Hsa-miR-185-5p primer group, kit and method for PTC (Positive Temperature Coefficient) transfer risk detection in high-iodine environment

By using the hsa-miR-185-5p primer set and kit, combined with serum exosome samples, the shortcomings of PTC transfer risk assessment under high iodine conditions were addressed, achieving detection with high specificity and stability. This confirmed that high iodine is an independent risk factor for PTC transfer and provided a convenient risk assessment tool.

CN121518656APending Publication Date: 2026-02-13SHANDONG FIRST MEDICAL UNIV & SHANDONG ACADEMY OF MEDICAL SCI
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202610055368.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-16
Publication Date
2026-02-13

AI Technical Summary

Technical Problem

Existing technologies lack effective means of assessing the risk of PTC transfer in high-iodine environments. Traditional methods such as ultrasound, FNA, and intraoperative frozen section pathology have limitations. miRNA markers are not affected by the iodine environment, resulting in insufficient detection stability and accuracy. There is also a lack of specific assessment tools related to high iodine.

Method used

Using hsa-miR-185-5p primers and kits, combined with serum exosome samples, a standardized detection process was constructed. The risk of PTC transfer was assessed by detecting miR-185-5p expression levels, confirming that high iodine is an independent risk factor and providing a convenient risk assessment tool.

Benefits of technology

It achieves specificity and stability detection of PTC transfer risk under high iodine environment, with an area under the ROC curve (AUC) of 0.79, providing predictive value for preoperative risk assessment and is suitable for clinical operation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121518656A_ABST
    Figure CN121518656A_ABST
Patent Text Reader

Abstract

The invention discloses an hsa-miR-185-5p primer group, a kit and a method for PTC (Positive Temperature Coefficient) metastasis risk detection in a high-iodine environment, and belongs to the technical field of in-vitro auxiliary evaluation of tumor molecules. The primer group comprises hsa-miR-185-5p, a nucleotide sequence of the hsa-miR-185-5p is as shown in SEQ ID NO. 1; the nucleotide sequence of the U6 upstream primer is as shown in SEQ ID NO. 2; the nucleotide sequence of the U6 downstream primer is as shown in SEQ ID NO. 3; and the nucleotide sequence of the miRNA reverse universal downstream primer is as shown in SEQ ID NO. 4. The invention proves that high iodine is an independent risk factor of PTC lymph node metastasis; it is found that the serum exosome miR-185-5p under high iodine is a PTC LNM specific marker; a detection kit containing an autonomously designed primer group and a standardized detection process are constructed, the kit is clinically adapted, and a non-invasive and accurate auxiliary detection tool is provided for metastasis risk stratification of PTC subjects in high-iodine regions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of in vitro molecular auxiliary assessment technology for tumors, specifically to hsa-miR-185-5p primer set, reagent kit and method for detecting PTC metastasis risk under high iodine environment. Background Technology

[0002] Currently, clinical risk assessment for PTC LNM mainly relies on the following techniques, with relevant standards referring to the "Chinese Guidelines for Integrated Diagnosis and Treatment of Cancer (CACA) - Tumor Types": Ultrasound examination: The risk of malignancy of thyroid nodules is assessed by identifying malignant signs (microcalcifications, aspect ratio >1, solid hypoechoic area, abnormal cervical lymph node ultrasound, indistinct and irregular / lobulated borders, extrathyroidal invasion). At least 4 malignant signs must be met simultaneously for a preliminary diagnosis of malignancy, but the misdiagnosis rate of a single sign is relatively high. Fine needle aspiration (FNA) cytopathology: PTC is identified by observing the morphological characteristics of the punctured cells, such as papillary / monolayer sheet arrangement, whorled sheets, longitudinal nuclear grooves, and intranuclear pseudo-inclusion bodies. However, due to the influence of sampling quality and the subjectivity of cell morphology interpretation, there is a certain false negative rate. Intraoperative frozen section pathology: By sending lymph node tissue separately after surgery, cancer cells or psammoma bodies are observed under a microscope (continuous sectioning is required for confirmation) to determine the presence of LNM. This is a postoperative assessment method, which cannot assess the risk of metastasis before surgery, and has a low detection rate for micrometastases.

[0003] Existing research has confirmed that some miRNAs are associated with the occurrence and development of PTC, and some miRNAs have been attempted as biomarkers for PTC risk assessment. However, such studies mostly focus on miRNAs in tumor tissues or ordinary serum samples, without taking into account the key environmental factor of serum iodine level, and have not developed specific biomarkers for specific pathological processes of PTC (such as LNM). At the same time, existing miRNA detection methods mostly do not use serum exosome samples (exosomes can protect miRNAs from degradation and improve detection stability), resulting in limited reproducibility and accuracy of detection.

[0004] The World Health Organization (WHO) has defined the reference range for serum iodine concentration (45-90 μg / L is normal iodine level, and >90 μg / L is high iodine level). Existing studies have shown that abnormal iodine intake (too high or too low) is associated with diseases such as thyroiditis and thyroid nodules, but high iodine has not yet been confirmed as an independent risk factor for LNM in patients with PTC, nor have any specific molecular markers for risk assessment of LNM in PTC under high iodine conditions been found. This has resulted in a lack of targeted technical means for risk assessment of LNM in PTC subjects in high iodine areas.

[0005] 1. Limitations of traditional clinical risk assessment methods Insufficient preoperative risk assessment methods: Ultrasound and FNA are both preoperative examinations, but ultrasound has low specificity for early LNM (e.g., small metastatic lesions have no typical ultrasound signs), and FNA cannot directly assess lymph node metastasis; intraoperative frozen section pathology depends on surgery and cannot guide surgical planning (e.g., whether to perform lymph node dissection) preoperatively. Subjectivity and error in assessment: interpretation of ultrasound signs and identification of cell morphology by FNA both rely on physician experience and are subject to subjective bias; intraoperative frozen section pathology of psammoma samples requires continuous sectioning for confirmation, which is cumbersome and prone to missing micrometastases.

[0006] 2. Deficiencies in the application of existing miRNA biomarkers The influence of iodine environment was not considered: existing studies on PTC-related miRNA biomarkers did not distinguish between differences in serum iodine levels. When applied in high-iodine areas, the accuracy of auxiliary assessment was low because the regulatory effect of iodine on miRNA expression was not excluded (e.g., miRNAs that are not different under normal iodine environment only have risk assessment value under high iodine environment). Sample and detection system mismatch: Existing studies mostly use tumor tissue or ordinary serum samples, without utilizing the protective effect of serum exosomes on miRNAs, resulting in high miRNA degradation rates and poor detection stability; and a standardized detection system of "exosome extraction-RNA quality control-qRT-PCR quantification" has not been constructed, resulting in insufficient reproducibility of results.

[0007] 3. Lack of research on the association between serum iodine and PTC LNM Existing research only clarifies the macroscopic association between iodine and thyroid diseases, but has not confirmed through multivariate regression analysis that "high iodine is an independent risk factor for PTC LNM". It has also not explored the specific molecular mechanisms (such as miRNA regulatory pathways) related to PTC LNM in high-iodine environments. As a result, there are gaps in the research on the etiology and risk assessment technology of LNM in PTC subjects in high-iodine areas, which cannot meet the clinical needs for accurate risk assessment of PTC LNM in high-iodine environments. Summary of the Invention

[0008] The purpose of this invention is to provide an hsa-miR-185-5p primer set, kit, and method for detecting PTC transfer risk under high iodine conditions. The problems to be solved by this invention are: traditional PTC LNM risk assessment methods have limitations; existing miRNA markers do not bind to high iodine environments and mostly do not use serum exosome samples, resulting in insufficient specificity and poor detection stability in high iodine areas; and there is a lack of high iodine-related PTC LNM risk assessment tools.

[0009] The technical solution provided by this invention is an hsa-miR-185-5p primer set for detecting PTC transfer risk under high iodine conditions, comprising: The upstream primer of hsa-miR-185-5p has the nucleotide sequence shown in SEQ ID NO.1, namely: TGGAGAGAAAGGCAGTTCCTGA; The upstream primer for U6 has the nucleotide sequence shown in SEQ ID NO.2, namely: GCTTCGGCAGCACATATACTAAAAT; The downstream primer of U6 has the nucleotide sequence shown in SEQ ID NO.3, namely: CGCTTCACGAATTTGCGTGTCAT; The reverse universal downstream primer for miRNA has the nucleotide sequence shown in SEQ ID NO.4, namely GACTCGAGTCGACATCG.

[0010] The present invention also provides an hsa-miR-185-5p detection kit for detecting the risk of PTC transfer under high iodine conditions, comprising the primer set described above.

[0011] The beneficial effects of this application are as follows: This study confirms that high iodine levels are an independent risk factor for lymph node metastasis in papillary thyroid carcinoma (PTC LNM), providing a basis for metastasis risk stratification in PTC subjects in high-iodine areas. Serum exosome miR-185-5p was found to be a specific marker for PTC LNM under high iodine conditions. Serum sampling is non-invasive and has good predictive value (AUC=0.79), which can be used for preoperative risk assessment. We developed a detection kit with a self-designed primer set and a standardized detection process, adapted to clinical operation, to provide a convenient tool for PTCLNM risk assessment.

[0012] The high specificity and efficiency achieved by the primer set of this invention are directly reflected in the significant clinical predictive ability of miR-185-5p expression level in the specific detection of target diseases. In specific experiments, the area under the ROC curve (AUC) of the results detected using the primer set of this invention reached 0.79, indicating that the miR-185-5p quantification results obtained by the primer set of this invention have significant statistical significance and clinical risk assessment value in distinguishing samples with different metastasis risks compared to the detection results of existing technologies or non-optimized primer sets. Attached Figure Description

[0013] Figure 1 This is a heatmap of 7 differentially expressed exosomal miRNAs in high-iodine papillary thyroid carcinoma lymph node metastasis (PTC LNM) provided in an embodiment of the present invention; Figure 2 This is a heatmap of eight differentially expressed exosomal miRNAs in normal iodine-containing papillary thyroid carcinoma lymph node metastases (PTC LNM) provided in an embodiment of the present invention; Figure 3 This refers to the relative expression level of miR-185-5p in subjects with high-iodine papillary thyroid carcinoma lymph node metastasis (PTC LNM) provided in this embodiment of the invention. Figure 4 This is an evaluation chart of the predictive value of miR-185-5p for lymph node metastasis (PTC LNM) in papillary thyroid carcinoma, provided in an embodiment of the present invention. Detailed Implementation

[0014] To fully illustrate the preparation concept of this invention, the process of this solution is described below with reference to specific embodiments. These embodiments are for illustrative purposes only and should not be interpreted or construed as limiting the protection of this invention.

[0015] Example 1: Study on the effect of serum iodine levels on lymph node metastasis of papillary thyroid carcinoma by regulating miR-185-5p 1. Objects and methods 1.1 Specimen Source After obtaining informed consent from the subjects, fasting venous serum was collected from subjects with pathologically confirmed papillary thyroid carcinoma metastasis and non-metastasis at the Second Affiliated Hospital of Shandong First Medical University and Taian Central Hospital from October 2021 to September 2023. This included 46 subjects with high-iodine papillary thyroid carcinoma metastasis and 46 subjects with high-iodine papillary thyroid carcinoma without metastasis; and 107 subjects with normal-iodine papillary thyroid carcinoma with lymph node metastasis and 107 subjects with normal-iodine papillary thyroid carcinoma without lymph node metastasis. None of the subjects had received any treatment prior to sample collection.

[0016] The criteria for diagnosing papillary thyroid carcinoma (PTC) strictly adhere to the guidelines for the diagnosis and treatment of thyroid cancer: A thyroid nodule exhibiting 1-4 malignant features on ultrasound (microcalcifications, aspect ratio >1, solid hypoechoic nodule, abnormal ultrasound findings in cervical lymph nodes, indistinct / irregular / lobulated borders, extrathyroidal invasion) is likely malignant; the presence of 4 or more malignant features confirms malignancy. Fine-needle aspiration (FNA) cytopathological examination reveals papillary or monolayered cell arrangement, with swirling sheets, longitudinal nuclear grooves, intranuclear pseudoinclusion structures, enlarged, crowded, and even overlapping nuclei, sometimes showing psammoma bodies. Meeting these criteria confirms PTC.

[0017] All subjects with lymph node metastasis in papillary thyroid carcinoma were confirmed to have central lymph node metastasis (LNM) by intraoperative frozen section pathology. Criteria for determining LNM in PTC: Postoperative frozen section pathology of lymph nodes should be performed separately. If cancer cells are observed in the lymph node tissue, and psammoma bodies are observed under a microscope, serial sections should be prepared to determine whether LNM has occurred.

[0018] Subjects diagnosed with PTC and accompanied by central LNM according to the diagnostic criteria were defined as the case group (PTC LNM+), and subjects with PTC who did not have LNM were defined as the control group (PTC LNM-).

[0019] 1.2 Main Instruments and Equipment Micropipette: Eppendorf (Shanghai) International Trading Co., Ltd.; -80℃ Ultra-low Temperature Freezer: Panasonic Health Medical Devices Co., Ltd.; -20℃ Freezer: Haier Group; 4℃ Freezer: Haier Group; Micro Electronic Weighing Balance: Sartorius Group, Germany; Reverse Osmosis High-Efficiency Pure Water System: Likang Biomedical Technology Holding Co., Ltd.; Vortex Oscillator: Selrod GmbH, USA; Miniature Centrifuge: Dalong Xingchuang Experimental Instruments (Beijing) Co., Ltd.; Electric Thermostatic Water Bath: Prima Instruments (Shanghai) Co., Ltd.; Automatic Electric Heating Digester Urine Iodine Digestion System: Qiqihar Precision Instrument Factory; Ultraviolet Spectrophotometer: Beijing Purkinje General Instrument Co., Ltd.; Snowflake Ice Maker: Ningbo Xinzhi Biotechnology Co., Ltd.; Biosafety Cabinet: Thermo Fisher Scientific; Sorvall™ Legend™ Micro 21R Microcentrifuge: Thermo Fisher Scientific; NanoDrop 2000 Micro Spectrophotometer: Thermo Fisher Scientific; Qubit 4 Fluorometer: Thermo Fisher Scientific; 2100 Bioanalyzer: Agilent Technologies, USA; Illumina Novaseq high-throughput sequencing platform: Illumina, USA; PCR instrument: Jena Analytical Instruments GmbH, Germany; Roche LightCycler 96 real-time quantitative PCR instrument: Roche, Switzerland.

[0020] 1.3 Main Experimental Reagents Cerium ammonium sulfate tetrahydrate: Shanghai Maclean Biotech Co., Ltd.; Sodium chlorate: Sigma-Aldrich; Potassium iodate: Aladdin (Shanghai) Biotech Co., Ltd.; Perchloric acid: Cangzhou Xinyuanquan Chemical Co., Ltd.; Arsenic trioxide: Zhong Sheng Biochemical (Wuhan) Technology Co., Ltd.; Sodium thiosulfate: Aladdin (Shanghai) Biotech Co., Ltd.; Total Exosome Isolation (from serum): Thermo Fisher Scientific; 1×PBS phosphate buffer: Beijing Solarbio Science & Technology Co., Ltd.; Uranium acetate solution: Shanghai Maclean Biotech Co., Ltd.; Trizol Reagent: Thermo Fisher Scientific; Ultrapure RNA extraction kit: Kangwei Century Biotechnology Co., Ltd.; Anhydrous ethanol: Tianjin Kaitong Chemical Co., Ltd.; NEBNext® Small RNA Single Sample Library Preparation Kit: New England Biotechnology Co., Ltd.; Agilent™ RNA Pico 6000 Kit: Agilent Technologies, Inc.; Qubit dsDNA Quantification Kit: Thermo Fisher Scientific; Novex™ TBE Run buffer (5X): Thermo Fisher Scientific; PrimeScript™ RT reagent Kit (Perfect Real Time): Bio-Rad Biotechnology (Beijing) Co., Ltd.; miRNA 1st Strand cDNA Synthesis Kit (by tailing A): Nanjing Novizan Biotechnology Co., Ltd.; ChamQ Universal SYBR qPCR Master Mix: Nanjing Novizan Biotechnology Co., Ltd.; Enzyme-free sterile water: Beijing Solarbio Technology Co., Ltd.

[0021] 1.4 Sample Collection Five mL of venous blood was collected from the subjects after fasting for 8–12 hours and placed in a vacuum tube. After being placed at room temperature for 30 minutes, the serum was separated by centrifugation at 3000 r / min. The separated serum was transferred to a 1.5 mL EP tube and stored in an ultra-low temperature freezer at -80°C.

[0022] 1.5 Serum iodine determination and grouping criteria Serum iodine content was measured using the arsenic-cerium catalytic spectrophotometric method (standard number: WS / T 572-2017). The principle of the method is as follows: in an acidic environment, Ce... 4+ (Yellow) can be reduced to produce Ce. 3+(Colorless) Iodine can catalyze the redox reaction of arsenic and cerium. The higher the iodine content in the serum sample digested with perchloric acid and sodium chlorate at high temperature, the faster the catalyzed redox reaction and the shorter the time for the solution to change from yellow to colorless. Therefore, controlling the reaction temperature and time and measuring the unreduced Ce in the system using a UV spectrophotometer is crucial. 4+ The absorbance can be used to calculate the iodine content in serum based on the standard curve obtained from the standard iodine solution.

[0023] The specific steps for determining serum iodine levels using the arsenic-cerium catalytic spectrophotometric method are as follows: (1) Prepare a cerium ammonium sulfate solution (c=0.025mol / L) Weigh 16.7 g of cerium ammonium sulfate tetrahydrate using a micro-balance and dissolve it in 700 mL of diluted sulfuric acid solution (c = 2.5 mol / L). Stir with a glass rod until dissolved, then add pure water to bring the volume to 1000 mL. Place the prepared cerium ammonium sulfate solution in a brown bottle and store it at 4°C.

[0024] (2) Prepare sodium chlorate solution (c=2.0mol / L) Weigh 106.4g of sodium chlorate using a micro-electronic balance and dissolve it in 400mL of pure water. After dissolving, bring the volume to 500mL and transfer the solution to a brown bottle. Store the solution in a refrigerator at 4℃.

[0025] (3) Prepare iodine standard solution Weigh 0.1686 g of potassium iodate using a micro-balance and place it in a volumetric flask. Add 200 mL of pure water to dissolve it, and then add pure water to bring the volume to 1000 mL. Measure 10 mL of the prepared potassium iodate solution into a volumetric flask and bring the volume to 100 mL with pure water. The concentration of the diluted potassium iodate solution is 10 μg / mL. Transfer the solution to a brown bottle and store it at 4°C.

[0026] Take 0 mL, 0.5 mL, 1 mL, 1.5 mL, 2 mL, 2.5 mL, and 3 mL of the diluted potassium iodate solution and place them into volumetric flasks, then add pure water to bring the volume to 100 mL. The iodine concentrations of the solutions at this point are 0 μg / L, 50 μg / L, 100 μg / L, 150 μg / L, 200 μg / L, 250 μg / L, and 300 μg / L, respectively. Store the solutions in brown bottles, label them, and preserve them.

[0027] (4) Take 100 μL of each of the prepared potassium iodate solutions of different concentrations and place them in glass test tubes in descending order of concentration. Thaw the serum samples to be tested on ice, shake to mix, and then take 100 μL of each sample in a glass test tube and record the sample order.

[0028] (5) Add 500 μL of perchloric acid to each glass tube, mix well on a vortex mixer, and then add 600 μL of sodium chlorate solution and mix well by shaking.

[0029] (6) Transfer the test tube to a digester preheated to 130°C and digest for 2 hours. After digestion, remove the tube and cool it to room temperature.

[0030] (7) Preheat the water bath to 37°C. Add 3 mL of arsenic acid solution to each tube in sequence, shake well to mix thoroughly, and then transfer to a 37°C water bath for 15 min.

[0031] (8) Use a stopwatch to time the process, and add 600 μL of cerium ammonium sulfate solution to each glass test tube in sequence at 20-second intervals. Then, mix thoroughly on a vortex mixer immediately.

[0032] (9) Set the wavelength of the ultraviolet spectrophotometer to 400 nm, use pure water as a reference, pour the liquid in the test tube into a 1 cm cuvette and measure the absorbance value. When the absorbance of the potassium iodate solution with an iodine concentration of 300 μg / L reaches about 0.1, measure the absorbance values ​​of potassium iodate solutions of various concentrations and serum samples at 20-second intervals according to the order of adding cerium ammonium sulfate.

[0033] (10) If the x-axis of the standard curve is set to iodine concentration and the logarithm of the measured absorbance values ​​is set to the y-axis, and the correlation coefficient R² of the standard curve is ≥0.999, then the standard curve has high reliability. Calculate the regression equation: ρ: The mass concentration (μg / L) of iodine in potassium iodate solution or serum sample; a: Intercept of the standard curve regression equation; b: Slope of the standard curve regression equation; A: Absorbance value of potassium iodate solution or serum sample.

[0034] (11) Glass test tubes should be washed with sodium thiosulfate and deionized water in sequence to remove residual iodine ions so as not to affect the serum iodine measurement results of subsequent samples.

[0035] According to the World Health Organization's reference range for serum iodine concentration, a serum iodine concentration of 45-90 μg / L is defined as a normal iodine level, and a serum iodine concentration >90 μg / L is defined as a high iodine level.

[0036] 1.6 Extraction of serum exosomes (1) Take the serum sample out of the -80℃ ultra-low temperature freezer, place it in a 25℃ water bath to dissolve, and vortex to mix. The serum sample should be placed on ice. (2) Centrifuge the serum sample at 2000g for 30 minutes to remove residual cells and debris from the serum sample; (3) Use a pipette to transfer 1 mL of serum sample supernatant into an enzyme-free 1.5 mL EP tube and place it on ice for later use; (4) Add 200 μL of exosome separation reagent to each tube of serum sample, shake thoroughly until well mixed, and the well mixed liquid should be yellow and turbid; (5) Let the mixed liquid stand in a refrigerator at 4°C for 30 minutes, and keep the EP tube upright; (6) After incubation, centrifuge at 10000g for 10 minutes at room temperature. The upper layer is a clear yellow liquid, and the bottom of the EP tube is a yellow or off-white precipitate, in which the exosomes are encapsulated. (7) Use 1mL, 200μL and 10μL pipettes in sequence to aspirate and discard the supernatant as much as possible. Be careful to keep the pipette tip above the liquid surface and close to the tube wall to aspirate the liquid. Do not touch the precipitate at the bottom. (8) Add 100 μL of 1×PBS buffer to each tube, mix well by pipetting, and completely resuspend the precipitate; (9) The isolated exosomes can be stored for one week in a 4°C refrigerator and for a long time in an ultra-low temperature refrigerator at -80°C.

[0037] 1.7 Extraction and quality control of total exosome RNA Serum exosome RNA was extracted following the steps outlined in the ultrapure RNA extraction kit: (1) Take the exosome sample out of the -80℃ ultra-low temperature freezer and place it on ice to thaw. After thawing, shake to mix and centrifuge. (2) Add 1 mL of Trizol Reagent to lyse the exosome sample. Note that after adding Trizol, flocculent precipitate will appear in the EP tube. Vortex thoroughly until the precipitate dissolves. Let stand at room temperature for 5 min to completely separate the protein-nucleic acid complex in the exosome. (3) Add 200 μL of chloroform, shake for 15 s, the mixed liquid is turbid, place at room temperature for 2 min, and then centrifuge at 12000 rpm for 10 min at 4℃. After centrifugation, the sample contains three layers: RNA in the upper aqueous phase, protein and DNA in the middle white thin layer, and organic phase in the lower layer. (4) Transfer 450 μL of the upper aqueous phase to a 1.5 mL enzyme-free EP tube. Do not touch the middle white thin layer when transferring. If you do, centrifuge again. (5) Add the same volume (450 μL) of 70% ethanol to the transferred upper aqueous phase and mix thoroughly by inverting the container. (6) Load the adsorption column into an enzyme-free tube, add 450 μL of the mixed solution into it, centrifuge at 12000 rpm for 20 s, discard the liquid in the enzyme-free tube, add the remaining 450 μL of solution, and repeat the above steps. (7) Take 700 μL of Buffer RW1 from the kit and place it in the adsorption column. Centrifuge at 12000 rpm for 20 s and discard the centrifuged liquid. (8) Before using Buffer RW2 for the first time, add 160 mL of anhydrous ethanol, mix well, and then add 500 μL to the adsorption column. Centrifuge at 12000 rpm for 20 s, discard the waste liquid from centrifugation, and reload the adsorption column into an enzyme-free tube. (9) Add 500 μL Buffer RW2 again, centrifuge at 12000 rpm for 20 s, discard the solution, and reload the adsorption column into the enzyme-free tube; (10) Centrifuge at 12000 rpm for 2 min, discard the waste liquid, place the adsorption column in a new enzyme-free tube, and let it stand at room temperature for 5-8 min to dry the residual liquid in the column; (11) Add 30 μL of enzyme-free water to the white filter membrane in the middle of the adsorption column. Note that you should use a different pipette tip for each sample to avoid RNA contamination. After standing at room temperature for 1 min, centrifuge at 12000 rpm for 1 min. (12) In order to increase the concentration of RNA, the RNA obtained by centrifugation was added back into the column, and after standing at room temperature for 1 min, it was centrifuged at 12000 rpm for 1 min. The RNA was placed on ice to avoid degradation. After measuring the concentration, the sample was labeled and stored in an ultra-low temperature freezer at -80℃ for a long time.

[0038] RNA was quality controlled using a NanoDrop 2000 micro spectrophotometer, measuring its concentration and purity. The steps are as follows: (1) Use NanoDrop software to measure. After opening the software, click the "Nucleic Acid" option; (2) Select the "RNA" option for the detection type, and the concentration unit is ng / μL; (3) Take 2 μL of enzyme-free water to clean the upper and lower bases of the instrument, and wipe the enzyme-free water dry with lens paper; (4) Add 1 μL of enzyme-free water to the base, and select the “blank” and “measure” options in sequence to measure the concentration of enzyme-free water RNA. Enzyme-free water with a concentration of 0 or ±0.1 ng / μL can be used as a blank control. (5) Add 1 μL of extracted sample RNA to the base, select the “measure” option to measure the exosome RNA concentration, and record the values ​​of OD260 / 280 and OD260 / 230. (6) Only samples with RNA that meet the requirements of 1.8≤OD260 / 280≤2.2 and OD260 / 230≥2.0 can be used for subsequent qRT-PCR (real-time quantitative PCR) experiments.

[0039] 1.7.2 High-throughput screening of differentially expressed miRNAs To screen for differentially expressed miRNAs specifically associated with papillary thyroid carcinoma lymph node metastases (PTC LNM) under high-iodine conditions and to provide a targeting basis for subsequent primer design, this invention conducted a high-throughput screening experiment, the specific procedure of which is as follows: 1. The serum exosomal miRNA library was sequenced using the Illumina NovaSeq high-throughput sequencing platform, and the differentially expressed miRNAs between the experimental group and the control group were analyzed using Deseq2 software.

[0040] 2. Sequencing data analysis (1) Phred quality score (Q) is an indicator for evaluating the accuracy of each base identification in high-throughput sequencing. Q20 means a base identification accuracy of 99%; while Q30 means an accuracy of 99.9%. During the quality control of the raw sequencing data, we used FASTP software to screen sequences. The screening criteria included: removing sequences containing adapter sequences; removing sequences without adapters at the 3' end or with missing insert fragments; excluding sequences with a Q20 base percentage below 60%; and filtering out sequences whose length was not in the 18-36 bp range. The screened sequences were of acceptable quality and suitable for subsequent analysis. (2) The selected sequences were further analyzed using blastn software. Only those sequences that matched the mature miRNA sequences in the miRBase and Rfam databases were retained, while sequences that matched the ncRNA library were excluded, so that they could be used for subsequent research. (3) Using the miRDeep2 program, RNA sequence data is matched with the miRBase database to quantify the expression of known miRNAs in each sample; (4) Differential analysis of miRNA expression data was performed using Deseq2. The criteria for judgment were |log2FC|>1 and P<0.05, where log2FC>1 indicated upregulated expression and log2FC<-1 indicated downregulated expression. miRNAs that did not meet these criteria were considered non-differentially expressed.

[0041] 1.8 Validation of differentially expressed miRNAs by qRT-PCR 1.8.1 Primer Design 1.8.1.1 Design basis, method and source logic of miR-185-5p upstream primer I. Sequence Source The mature sequence of miR-185-5p was obtained from the public database miRDB (www.mirdb.org). The original sequence was 5'-UGGAGAGAAAGGCAGUUCCUGA-3'. When constructing the nucleotide sequence listing, the "U" in the sequence was replaced with "T", and the corresponding sequence was 5'-TGGAGAGAAAGGCAGTTCCTGA-3'. Its nucleotide sequence is shown in SEQ ID NO.5.

[0042] II. Design Methods and General Principles The design follows conventional primer design principles in this field: (1) Length: Usually 18-25 bases (bp) or 15-30 bp to ensure specificity and annealing efficiency.

[0043] (2) GC content: Controlled between 40% and 60% to keep the annealing temperature (Tm value) stable at 50-60℃.

[0044] (3) Avoid secondary structures: During the design process, use software (such as Primer Premier, Oligo, etc.) to evaluate and avoid the formation of hairpin structures by the primers themselves or dimers between the primers.

[0045] (4) 3' end requirements: Ensure that the 3' end bases (especially the last 1-2) are stably bound to the template. Usually, G or C is preferred.

[0046] (5) Specificity: The primer sequence is compared with other regions of the genome by tools such as NCBI BLAST to ensure that there is no obvious homology between the primer sequence and other regions of the genome, thus avoiding non-specific amplification.

[0047] 1.8.1.2 Design basis, methods and source logic of U6 primers (upstream and downstream) The U6 primers were designed based on the publicly available gene sequence of human U6 small nuclear RNA (RNU6-1), with the following details: Gene name: U6 small nuclear RNA (RNU6-1), NCBI Gene ID: 26827, nucleotide sequence as shown in SEQ ID NO.6, specifically 5'-GGTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTTCATTTTTC-3'.

[0048] U6 snRNA is the most commonly used internal reference gene in microRNA (miRNA) expression research. The core goal of its primer design is to stably and specifically amplify a single, clear band under any experimental conditions to correct for loading amount and experimental errors, and its sequence is highly conserved within the species.

[0049] I. The design follows these principles: (1) Prioritize the conservation of the target region: Primers must be designed to target highly conserved regions in the U6 gene sequence to ensure stable binding and amplification in different individuals, tissues or cell samples, and avoid result deviation due to sequence polymorphism.

[0050] (2) General primer design guidelines: Length: typically 18-25 bases to ensure sufficient specificity and suitable annealing temperature.

[0051] GC content: Controlled between 40% and 60% to ensure moderate stability of double strands.

[0052] Annealing temperature (Tm value): The Tm values ​​of the upstream and downstream primers should be as close as possible, with a difference of no more than 2°C. They are usually designed to be between 55-65°C to match the standard PCR procedure.

[0053] 3' end stability: The last base at the 3' end is preferably G or C (which has three hydrogen bonds) to enhance the initiation efficiency of primer-template binding.

[0054] Avoid secondary structures: Use professional software (such as Primer Premier, Oligo 7) to ensure that the primers themselves do not form obvious hairpin structures, and that there is no dimer between the upstream and downstream primers, especially at the 3' end.

[0055] Specificity verification: The NCBI BLAST tool must be used to compare the designed primer sequence with the genome database of the corresponding species (such as human or mouse) to ensure that it only matches the target region of the U6 gene and does not show significant homology with other non-target gene sequences, thereby avoiding non-specific amplification.

[0056] 1.8.1.3 Design rationale, methods, and source logic of miRNA reverse universal downstream primers I. Design Principles: System Lock-in Principle In the Poly(A) tailing qPCR detection system, the sequence of the universal downstream primer is uniquely determined by the "tailing-reverse transcription" primer sequence in the reverse transcription kit used.

[0057] The universal downstream primers used for subsequent qPCR amplification must have sequences that are precisely complementary to the aforementioned tag sequences in order to specifically bind to the cDNA of all miRNAs. The primers are a dedicated component of the MR201 kit, and their high annealing temperature of 66°C has been optimized by the manufacturer to achieve highly specific amplification.

[0058] II. Summarize its design / selection logic: (1) Method determination: The Poly(A) tailing method qPCR standard method was determined to be used.

[0059] (2) System selection: The commercially available Novozymes kit (reagent model MR201) that has been validated in the market and has stable performance was selected as the complete solution.

[0060] (3) Component locking: The system architecture of this kit is logically locked and provides a matching universal downstream primer sequence to ensure amplification specificity.

[0061] The downstream primer for the miRNA was the Universal Reverse Q primer from the miRNA tailing reverse transcription kit, with an annealing temperature of approximately 66°C. The upstream primer and U6 primer for the miRNA were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Table 1: miRNA primer sequences The miRNA reverse universal downstream primer used in this invention is a product of Novizan Biotechnology Co., Ltd. (product model: MR201; primer name: Universal reverse Q primer (10μM)). This primer belongs to the reverse universal primers in the miRNA tailing reverse transcription kit, and the annealing temperature is about 66℃.

[0062] 1.8.2 Reverse transcription to synthesize cDNA Reverse transcription experiments should be performed in a biosafety cabinet, using enzyme-free centrifuge tubes, pipette tips, and other experimental consumables throughout the process. Reaction solutions should be prepared on ice to prevent RNA degradation. After removing the kit from the refrigerator at -20°C, it should be slowly thawed on ice, then vortexed to mix and centrifuged.

[0063] miRNA reverse transcription was performed using Novizan's miRNA tailing reverse transcription kit to synthesize first-strand cDNA. The specific steps are as follows: (1) Dilute the extracted sample RNA to the same concentration; (2) Prepare a reverse transcription system in an enzyme-free 0.2 mL centrifuge tube: Table 2: miRNA first-strand cDNA reverse transcription reaction system (3) Gently blow the prepared mixture to mix it, then centrifuge. There should be no air bubbles in the enzyme-free tube. (4) Perform reverse transcription under the following conditions: Table 3: miRNA first-strand cDNA reverse transcription reaction procedure:

[0064] (5) After the reverse transcription reaction is completed, the obtained cDNA can be temporarily stored at -20℃ or stored in an ultra-low temperature freezer at -80℃ for a long time.

[0065] The internal control U6 was reverse transcribed using a reverse transcription kit from Takara to synthesize first-strand cDNA. The specific steps are as follows: (1) Dilute the extracted sample RNA to the same concentration; (2) Prepare a reverse transcription system in an enzyme-free 0.2 mL centrifuge tube: Table 4: First-strand cDNA reverse transcription reaction system (3) Gently blow the prepared mixture to mix it and centrifuge it. There should be no air bubbles in the enzyme-free tube. If there are air bubbles, you can gently tap the tube wall to eliminate them. (4) Perform reverse transcription under the following conditions: Table 5: First-strand cDNA Reverse Transcription Procedure (5) The obtained cDNA can be temporarily stored in a -20℃ freezer and can be stored for a long time in an ultra-low temperature freezer at -80℃.

[0066] 1.8.3 qRT-PCR reaction Using the first-strand cDNA obtained from reverse transcription as a template, real-time quantitative PCR (qRT-PCR) was performed using Novizan's SYBR Green I chimeric fluorescence assay premix. A white precipitate will form after the SYBR qPCR Master Mix dissolves on ice; invert the container to mix until the precipitate dissolves, then centrifuge before use. The reaction solution should be prepared on an ice box in a dark environment.

[0067] (1) Prepare the reaction system in an enzyme-free tube: Table 6: qRT-PCR reaction system (2) Shake the prepared mixture to mix well, centrifuge, and transfer it to a light-proof eight-tube qRT-PCR tube. To avoid the influence of error, set up 3 replicates for each miRNA sample for verification. (3) Perform qRT-PCR reaction under the following conditions: Table 7: qRT-PCR reaction procedure 1.9 qRT-PCR Data Processing PCR amplification results are expressed using CT values, which represent the number of cycles required for the fluorescence signal in the PCR reaction solution to reach a set threshold. The relative expression rate (RQ) of the target gene in the sample is calculated using the ΔΔCT method (CT represents the number of cycles required for the real-time fluorescence intensity to be significantly greater than the background value; ΔCT sample = CT sample – CT U6sample, ΔCT control = CT control – CT U6control, ΔΔCT = ΔCT sample – ΔCT control).

[0068] 2.0 Statistical Analysis Baseline information and clinical data of the subjects were compiled and entered using Excel software. SPSS 25.0 software was used for statistical analysis of the data from the case group and the control group. R 4.3.2 software was used to plot the analysis results, and Graphpad Prism 9 software was used to plot bar charts of relative miRNA expression levels and receiver operating characteristic curves (ROC). Normality of continuous data was tested using the Shapiro-Wilk test. Normally distributed quantitative data were described as mean ± standard deviation (X ± SD), and independent samples t-tests were used for comparisons between groups. Skewed quantitative data were described as median and interquartile range [M(IQR)], and Wilcoxon rank-sum tests were used for comparisons between groups. All statistical tests were two-tailed, and P < 0.05 was considered statistically significant.

[0069] 3.0 Results 3.1 Correlation between serum iodine levels and PTC LNM Univariate logistic regression analysis of each influencing factor revealed that high iodine was a risk factor for PTC LNM (OR=2.148, 95%CI: 1.574-2.931). Concurrently, sex (OR=2.288, 95%CI: 1.658-3.159), unilateral or bilateral tumor (OR=1.983, 95%CI: 1.433-2.743), tumor diameter (OR=4.177, 95%CI: 3.120-5.592), multifocality (OR=1.497, 95%CI: 1.111-2.017), capsule invasion (OR=2.261, 95%CI: 1.615-3.165), abnormal Tg (OR=1.387, 95%CI: 1.022-1.882), and hyperuricemia (OR=1.968, 95%CI: 1.043-3.710) were also associated with PTC. Risk factors for LNM were identified, while age ≥55 years (OR=0.658, 95%CI: 0.495-0.876) and diabetes (OR=0.568, 95%CI: 0.330-0.976) were protective factors against PTC LNM (P<0.05).

[0070] Factors showing statistically significant differences in univariate regression analysis were incorporated into multivariate logistic regression analysis to analyze the relationship between high iodine levels and PTC LNM. All factors were found to be a risk factor for PTC LNM (P<0.05). After adjusting for other influencing factors, high iodine levels were positively correlated with PTC LNM (OR=2.813, 95%CI: 1.696-4.664), suggesting that high iodine levels may be an independent risk factor for PTC LNM.

[0071] 3.2 Differential expression of serum exosomal miRNAs under high iodine and normal iodine conditions Pairwise analysis was performed on the sequencing results of the PTC LNM+ and PTC LNM- groups under different iodine levels, with the condition that |log2FoldChange|>1 and P<0.05, to obtain differentially expressed miRNAs. Among them, the high-iodine PTC LNM+ group and the normal-iodine PTC LNM+ group showed differential expression of 8 miRNAs (e.g., ...). Figure 1 , Figure 2 Under normal iodine conditions, miR-185-5p did not show differential expression, while under high iodine conditions, it did. This indicates that a high iodine environment is a necessary condition for the differential expression of miR-185-5p.

[0072] 3.3 Real-time RT-PCR detection of target miRNAs in serum This study quantitatively analyzed the expression of target miRNAs in the serum of 46 pairs of subjects with and without lymph node metastasis of high-iodine papillary thyroid carcinoma. U6 was used as an internal standard. The results showed that the miRNAs were stably expressed in serum, and U6 was a stable and reliable internal control.

[0073] Under high iodine conditions, the expression level of miR-185-5p in the serum of PTC LNM+ subjects was significantly higher than that in PTC LNM- subjects (see...). Figure 3 ).

[0074] This invention detected the expression level of miR-185-5p in the serum of PTC LNM subjects under different iodine levels. It was found that the expression level of miR-185-5p was significantly increased under high iodine levels, and the difference was statistically significant (P<0.05). This indicates that the upregulation of miR-185-5p under high serum iodine levels is indicative of lymph node metastasis in papillary thyroid carcinoma and can be used as a biomarker for assessing the risk of papillary thyroid lymph node metastasis.

[0075] 3.4 Evaluation of the predictive value of differentially expressed miRNAs for PTC LNM The area under the curve (AUC) for differential expression of miR-185-5p under high-iodine PTC LNM conditions was >0.70 (P<0.05), indicating good predictive value. Figure 4 ).

[0076] 4. Reagent kit for assessing the risk of lymph node metastasis in human papillary thyroid carcinoma The above experiments and results demonstrate that hsa-miR-185-5p exhibits very high sensitivity and specificity for lymph node metastasis in papillary thyroid carcinoma. Therefore, a kit for detecting lymph node metastasis in human papillary thyroid carcinoma can be developed based on hsa-miR-185-5p. This kit includes hsa-miR-185-5p primers and probes. Specifically, the primers include reverse transcription primers and pre-primers for quantitative PCR. The kit also includes reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, Taq enzyme, and standards and / or controls.

Claims

1. A hsa-miR-185-5p primer set for PTC transfer risk detection in a high iodine environment, characterized by, Comprising: hsa-miR-185-5p upstream primer, the nucleotide sequence of which is shown as SEQ ID NO. 1; U6 upstream primer, the nucleotide sequence of which is shown as SEQ ID NO. 2; U6 downstream primer, the nucleotide sequence of which is shown as SEQ ID NO. 3; and miRNA reverse universal downstream primer, the nucleotide sequence of which is shown as SEQ ID NO.

4.

2. The primer set according to claim 1, characterized in that, The annealing temperature of the miRNA reverse universal downstream primer is 66℃.

3. A hsa-miR-185-5p detection kit for detecting PTC transfer risk in a high-iodine environment, characterized in that, The primer set of claim 1 is contained.

4. The kit of claim 3, wherein Also comprising: reverse transcriptase, Taq enzyme, buffer, dNTPs, MgCl2 and DEPC water.

Citation Information

Patent Citations

  • Construction method for infected animal model and application

    CN110447595A

  • MiRNA biomarker and detection kit for diagnosing cervical lateral lymph node metastasis of papillary thyroid carcinoma

    CN113025714A

  • Papillary thyroid carcinoma marker and application method

    CN118006780A

  • Exosome miRNA biomarker and kit for diagnosing gastric cancer

    CN118186093A

  • Renal Cell Carcinoma Biomarkers

    US20120251451A1