verified is n pairs, and n is an integer greater than or equal to 2.

3. The method of claim 1, wherein, The middle sequence of the simulated target region is a DNA sequence with a length of 150-350 bp and a GC content of 25%-75%; Preferably, the GC content difference between the middle sequence of the simulated target region and the primer to be verified is not more than 10%; Preferably, the middle sequence of the simulated target region and the primer to be verified are non-homologous; More preferably, the base sequence of the middle sequence of the simulated target region is shown in any one of SEQ ID NO: 1-15.

4. The method of claim 1, wherein, The method obtains the following results by the following standards: when the number of primers to be verified accounts for less than 0.05%-1%, the primers to be verified have poor amplification ability and are unusable; When the number of primers to be verified accounts for greater than or equal to 0.05%-1%, the primers to be verified have amplification ability and are usable.

5. The method of claim 1, wherein, The method for obtaining the quantity information of the primers to be verified is high-throughput sequencing; Preferably, the high-throughput sequencing further comprises the steps of purifying the amplification products, library amplification, purifying the library amplification products, and library quantification.

6. The method of claim 1, wherein, The conventional PCR amplification or multiplex PCR amplification is performed under similar amplification conditions.

7. The method of claim 6, wherein, The system comprises a processing unit, and the processing unit implements the method of any one of claims 1-8. ​ 8. The method of claim 6, wherein, ​ ​ 9. A system, characterized by ​ 10. A computer device and a computer readable storage medium, characterized in that, The computer device comprises a memory and a processor, the memory is used for storing program instructions; the processor is used for calling the program instructions, and the program instructions are executed to implement the method in any one of claims 1-8. The computer readable storage medium stores a computer program, and the computer program is executed by the processor to implement the method in any one of claims 1-8.

Images