Primer probe group and kit for joint detection of mycoplasma genitalium, ureaplasma urealyticum and chlamydia trachomatis

Abstract

The invention discloses a primer probe group and a kit for joint detection of mycoplasma genitalium, ureaplasma urealyticum and chlamydia trachomatis, and belongs to the technical field of molecular biological detection. The primer probe group comprises a primer probe group A for directly detecting a mycoplasma genitalium mgpB gene, a primer probe group B for directly detecting a ureaplasma urealyticum ureB gene and a primer probe group C for directly detecting a chlamydia trachomatis ompA gene; the kit comprises a PCR (Polymerase Chain Reaction) reaction solution and the primer probe group. Nucleic acid extraction is not needed, the detection cost is greatly reduced, the experiment time is shortened, meanwhile, the specificity and accuracy are still guaranteed, meanwhile, the sensitivity is improved, and the method has wide application prospects in the fields of non-gonococcal genital tract infection main pathogen detection, infertility and prenatal and postnatal care screening and the like. And the kit has important significance on clinical diagnosis, early treatment and prevention of diseases, prevalence and the like.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology detection, and particularly relates to a primer probe set and kit for combined detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis. BACKGROUND

[0002] Common sexually transmitted disease pathogens include viruses, bacteria, mycoplasma, chlamydia and the like. Non-gonococcal urethritis in the urogenital tract is mainly caused by Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis.

[0003] Mycoplasma genitalium (MG) was first isolated from urethral specimens of patients with nongonococcal urethritis in 1980, and belongs to the Mycoplasmatales class. It is a sexually transmitted pathogen. It adheres to and invades epithelial cells through adhesion proteins on the cell membrane, induces inflammatory reactions and damages host cells through the production of nucleases and membrane lipoproteins, and can cause urethritis, cervicitis, proctitis, secondary pelvic inflammatory disease, prostatitis, epididymitis, and even male infertility, and is closely related to premature birth. Asymptomatic infection is also common. In addition, MG can promote the infection and transmission of HIV.

[0004] Ureaplasma urealyticum belongs to the Ureaplasma genus of the Mycoplasmatales order of the Mycoplasmataceae family, and is a common mycoplasma of urogenital tract infection. It plays a persistent etiological role in vaginitis, urethritis in women of childbearing age, and non-gonococcal urethritis in men. It can cause infertility, spontaneous abortion, congenital pneumonia, chronic lung disease, and neonatal meningitis in infants. Currently, Ureaplasma urealyticum is known to include two biological groups and 14 serotypes: serotypes 1, 3, 6 and 14 belong to the first biological group, i.e. Ureaplasma parvum Up, and serotypes 2, 4, 5 and 7-13 belong to Ureaplasma urealyticum Uu.

[0005] The number of cases of Chlamydia trachomatis (Ct) infection in the genital tract has exceeded that of gonococcal infection, accounting for the first of sexually transmitted diseases. In addition to urogenital tract inflammation, Ct can also cause a series of other clinical diseases, such as prostatitis, epididymitis, vaginitis, cervicitis, endometritis, pelvic inflammatory disease, etc., and even lead to ectopic pregnancy or tubal infertility in women, in addition, Ct infection is also a synergistic factor for human papillomavirus-induced cervical cancer, and an important risk factor for HIV infection. Ct has high incidence, wide prevalence and serious harm, which has attracted global public health attention. In order to reduce the disease burden of genital tract infection, the present application designs non-specific primers and probes for Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis respectively, realizes multiplex detection of non-gonococcal genital tract pathogen infection, infertility and eugenics screening, provides better clinical auxiliary diagnosis for early detection and early treatment, and has important significance for early treatment, prevention and prevalence of diseases.

[0006] In the prior art, the patent for invention with publication number CN102888464A discloses a multiplex real-time PCR method capable of simultaneously detecting five pathogenic agents, including Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma urealyticum, Mycoplasma hominis and Mycoplasma genitalium, and discloses primers and probes used therein, which have no cross contamination and interference, ensuring the accuracy, reliability, specificity, sensitivity and repeatability of detection of the five pathogenic agents. In addition, the patent for invention with publication number CN115896306A also discloses a detection kit capable of simultaneously detecting Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum, which adopts a multiplex real-time fluorescent PCR method, and can realize simultaneous detection of multiple pathogens by using multiple fluorescent labels in the same reaction system, and has strong specificity and high sensitivity, and can meet the demand for a detection method with strong specificity, high sensitivity, simple and fast operation for simultaneously detecting Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum. It can be seen that the prior art does not disclose detection primers, probes and kits specially used for the three pathogenic agents, i.e., Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis. SUMMARY

[0007] The purpose of the present application is to provide a primer probe set for combined detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, which is specially designed for specific conserved regions of different genes of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, and can efficiently and specifically directly detect Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis.

[0008] Another object of the present application is to provide a kit for combined detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, which can realize PCR detection without nucleic acid extraction of the sample, reduce the detection cost, simplify the test operation, shorten the detection time, ensure high specificity, accuracy, and improve the sensitivity. Further, the present application can also be used for gene detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis in female cervical swabs / vaginal swabs and male urethral swabs.

[0009] The present application realizes the above objects by the following technical scheme: a primer probe set for combined detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, comprising a primer probe set A for directly detecting the mgpB gene of Mycoplasma genitalium, a primer probe set B for directly detecting the ureB gene of Ureaplasma urealyticum, and a primer probe set C for directly detecting the ompA gene of Chlamydia trachomatis, The primer probe set A comprises: a primer MG-F selected from the 131th to 151th base region of the mgpB gene sequence, the sequence of which is shown in SEQ ID NO: 1; a primer MG-R selected from the 175th to 199th base region of the mgpB gene sequence, the sequence of which is shown in SEQ ID NO: 2; and a probe MG-P selected from the 155th to 172th base region of the mgpB gene sequence, the sequence of which is shown in SEQ ID NO: 3, Specifically: SEQ ID NO: 1: AGAARTACCTTGATGRTCAGC, SEQ ID NO: 2: CATATAAAGCTCTACCGTTGTTATC, SEQ ID NO: 3: ACTTTGCAATCAGAAGGT, The primer probe set B comprises: a primer Uu-F selected from the 50th to 70th base region of the ureB gene sequence, the sequence of which is shown in SEQ ID NO: 4; two complementary primers Uu-R.1 and Uu-R.2 designed for the 149th to 169th base region of the ureB gene sequence, the sequence of which is shown in SEQ ID NO: 5 and SEQ ID NO: 6; and a probe Uu-P selected from the 104th to 131th base region of the ureB gene sequence, the sequence of which is shown in SEQ ID NO: 7, Specifically: SEQ ID NO: 4: CGTGTTCCGRCTAAATCAATA, SEQ ID NO: 5: CGAAGACAAAGAACGTAAAGT, SEQ ID NO: 6: TGAAGATAAAGAACGCAAAGT, SEQ ID NO: 7: CGAATAGCAGTACCTGATGGAATATCGA; The primer probe set C comprises: a primer CT-F selected from the 135th to 153rd base region of the ompA gene sequence, the sequence of which is shown in SEQ ID NO: 8; a primer CT-R selected from the 199th to 218th base region of the ompA gene sequence, the sequence of which is shown in SEQ ID NO: 9; and a probe CT-P selected from the 155th to 175th base region of the ompA gene sequence, the sequence of which is shown in SEQ ID NO: 10, Specifically: SEQ ID NO: 8: AGATCCTTGCGATCCTTGC, SEQ ID NO: 9: ACACGGTCGAAAACAAAGTC, SEQ ID NO: 10: CCACTTGGTGTGACGCTATCAGCATG.

[0010] Preferably, the kit further comprises an internal standard primer probe set RP for monitoring the entire detection process.

[0011] Preferably, the internal standard primer probe set RP comprises: a primer RP-F: AGATTTGGACCTGCGAGC; a primer RP-R: GAGCGGCTGTCTCCACAAGT; a probe RP-P: TTCTGACCTGAAGGCTCTGCGCG.

[0012] Preferably, the direct detection method is to take a female cervical swab, a female vaginal swab or a male urethral swab as a detection sample, and directly performs PCR amplification detection without nucleic acid extraction.

[0013] The application further provides a kit for combined detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, which comprises a PCR reaction solution and the above-mentioned primer probe set.

[0014] Preferably, the PCR reaction solution comprises Taq DNA polymerase, UNG enzyme, dA / G / C / UTPs, magnesium ions, sodium chloride and Tris buffer.

[0015] Compared with the prior art, the application has the following advantages and beneficial effects: (1) The primer probe group A for directly detecting the mycoplasma genitalium mgpB gene in the application is selected in the gene conservative region (131-151 aa, 155-172 aa, 175-199 aa), and formation of hairpin structure, primer internal dimer, primer inter dimer and mismatch is avoided as much as possible, and non-specific binding with other viruses or human genes can be avoided.

[0016] (2) The primer probe group B for directly detecting the ureaplasma urealyticum ureB gene in the application is selected in the gene conservative region (50-70 aa, 104-131 aa, 149-169 aa) and can cover 14 serotypes, and formation of hairpin structure, primer internal dimer, primer inter dimer and mismatch is avoided as much as possible, and non-specific binding with other viruses or human genes can be avoided.

[0017] (3) The primer probe group C for detecting the chlamydia trachomatis ompA gene in the application is selected in the gene conservative region (135-153 aa, 155-175 aa, 199-218 aa) and can cover all types (D, Da, E, F, G, H, I, Ia, J, Ja, K, L1, L2, L2a, L3) of genital chlamydia trachomatis, and formation of hairpin structure, primer internal dimer, primer inter dimer and mismatch is avoided as much as possible, and non-specific binding with other viruses or human genes can be avoided.

[0018] (4) The primer probe group of the application can directly detect the target gene in the sample, therefore, based on the design of the primer probe group, the method can be used for directly performing PCR amplification detection on the female cervical swab / vaginal swab or male urethral swab without nucleic acid extraction.

[0019] (5) The primer probe group provided by the application not only improves the existing detection method, reduces the detection cost, shortens the test time and simplifies the operation steps, but also guarantees specificity and accuracy while improving sensitivity.

[0020] In summary, the application designs specific primers and probes for mycoplasma genitalium, ureaplasma urealyticum, chlamydia trachomatis and internal standard gene RP, and uses real-time fluorescent quantitative PCR technology for qualitative detection of mycoplasma genitalium, ureaplasma urealyticum and chlamydia trachomatis nucleic acid DNA in vitro. The sample of the detection kit described in the application does not need to be subjected to nucleic acid extraction, greatly reduces the detection cost, shortens the experimental time while still guarantees specificity and accuracy and improves sensitivity, has a wide application prospect in the fields of detection of main pathogens of non-gonococcal genital tract infection, screening of infertility and eugenics, and has important significance for clinical diagnosis, early treatment and prevention of diseases and epidemic. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 Amplification curve for M. genitalium in Example 2.

[0022] Figure 2 Amplification curve for C. trachomatis in Example 2.

[0023] Figure 3 Amplification curve for U. urealyticum in Example 2.

[0024] Figure 4 Amplification curve for RP in Example 2.

[0025] Figure 5 Amplification curve for M. genitalium in quadruplex system in Example 3.

[0026] Figure 6 Amplification curve for C. trachomatis in quadruplex system in Example 3.

[0027] Figure 7 Amplification curve for U. urealyticum in quadruplex system in Example 3.

[0028] Figure 8 Amplification curve for RP in quadruplex system in Example 3.

[0029] Figure 9 Amplification curve for direct detection of M. genitalium in Example 5.

[0030] Figure 10 Amplification curve for detection of M. genitalium after nucleic acid extraction in Example 5.

[0031] Figure 11 Amplification curve for direct detection of C. trachomatis in Example 6.

[0032] Figure 12 Amplification curve for detection of C. trachomatis after nucleic acid extraction in Example 6.

[0033] Figure 13 Amplification curve for direct detection of U. urealyticum in Example 7.

[0034] Figure 14 Amplification curve for detection of U. urealyticum after nucleic acid extraction in Example 7.

[0035] Figure 15 Amplification curve for detection of U. urealyticum using other manufacturer's reagent in Example 8.

[0036] Figure 16 Amplification curve for detection of U. urealyticum using nucleic acid detection kit of Example 4 in Example 8. DETAILED DESCRIPTION

[0037] The invention purposes, technical solutions and beneficial effects will be further explained in detail below.

[0038] It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed, and all technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art to which the invention belongs, unless otherwise specified.

[0039] The present application aims to provide a primer probe set and kit for combined detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis. The primer probe set is a series of primers and probes with high specificity and wide coverage designed for Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis and internal standard gene RP, respectively; the kit uses the primer probe set for real-time fluorescent quantitative PCR detection, without the need for nucleic acid extraction, so as to realize in vitro qualitative detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis nucleic acid DNA, with the characteristics of fast operation, low detection cost, high detection specificity, sensitivity and accuracy, and providing data support for clinical diagnosis and evaluation of diseases such as nongonococcal urethritis, infertility and eugenics.

[0040] Specifically, the primer probe set comprises primer probe set A for directly detecting Mycoplasma genitalium mgpB gene, primer probe set B for directly detecting Ureaplasma urealyticum ureB gene, primer probe set C for directly detecting Chlamydia trachomatis ompA gene, and internal standard primer probe set RP. Among them, the primer probe set A comprises primer MG-F, primer MG-R and detection probe MG-P, and the sequence information is shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 in turn; the primer probe set B covers all 14 serotypes of Ureaplasma urealyticum 2 biological groups, comprising primer Uu-F, primer Uu-R.1, primer Uu-R.2 and detection probe Uu-P, and the sequence information is shown in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 in turn; the primer probe set C covers all reproductive serotypes (D, Da, E, F, G, H, I, Ia, J, Ja, K, L1, L2, L2a, L3), comprising primer CT-F, primer CT-R and detection probe CT-P, and the sequence information is shown in SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 in turn; the internal standard primer probe set RP is used for monitoring the whole process, comprising primer RP-F, primer RP-R and detection probe RP-P, and the sequence information is shown in SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13 in turn.

[0041] It should be noted that the internal standard primer probe set RP of the present application is for detecting human gene RNase P, which is present in large quantities in the human body, and as long as it is a human sample, this gene should be detected, and the detection of this gene is used to verify whether the entire amplification system is normal. If the detection result is negative, it means that there is a problem in the amplification process, i.e. the mycoplasma genitalium, ureaplasma urealyticum or chlamydia trachomatis is negative, which may also be a false negative result.

[0042] As an optional mode, in all the primer probe sets for directly detecting mycoplasma genitalium, ureaplasma urealyticum and chlamydia trachomatis described above, a fluorescent group is labeled at the 5' end of the probe, and a fluorescent quenching group or MGB quenching group is labeled at the 3' end of the probe, and different fluorescent groups are labeled on the probes for different target genes. Different fluorescence channels are used for detection in the detection. For example, in some specific embodiments, the fluorescent group can be selected from FAM, ROX, VIC, CY5 or HEX; the quenching group can be selected from BHQ1, BHQ2, BHQ3, MGB, and the excitation and emission wavelength bands of these groups are relatively separated, so that they can be detected separately in one system.

[0043] In one specific embodiment, in all the primer probe sets for directly detecting mycoplasma genitalium, ureaplasma urealyticum and chlamydia trachomatis described above, the probe MG-P is labeled with FAM, the probe Uu-P is labeled with CY5, the probe CT-P is labeled with ROX, and the probe RP-P is labeled with Vic.

[0044] Further, the kit of the present application comprises the primer probe set described above, and further comprises PCR reaction solution, negative control and positive control.

[0045] As an optional mode, the PCR reaction solution generally comprises Taq DNA polymerase, UNG enzyme, dA / G / C / UTPs, magnesium ions, sodium chloride, Tris buffer; the negative control is a pseudo virus containing an internal standard RP gene fragment, which does not include mycoplasma genitalium, ureaplasma urealyticum, chlamydia trachomatis, human genome sequence or similar sequence, and can be used for independent quality control of each amplification reaction, and the normality of the quality control kit itself and experimental operation, so as to exclude false negative caused by failure of the kit or individual sample sampling and operation error; the positive control product is a pseudo virus containing a detection gene fragment.

[0046] Based on the design of the primer probe set of the application, the kit containing the primer probe set, PCR reaction solution, negative control and positive control can be used for the PCR method for directly detecting Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis, which is a flurogenic quantitative polymerase chain reaction (FQ-PCR), also known as real-time quantitative PCR (RT-qPCR) or quantitative PCR (qPCR), which is a quantitative test technology. The reaction is monitored in real time by using a fluorescent dye or a fluorescently labeled specific probe to mark and track the PCR product, obtain an amplification curve, and analyze the product by using a software suitable therefor to calculate the initial concentration of the nucleic acid template of the sample to be detected.

[0047] In the specific detection, a female cervical swab / vaginal swab or a male urethral swab can be used as the detection sample, and the specific detection steps are as follows: (1) Sample processing: 1-3 mL of normal saline (enzyme-free sterile water) is added to the swab sample, and the swab head is fully soaked for 5 min, and vortexed for 2 min to fully detach the pathogens and cells on the swab into the liquid. After instantaneous centrifugation, the sample is used as the sample to be detected. If the sample is not detected immediately after processing, it can be stored at -70°C for standby, and repeated freezing and thawing is avoided.

[0048] (2) Reagent preparation: The primer probe set mixture in the kit is thawed at room temperature, shaken and mixed, and then centrifuged for standby. The nucleic acid amplification reaction solution is thawed at room temperature, shaken and mixed, and then centrifuged for standby. According to the number of samples to be detected, the reaction solution is prepared as shown in the following table. Negative and positive controls are set for each detection. When the number of samples to be detected is n, the number of reaction systems N to be prepared is n + 1 (positive control) + 1 (negative control) + 1. The reaction system is prepared as shown in Table 1.

[0049] Table 1 ; The prepared amplification reaction system is mixed, and then 20 μl / reaction is aliquoted into a PCR reaction tube for standby.

[0050] (3) Sample addition: 5 μl of negative control, sample to be detected and positive control are added to the aliquoted system, and the total reaction volume is 25 μl. The PCR reaction tube cap is tightly covered, and then centrifuged at a low speed for standby.

[0051] (4) PCR amplification: Put the PCR tube in the real-time fluorescence quantitative PCR instrument sample slot in order, and set the sample types such as the sample to be detected, the negative control, the positive control, and the sample name in turn. Select the corresponding fluorescence channel to detect the target gene.

[0052] (5) Result analysis: After the reaction is completed, the result is automatically saved, and the amplification curves of the detection target and the internal standard are analyzed respectively. According to the image after the analysis, adjust the Start value, the End value and the Threshold value (for example, ABI 7500, the user can adjust it according to the actual situation, the Start value can be 3-15, the End value can be 5-20, and the baseline of all amplification curves is ensured to be straight; the threshold line height of various fluorescence channels is set to ΔRn=6000), click Analyze to analyze, and then record the qualitative result under the Plate window.

[0053] Further, the Ct (Cycle-threshold) value can be obtained according to the fluorescence quantitative PCR amplification curve according to the following steps.

[0054] a. Description of amplification curve characteristics: The amplification curve is generally S-shaped, which can be divided into baseline period, exponential growth period, linear growth period and plateau period.

[0055] b. Baseline setting: According to the experimental situation, select a region with stable fluorescence background value as the baseline setting range. It is recommended that the baseline is selected for 5-22 cycles.

[0056] c. Threshold setting: ΔRn (corrected report fluorescence intensity) is a value, which is automatically determined or manually set by software, and is used to determine the Ct value in experimental analysis. The threshold value should be higher than the baseline, and should be controlled within the exponential growth stage of the amplification curve, generally above the highest point of the negative control product amplification curve.

[0057] d. Ct value (Cycle-threshold): The intersection of the threshold line and the amplification curve determines the Ct value.

[0058] (6) Quality control: According to the Ct value and the amplification curve shape corresponding to the detection results of each fluorescence channel, the effectiveness of the experiment is judged.

[0059] The application will be further described in detail in combination with the examples, but the embodiments of the application are not limited thereto.

[0060] 1. Sample type: The samples measured in the following examples are from female cervical swabs / vaginal swabs or male urethral swabs.

[0061] 2. Sample collection: The sample was collected according to the method of collecting the genital tract specimen in the Guide for Clinical Specimen Collection.

[0062] 3. Sample preservation and transportation: The sample to be tested can be immediately used for processing, and the sample to be detected within 24 hours can be stored at 4°C; the sample that cannot be detected within 24 hours should be stored at -70°C or below (if there is no -70°C storage condition, the sample to be tested can be stored at -20°C for 30 days, and the nucleic acid sample is stored at -20±5°C for 30 days). Repeated freezing and thawing should be avoided. The sample is transported by ice flask plus ice or foam box plus ice sealed for transportation.

[0063] Example 1: Preparation of each reagent The following sequences were synthesized by using a DNA synthesizer through a solid-phase phosphoramidite triester method: Primer probe group A: containing primer MG-F, primer MG-R, and probe MG-P; Primer probe group B: containing primer Uu-F, primer Uu-R.1, primer Uu-R.2, and probe Uu-P; Primer probe group C: containing primer CT-F, primer CT-R, and probe CT-P; Internal standard primer probe group RP: containing primer RP-F, primer RP-R, and probe RP-P; Among them, the probe MG-P is labeled with FAM, the probe RP-P is labeled with VIC, the probe Uu-P is labeled with CY5, and the probe CT-P is labeled with ROX.

[0064] Positive control: containing false virus of Mycoplasma genitalium (OK556696.1), Ureaplasma urealyticum (AF085733.2), and Chlamydia trachomatis (OP611864.1) gene sequences.

[0065] Negative control: containing false virus of internal standard gene sequence (U77665.1).

[0066] PCR reaction solution: containing Taq DNA polymerase, UNG enzyme, dA / G / C / UTPs, magnesium ions, sodium chloride, Tris.

[0067] Comparative Example 1: The primer probe group of this comparative example includes primer probe group A', primer probe group B', and primer probe group C', which are as follows: The primer probe set A' is used for directly detecting the mgpB gene of Mycoplasma genitalium, and is also selected in the conserved region of the mgpB gene, but the upstream primer MG-F' is selected in the 90th to 118th base region of the mgpB gene sequence, see SEQ ID NO: 14, the probe MG-P' is selected in the 120th to 152nd base region of the mgpB gene sequence, see SEQ ID NO: 15, and the downstream primer MG-R' is selected in the 171th to 197th base region of the mgpB gene sequence, see SEQ ID NO: 16, and the primer probe set A' is as follows: Primer MG-F': TAATGTTAGTGATGATAATCTCAAGTATC; Primer MG-R': TATAAAGCTCTACCGTTGTTATCATAC; Probe MG-P': CAATGATGTTGAGAAATACCTTGATGATCAGCA.

[0068] The primer probe set B' is used for directly detecting the ureB gene of Ureaplasma urealyticum, and is also selected in the conserved region of the ureB gene, but the upstream primer Uu-F' is selected in the 21th to 41th base region of the ureB gene sequence, see SEQ ID NO: 17, the probe Uu-P' is selected in the 104th to 131th base region of the ureB gene sequence, see SEQ ID NO: 18, and the downstream primer Uu-R' is selected in the 179th to 203th base region of the ureB gene sequence, see SEQ ID NO: 19, and the primer probe set B' is as follows: Primer Uu-F': TAACTAAGCCRTTTACACCTC; Primer Uu-R': ATAGTGCATTAGTATTYTTTGATGA; Probe Uu-P': CGAATAGCAGTACCTGATGGAATATCGA.

[0069] The primer probe set C' is used for directly detecting the ompA gene of Chlamydia trachomatis, and is also selected in the conserved region of the ompA gene, but the upstream primer CT-F' is selected in the 24th to 45th base region of the ompA gene sequence, see SEQ ID NO: 20, the probe CT-P' is selected in the 81th to 105th base region of the ompA gene sequence, see SEQ ID NO: 21, and the downstream primer CT-R' is selected in the 108th to 128th base region of the ompA gene sequence, see SEQ ID NO: 22, and the primer probe set C' is as follows: Primer CT-F: ATTAGTATTTGCCGCTTTGAGT; Primer CT-R: AAACCTTCCCACAGAATTCCG; Probe CT-P: TCCTGCTGAACCAAGCCTTATGATC.

[0070] Comparative Example 2 The primer probe set of the present comparative example includes primer probe set A", primer probe set B" and primer probe set C".

[0071] The primer probe set A" is used for directly detecting the mgpB gene of Mycoplasma genitalium, and is also selected in the conserved region of the mgpB gene, but the upstream primer MG-F" is selected in the 81-110th base region of the mgpB gene sequence, see SEQ ID NO: 23, the probe MG-P" is selected in the 125-157th base region of the mgpB gene sequence, see SEQ ID NO: 24, and the downstream primer MG-R" is selected in the 166-189th base region of the mgpB gene sequence, see SEQ ID NO: 25. The primer probe set A" is as follows: Primer MG-F: TGTTACAAAGAATGTTAGTGATGATAATCT; Primer MG-R: TCTACCGTTGTTATCATACCTTCT; Probe MG-P: ATGTTGAGAAATACCTTGATGATCAGCAAAACT.

[0072] The primer probe set B" is used for directly detecting the ureB gene of Ureaplasma urealyticum, and is also selected in the conserved region of the ureB gene, but the upstream primer Uu-F" is selected in the 22-42th base region of the ureB gene sequence, see SEQ ID NO: 26, the probe Uu-P" is selected in the 89-118th base region of the ureB gene sequence, see SEQ ID NO: 27, and the downstream primer Uu-R" is selected in the 145-167th base region of the ureB gene sequence, see SEQ ID NO: 28. The primer probe set B" is as follows: Primer Uu-F: AACTAAGCCGTTTACACCTCA; Primer Uu-R: AAGACAAAGAACGTAAAGTTGCT; Probe Uu-P: TCTCCTGGTTCAAAACGAATAGCAGTACCT.

[0073] The primer probe set C" is used for directly detecting the Chlamydia trachomatis ompA gene, and is also selected in the conserved region of the ompA gene, but the upstream primer CT-F" is selected in the 10th to 35th base region of the ompA gene sequence, see SEQ ID NO: 29, the probe CT-P" is selected in the 50th to 72nd base region of the ompA gene sequence, see SEQ ID NO: 30, and the downstream primer CT-R" is selected in the 106th to 124th base region of the ompA gene sequence, see SEQ ID NO: 31. The primer probe set C" is as follows: Primer CT-F": CTCTTGAAATCGGTATTAGTATTTGC; Primer CT-R": CTTCCCACAGAATTCCGTC; Primer CT-R": CTTCCCACAGAATTCCGTC;

[0074] Example 2: Single verification of the primer probe The primer probe of the Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis and RP gene involved in the above-mentioned Example 1, Comparative Example 1 to Comparative Example 2 were respectively prepared into amplification reaction liquid (the final concentration of each upstream and downstream primer was 50-500 nM, and the final concentration of the probe was 25-250 nM) by being mixed with PCR reaction liquid, and the Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis and RP pseudovirus were respectively taken as templates and added into the nucleic acid amplification reaction liquid, and the final volume was 25 μl. The PCR tube was placed in a real-time fluorescent quantitative PCR instrument, and PCR amplification was carried out according to the following program: 50°C for 2 min, 95°C for 2 min, 95°C for 15 sec, 55°C for 45 sec, 45 cycles.

[0075] The experimental results are shown in Table 2. Figures 1 to 4

[0076] Table 2 ; From Figures 1 to 4 ​As shown in Table 2 above, when amplifying the corresponding target pseudoviruses using the primer and probe schemes for *Mycoplasma genitalium*, *Ureaplasma urealyticum*, and *Chlamydia trachomatis* in Example 1 and Comparative Examples 1 and 2, considering both the linear shape of the amplification curve and the Ct value, the amplification curve of *Mycoplasma genitalium* in Example 1 is closer to an "S" shape, with higher fluorescence increment and lower Ct value, thus superior to Comparative Examples 1 and 2. Similarly, the amplification curve of *Ureaplasma urealyticum* in Example 1 is also closer to an "S" shape, with higher fluorescence increment and lower Ct value, superior to Comparative Examples 1 and 2. Finally, the amplification curve of *Chlamydia trachomatis* is also closer to an "S" shape, with higher fluorescence increment and lower Ct value, thus superior to Comparative Examples 1 and 2. In summary, the four-system combination of *Mycoplasma genitalium*, *Ureaplasma urealyticum*, and *Chlamydia trachomatis* from Example 1, *Mycoplasma genitalium*, *Chlamydia trachomatis*, and *Ureaplasma urealyticum* from Comparative Example 1, and the internal standard control was selected for further evaluation.

[0077] Example 3: Mixing of Quadruple Primer-Probe Sets Four primer-probe combinations were used to form a quadruple system. Specifically, primer-probe set A, primer-probe set B, primer-probe set C, and internal standard primer-probe set RP from Example 1 were combined to form quadruple system I. Primer-probe set A', primer-probe set B', primer-probe set C', and internal standard primer-probe set RP from Comparative Example 1 were combined to form quadruple system II. Different concentrations of pseudoviruses of Mycoplasma genitalium, Ureaplasma urealyticum, and Chlamydia trachomatis were amplified.

[0078] Experimental results are as follows Figures 5 to 8 As shown in Table 3.

[0079] Table 3 ; Depend on Figures 5 to 8 It is evident that in both quadruple systems I and II, when Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis, and internal standard primers and probes were combined into a quadruple primer-probe mixture and internal standard template was added, the amplification curves and fluorescence increments of each target in quadruple system I showed no significant difference compared to the single-target mixtures. This indicates that when Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis, and internal standard RP primer-probe mixtures were combined into a quadruple mixture, there was no inhibitory interference between the targets, and the internal standard template did not affect or inhibit the other three targets. In quadruple system II, the fluorescence increments of Ureaplasma urealyticum, Chlamydia trachomatis, and the internal standard were not significantly different, but the fluorescence increment of Mycoplasma genitalium decreased significantly by about 50%, which may be due to primer or primer-to-primer interference, leading to the decrease in fluorescence increment.

[0080] As can be seen from Table 3, the four Mycoplasma genitalium, Ureaplasma urealyticum, Chlamydia trachomatis and internal standard RP primer probe combination into a four-fold amplification system, the Ct value difference of each target amplification curve in the single-fold is ≤1, there is no mutual interference and inhibition between each target in the four-fold system I, the four groups of primers and probes can be combined into a four-fold primer probe mixture for simultaneous detection of Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis nucleic acid; at the same time, combined with the consideration of the fluorescence amount of the amplification curve, the four-fold system I has better amplification efficiency, so the four-fold system I is selected for subsequent research.

[0081] Example 4: Mycoplasma genitalium / Ureaplasma urealyticum / Chlamydia trachomatis nucleic acid detection kit The reagent is prepared according to the composition of Table 4.

[0082] Table 4 ; (1) Sample processing (in the sample processing area) Dilute the Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis pseudovirus with physiological saline gradient, and the dilution liquid is the sample to be tested.

[0083] (2) Reagent preparation (in the reagent preparation area) Take out the nucleic acid amplification reaction solution and primer probe mixture from the kit, shake well after thawing at room temperature, and centrifuge briefly for standby. According to the number of samples to be detected, prepare the reaction solution according to the following table, and it is recommended to set up negative control and positive control for each detection. When the number of samples to be detected is n, the number of reaction systems N to be prepared = the number of samples to be detected (n) + positive control (1) + negative control (1) + 1. Prepare the reaction system according to Table 5.

[0084] Table 5 ; Mix the prepared reaction system, and aliquot 20 μl into a PCR reaction tube, and transfer to the sample processing area.

[0085] (3) Sample loading (in the sample processing area) Add 5 μl of negative control, sample to be tested and positive control to the aliquoted reaction system, respectively, and the total reaction volume is 25 μl. Tighten the reaction tube, centrifuge momentarily at low speed, and transfer to the detection area.

[0086] (4) PCR amplification (in the amplification and analysis area) The PCR amplification program is as follows: 50℃ 2min, 95℃ 2min, 95℃ 15sec, 55℃ 45sec 45cycles, Put the PCR tube in the amplification instrument sample groove in order, and set the positive control, negative control, sample to be tested and other sample types in turn, and set the sample name. Select FAM, CY5 and ROX channels to detect Mycoplasma genitalium, Ureaplasma urealyticum and Chlamydia trachomatis respectively, and select VIC channel to detect internal standard gene RP. Set "Quencher Dye" and "Passive Reference" in the ABI 7500 instrument to None.

[0087] (5) Result analysis After the reaction is completed, the results are automatically saved, and the amplification curves of the detection target and the internal standard are analyzed respectively. According to the image after analysis, adjust the Start value, End value and Threshold value of the baseline (for example, the user can adjust it according to the actual situation, the Start value can be set to 3-15, the End value can be set to 5-20, and the baseline part of all amplification curves is ensured to be flat; the threshold line height of the four fluorescence channels is set to △Rn=6000), click Analyze to analyze, and then record the qualitative results under the Plate window.

[0088] (6) Quality control (determination of experimental effectiveness) The kit control must meet the following requirements, as shown in Table 6 below, otherwise the experiment is invalid.

[0089] Table 6 ; Positive judgment value: The Ct reference value of the target gene of the kit is 38, and the Ct reference value of the internal standard is 38, which is determined by the reference value research.

[0090] Further, under the premise of experimental validity, the test results are determined according to Tables 7 and 8, Table 7 is used for Ct value and positive and negative result judgment of each fluorescence channel, and Table 8 is used for result judgment.

[0091] Table 7 ; Table 8 ; Note: "+" represents positive, "-" represents negative Example 5: Detection of clinical samples (Mycoplasma genitalium) Using the nucleic acid detection kit of Example 4, the collected 5 cases of Mycoplasma genitalium clinical samples were directly detected and detected after nucleic acid extraction (using the nucleic acid extraction kit of Beijing Jijian Medical Technology Co., Ltd.), and the detection results were compared and verified. The detection results are shown in Figure 9 and Figure 10 .

[0092] Further, the detection results of 5 Mycoplasma genitalium clinical samples after direct detection and nucleic acid extraction are analyzed, and the Ct values are shown in Table 9.

[0093] Table 9 ; As shown in Table 9, the Ct values of the direct detection results of the 5 Mycoplasma genitalium clinical samples are smaller than the Ct values of the detection results after nucleic acid extraction, and the direct detection Ct values are about 0.5-1.9 smaller than the nucleic acid extraction detection Ct values. The comparison results show that the detection sensitivity of the direct detection using the nucleic acid detection kit of Example 4 is higher.

[0094] Example 6: Clinical sample detection (Chlamydia trachomatis) The nucleic acid detection kit of Example 4 is used to compare and verify the direct detection and the detection after nucleic acid extraction (using the nucleic acid extraction kit of Beijing Jijian Medical Technology Co., Ltd.) of 6 Chlamydia trachomatis clinical samples collected. The detection results are shown in Tables 10 and 11. Figure 11 Figure 12

[0095] Further, the detection results of 6 Chlamydia trachomatis clinical samples after direct detection and nucleic acid extraction are analyzed, and the Ct values are shown in Table 10.

[0096] Table 10 ; As shown in Table 10, the Ct values of the direct detection results of the 6 Chlamydia trachomatis clinical samples are smaller than the Ct values of the detection results after nucleic acid extraction, and are about 0.29-2.86 smaller. The comparison results show that the detection sensitivity of the direct detection using the nucleic acid detection kit of Example 4 is higher.

[0097] Example 7: Clinical sample detection (Ureaplasma urealyticum) The nucleic acid detection kit of Example 4 is used to compare and verify the direct detection and the detection after nucleic acid extraction (using the nucleic acid extraction kit of Beijing Jijian Medical Technology Co., Ltd.) of 22 Ureaplasma urealyticum clinical samples collected. The detection results are shown in Tables 11 and 12. Figure 13 Figure 14

[0098] Further, the detection results of 22 Ureaplasma urealyticum clinical samples after direct detection and nucleic acid extraction are analyzed, and the Ct values are shown in Table 11.

[0099] Table 11 ; ​​​​From Table 11, it can be seen that the Ct values of the results of the direct detection of 14 clinical samples of Ureaplasma urealyticum are smaller than the Ct values of the results of the detection after extraction of nucleic acid, about 0.21-3.3 smaller, the results of the direct detection and the detection after extraction of nucleic acid of 8 negative samples are both negative, and the accuracy is consistent. The comparison result shows that the accuracy of the direct detection by using the nucleic acid detection kit of Example 4 is good, and the sensitivity is higher.

[0100] Example 8: Comparison with other manufacturers' reagents The nucleic acid detection kit of Example 4 is used to detect 18 clinical samples, together with the Ureaplasma urealyticum nucleic acid detection kit (fluorescence PCR method) (with extraction reagent) which has been registered and approved for marketing, and the detection results are shown in Table 11. Figure 15 and Figure 16 .

[0101] Further, the detection results of the direct detection and the detection after extraction of nucleic acid of 18 clinical samples of Ureaplasma urealyticum are analyzed, and the Ct values are shown in Table 12.

[0102] Table 12 ; From Table 12, it can be seen that the coincidence rate of the positive and negative results of the detection results of the nucleic acid detection kit of Example 4 and the registered and approved kit is 100%, and the Ct values of the detection results of the nucleic acid detection kit of Example 4 are smaller than the Ct values of the detection results of other manufacturers' reagents, about 0.07-1.43 smaller. The comparison result shows that the accuracy of the direct detection by using the nucleic acid detection kit of Example 4 is good, and the sensitivity is higher.

[0103] The above is only a preferred embodiment of the present application, and does not limit the present application in any form, and any simple modification and equivalent change of the above embodiment according to the technical essence of the present application all fall within the protection scope of the present application.

Claims

1. A primer and probe set for the combined detection of Mycoplasma genitalium, Ureaplasma urealyticum, and Chlamydia trachomatis, characterized in that: This includes primer and probe set A for direct detection of the mgpB gene of Mycoplasma genitalium, primer and probe set B for direct detection of the ureB gene of Ureaplasma urealyticum, and primer and probe set C for direct detection of the ompA gene of Chlamydia trachomatis. The primer-probe set A includes: Primer MG-F, located in the region of bases 131–151 of the mgpB gene sequence, has the sequence shown in SEQ ID NO: 1; primer MG-R, located in the region of bases 175–199 of the mgpB gene sequence, has the sequence shown in SEQ ID NO: 2; and probe MG-P, located in the region of bases 155–172 of the mgpB gene sequence, has the sequence shown in SEQ ID NO:

3. The primer-probe set B includes: Primer Uu-F, targeting the 50-70 base region of the ureB gene sequence, has the sequence shown in SEQ ID NO: 4; two complementary primers, Uu-R.1 and Uu-R.2, targeting the 149-169 base region of the ureB gene sequence, have the sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6; and probe Uu-P, targeting the 104-131 base region of the ureB gene sequence, has the sequence shown in SEQ ID NO:

7. The primer-probe set C includes: Primer CT-F, selected from the 135th to 153rd base region of the ompA gene sequence, has the sequence shown in SEQ ID NO: 8; primer CT-R, selected from the 199th to 218th base region of the ompA gene sequence, has the sequence shown in SEQ ID NO: 9; and probe CT-P, selected from the 155th to 175th base region of the ompA gene sequence, has the sequence shown in SEQ ID NO:

10.

2. The primer-probe set according to claim 1, characterized in that: It also includes the internal standard primer-probe set RP used to monitor the entire detection process.

3. The primer-probe set according to claim 2, characterized in that: The internal standard primer-probe set RP includes: Primer RP-F: AGATTTGGACCTGCGAGC; Primer RP-R: GAGCGGCTGTCTCCACAAGT; Probe RP-P: TTCTGACCTGAAGGCTCTGCGCG.

4. The primer-probe set according to claim 1, characterized in that: The direct detection method uses female cervical swabs, female vaginal swabs, or male urethral swabs as test samples, and performs PCR amplification detection directly without nucleic acid extraction.

5. A kit for the combined detection of Mycoplasma genitalium, Ureaplasma urealyticum, and Chlamydia trachomatis, characterized in that: The kit includes a PCR reaction solution and a primer and probe set as described in any one of claims 1 to 4.

6. The reagent kit according to claim 5, characterized in that: The PCR reaction solution includes Taq DNA polymerase, UNG enzyme, dA / G / C / UTPs, magnesium ions, sodium chloride, and Tris buffer.

Images