Molecular marker for identifying wheat grain weight, KASP primer combination, kit and application thereof
By detecting the TaWRKY4-5D gene on wheat chromosome 5D and developing a KASP primer combination, the stability problem of wheat grain weight identification was solved, efficient molecular marker-assisted selection was achieved, and the process of high-yield wheat breeding was promoted.
Patent Information
- Application Number
- CN202511653484.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-12
- Publication Date
- 2026-02-13
AI Technical Summary
Existing technologies lack molecular markers that are stably expressed in wheat grain weight under different environments, making it difficult to achieve efficient marker-assisted selection and affecting the process of high-yield wheat breeding.
A stable grain weight-related QTL was detected on wheat chromosome 5D. The TaWRKY4-5D gene was identified as the key gene through candidate gene analysis. KASP primer combinations were designed to accurately distinguish different haplotypes, and a KASP kit was developed for rapid identification.
This method enables stable identification of wheat grain weight under various environmental conditions, simplifies the breeding process for high-grain-weight materials, and improves breeding efficiency and accuracy.
Smart Images
Figure CN121518682A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular genetics and breeding, and particularly relates to a molecular marker for identifying wheat grain weight, a KASP primer combination, a kit and application thereof. BACKGROUND
[0002] Wheat (Triticum aestivum L.) is one of the three major crops in the world, with the largest planting area and total yield, and has strategic significance for ensuring national food security. The grain yield of wheat is determined by three major factors: the number of spikes per unit area, the number of grains per spike, and the grain weight. Under the current cultivation conditions and breeding level, the improvement of spike number and grain number has relatively limited space, and increasing grain weight has become an important way to further break through the yield bottleneck of wheat.
[0003] Wheat grain weight is a typical quantitative trait, controlled by multiple genes and easily affected by environmental conditions, making it difficult to improve genetically. With the development of molecular markers and genomics, quantitative trait locus (QTL) mapping has become a major means to analyze the genetic basis of wheat grain weight. Previous studies have used 9K, 55K, 90K, 660K, and other SNP chips of different densities to map QTLs related to wheat grain traits, and reported multiple QTLs associated with grain weight. However, most of these QTLs have environmental dependence and population specificity, and their stability is poor under different genetic backgrounds and ecological conditions. Currently, there are limited numbers of QTLs for grain weight that can be stably expressed in different environments, and there is a lack of key sites that can be directly applied to molecular marker-assisted selection. Therefore, it is of great significance to identify and utilize stable QTLs and analyze their candidate genes for molecular design breeding of high-yield wheat.
[0004] Transcription factors play an important regulatory role in the formation of crop yield traits. Among them, WRKY transcription factors are a family of plant-specific transcription factors that have been shown to be involved in stress response, grain development, and metabolic pathways. In crops such as rice and maize, different WRKY members are associated with grain size, grain filling, and yield traits. However, in wheat, the association between WRKY family and grain weight traits is still limited. SUMMARY
[0005] The present application aims at the blank of the prior art, and detects a stable grain weight related QTL on the 5D chromosome by high-density chip (660K) genotyping and grain trait determination of a wheat recombinant inbred line population, the QTL shows a high genetic interpretation rate in multiple environments, and further candidate gene analysis shows that TaWRKY4-5D gene in the interval encodes a WRKY transcription factor, which is the most reliable candidate gene in the QTL region. Haplotype analysis of the TaWRKY4-5D gene finds that three main haplotype materials show significant differences in grain weight, which have the value of being used as a target gene for molecular marker development and genetic improvement. Further, a KASP primer combination is designed and developed according to the gene sequence and key polymorphic sites, the primer combination can accurately distinguish different haplotypes, is simple and convenient to operate, has high throughput, is suitable for large-scale popularization and application in wheat breeding materials, and the KASP primer combination can be used for detection, so that excellent allelic variations can be quickly identified, and an effective technical means is provided for selection of excellent genotype materials and cultivation of high-yield wheat new varieties, and has a wide application prospect.
[0006] The present application provides a molecular marker related to wheat grain weight, which is a SNP site located at 135660077 bp of the 5D chromosome of wheat, and has G / A mutation, specifically, the nucleotide sequence of the molecular marker is shown as SEQ ID NO:1, and the 19th base is G or A, and the mutation causes polymorphism.
[0007] The present application also provides a KASP primer combination for detecting the above-mentioned molecular marker, which comprises: a forward primer F1 as shown in SEQ ID NO:2; a forward primer F2 as shown in SEQ ID NO:3; and a common reverse primer R as shown in SEQ ID NO:4. Forward primer F1: CCATTTACTTAACCCCCTG (SEQ ID NO:2) Forward primer F2: CCATTTACTTAACCCCCTA (SEQ ID NO:3) Common reverse primer R: GTCTGCCAGAGTTGTAGGACA (SEQ ID NO:4).
[0008] Further, the forward primer F1 and the forward primer F2 are respectively connected with different fluorescent labels. For example, the forward primer F1 is connected with a HEX fluorescent label, and the forward primer F2 is connected with a FAM fluorescent label.
[0009] The present application also provides a kit for identifying high and low wheat grain weight, which comprises the above-mentioned KASP primer combination.
[0010] Further, the kit further comprises: PCR buffer, DNA polymerase, dNTP mixture.
[0011] The application further provides application of the above-mentioned molecular marker, KASP primer set or kit in any one of the following: A1) identifying or assisting in identifying wheat grain weight; A2) preparing a product for identifying or assisting in identifying wheat grain weight; A3) breeding wheat germplasm with high grain weight; A4) preparing a product for breeding wheat germplasm with high grain weight.
[0012] The application further provides a method for identifying or assisting in identifying high or low wheat grain weight, which comprises: detecting the above-mentioned molecular marker as shown in SEQ ID NO: 1, wherein when the genotype of the 19th position is GG, it corresponds to wheat with high grain weight, and when the genotype of the 19th position is AA, it corresponds to wheat with low grain weight.
[0013] Further, the KASP primer set or the kit is used to perform PCR amplification on the genomic DNA of the wheat sample to obtain the molecular marker, and the genotype is determined by detecting the fluorescence signal.
[0014] Further, the forward primer F1 is connected with a HEX fluorescence label, and the forward primer F2 is connected with a FAM fluorescence label, so that when the HEX fluorescence signal is detected, it indicates that the detected genotype is GG, which corresponds to wheat with high grain weight; and when the FAM fluorescence signal is detected, it indicates that the detected genotype is AA, which corresponds to wheat with low grain weight.
[0015] The application further provides a method for breeding wheat germplasm with high grain weight, which comprises: detecting the above-mentioned molecular marker as shown in SEQ ID NO: 1, and selecting wheat materials with the genotype GG at the 19th position of the molecular marker for breeding wheat germplasm with high grain weight.
[0016] Further, the KASP primer set or the kit is used to perform PCR amplification on the genomic DNA of the wheat sample to obtain the molecular marker, and the genotype is determined by detecting the fluorescence signal.
[0017] Further, the forward primer F1 is connected with a HEX fluorescence label, and the forward primer F2 is connected with a FAM fluorescence label, so that when the HEX fluorescence signal is detected, it indicates that the detected genotype is GG, which corresponds to wheat with high grain weight; and when the FAM fluorescence signal is detected, it indicates that the detected genotype is AA, which corresponds to wheat with low grain weight.
[0018] Further, the reaction system for PCR amplification of the genomic DNA of the wheat sample is as follows: 2.5 μL of KASP premix, 2.4 μL of 60 ng / μL genomic DNA, 0.04 μL of 0.06 μL of primer mixture, wherein the volume ratio of the primer mixture is as follows: 100 μM forward primer F1: 100 μM forward primer F2: 100 μM common reverse primer R: ddH2O = 12: 12: 30: 46. 2 ⁺ 0.04 μL, 0.06 μL of primer mixture, wherein the volume ratio of the primer mixture is as follows: 100 μM forward primer F1: 100 μM forward primer F2: 100 μM common reverse primer R: ddH2O = 12: 12: 30: 46.
[0019] Further, the reaction procedure for PCR amplification of the genomic DNA of the wheat sample is as follows: initial denaturation at 95°C for 15 minutes; then 10 cycles of touchdown PCR reaction: each cycle includes denaturation at 95°C for 20 seconds and annealing for 30 seconds, and the annealing temperature starts from 65°C and decreases by 0.5°C per cycle; followed by 30 cycles of standard amplification: each cycle includes denaturation at 95°C for 10 seconds and annealing / elongation at 57°C for 60 seconds.
[0020] Beneficial effects: the present application first detects a stable grain weight related QTL on the 5D chromosome of wheat, which exhibits a high genetic interpretation rate in multiple environments and has important application potential. Further candidate gene analysis shows that the TaWRKY4-5D gene in the interval encodes a WRKY transcription factor, which is the most reliable candidate gene in the QTL region. To verify its role in the natural population of wheat, haplotype analysis of the TaWRKY4-5D gene was performed, and the results showed that there are three major haplotypes of the gene, and the materials with different haplotypes differ significantly in grain weight performance. It is shown that the genetic variation of TaWRKY4-5D is closely related to the formation of grain weight, and it has the value of being used as a target gene for molecular marker development and genetic improvement. Further, a KASP primer set is designed and developed according to the sequence of the gene, which can accurately distinguish different haplotypes, is simple and high-throughput, and is suitable for large-scale application in wheat breeding materials.
[0021] The KASP marker developed by the present application can be applied to: 1. molecular marker assisted selection (MAS): rapidly identifying excellent grain weight haplotypes in early breeding, accelerating the polymerization and breeding of excellent materials; 2. germplasm resource evaluation: used for genotype analysis of grain weight related genes of wheat germplasm, to assist in exploring excellent gene resources; 3. variety identification: plays a role in variety authenticity detection and variety characteristic marker development.
[0022] Through the detection of the marker, excellent allelic variation can be rapidly identified, which provides an effective technical means for the selection of excellent genotype materials and the cultivation of high-yield wheat new varieties, and has broad application prospect and promotion value.
[0023] The KASP primer set of the present application can be prepared into reagents or a kit, which comprises KASP primers, PCR buffer, DNA polymerase, dNTP mixture and fluorescence channel setting instructions required for detection. The user can directly use the kit for genotype detection, thereby realizing rapid screening of excellent genotypes of grain weight of wheat materials. BRIEF DESCRIPTION OF DRAWINGS
[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can also be obtained without creative labor on the basis of these drawings.
[0025] Figure 1 Figure A is the change of LOD value of multiple grain traits with the change of chromosome position; Figure B is the genetic marker distribution (left side) of two parents and 7 key recombinant inbred lines in the candidate positioning region of 5D chromosome and the phenotype data distribution (right side) of their thousand-grain weight (TGW), grain length (GL) and grain width (GW); Figure C is the distribution of high-confidence annotated genes in the fine mapping region in the Chinese Spring reference genome.
[0026] Figure 2 Figure A is the relative expression amount of candidate genes TraesCS5D01G116000 and TraesCS5D01G116100 in parent round selection 987 (LX987) and mutant eh1; Figure B is the expression pattern of candidate genes TraesCS5D01G116000 and TraesCS5D01G116100 in different tissue organs of wheat; Figure C is the structure of TraesCS5D01G116100 (TaWRKY4-5D) gene and the sequence variation between parent LX987 and eh1; Figure D is the relative signal intensity of luciferase reporter gene driven by TaWRKY4-5D gene in LX987 and mutant eh1.
[0027] Figure 3 Figure A is the polymorphism site and haplotype analysis of TaWRKY4-5D gene; Figure B is the geographical distribution of different haplotypes in global wheat micro-core germplasm resources; Figure C is the statistical analysis of grain-related traits (thousand-grain weight TGW, grain length GL, grain width GW) of different haplotype material populations.
[0028] Figure 4 Validation results of the KASP primer set developed in Example 3 of the present application in a recombinant inbred line population, wherein Figure A is a genotyping cluster plot of the KASP primer set, and the data points in red, blue and green colors in the figure correspond to two homozygous parental types and a heterozygous genotype, respectively; Figure B is a statistical analysis chart of grain traits corresponding to different families identified in the recombinant population using the KASP primer set. DETAILED DESCRIPTION
[0029] The following examples are only used to more clearly illustrate the technical solutions of the present application, and thus are only examples and cannot be used to limit the protection scope of the present application. It should be noted that, unless otherwise specified, the technical terms or scientific terms used in the present application should be understood as the usual meanings understood by the skilled in the art to which the present application belongs. Unless otherwise specified, the reagents, methods and devices employed by the present application are the conventional reagents, methods and devices in the technical field. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.
[0030] Example 1 QTL positioning and candidate gene analysis of wheat grain weight In this example, a recombinant inbred line (RIL) population was constructed using the winter wheat variety LUX987 (LX987) and the mutant eh1 as parents, wherein the mutant eh1 was obtained by gamma irradiation mutagenesis of original No. 9 in a high-generation strain. Phenotypic determination of wheat grain-related traits was performed under multiple environmental conditions, including grain weight (TGW), grain length (GL), grain width (GW), grain area (GA), and grain perimeter (GP) data obtained in 2017 and 2018, which showed that LX987 was significantly better than eh1 in grain. Using the above-mentioned 400 RIL families, combined with 660K SNP chip genotyping data, a genetic linkage map was constructed for quantitative trait locus (QTL) positioning. The results, as shown in Figure 1 The results showed that a stable grain weight-related QTL was detected on chromosome 5D of wheat, which showed a high genetic explanation rate under multiple years and multiple environmental conditions, and had important application value.
[0031] Analysis found that there were candidate genes TraesCS5D01G116000 and TraesCS5D01G116100 in the interval, and the candidate genes were studied.
[0032] The expression levels of the two candidate genes in the parents LX987 and mutant eh1 and the expression patterns in different tissues and organs of wheat were analyzed, and the results showed that the expression levels of the two candidate genes in the leaves of LX987 were significantly higher than those in the mutant eh1 (P<0.05) (Fig. 4A and 4B). Figure 2A); in addition, analysis using the wheat public expression database shows that TraesCS5D01G116000 has a certain amount of expression only in stems, while TraesCS5D01G116100 has relatively high expression in leaves, glumes and seeds Figure 2 B).
[0033] Analysis shows that the candidate gene TraesCS5D01G116100 (TaWRKY4-5D) encodes a WRKY transcription factor. First sequencing of the TaWRKY4-5D gene in the two parents LX987 and eh1 shows, as shown in Figure 2 C, that compared with LX987, there is a single nucleotide polymorphism site (SNP) and two small fragment deletion mutations (1 bp and 12 bp) in the gene in eh1. Further, using a dual luciferase reporter gene detection system, the difference in regulatory activity of the sequence variation fragment of the TaWRKY4-5D gene in LX987 and mutant eh1 was compared, to verify the reason for the difference in expression amount of the gene in the two materials at the transcriptional regulation level. Specifically, the 300 bp sequence containing the variation in the third intron of TaWRKY4-5D in LX987 and eh1 was cloned, respectively, and the two different fragments were inserted into the reporter gene vector to drive the expression of the luciferase gene, thereby successfully constructing two recombinant reporter gene vectors. The above two recombinant vectors were transformed into tobacco leaves, and the blank vector was set as a negative control. The materials were collected for fluorescence signal by a cold light imaging system, the expression intensity of luciferase was directly represented as the intensity of blue fluorescence, and the relative fluorescence signal intensity was quantitatively determined (Renilla Luciferase (REN) was used as an internal reference to correct the difference in transformation efficiency), the experiment was repeated at least three times independently, the data were represented as mean ± standard deviation, and t test was used for statistical difference analysis (P < 0.05 was considered significant). The results are shown in Figure 2 D, which shows that compared with eh1, the reporter gene driven by the DNA fragment derived from LX987 shows significantly higher fluorescence signal intensity. In combination with the above results, TaWRKY4-5D is the best candidate gene.
[0034] Example 2 Analysis of TaWRKY4-5D gene polymorphism Analysis of the sequence variation of the TaWRKY4-5D gene in 262 wheat micro-core germplasm resources found that the TaWRKY4-5D gene has polymorphisms in the promoter region and the coding region, and according to these polymorphisms, the materials were divided into three main haplotypes: Hap1, Hap2 and Hap3. Figure 3-A), and further analysis of the geographical distribution of the three haplotypes in global wheat micro-core germplasm resources and grain-related traits, the results show that haplotype Hap1 is positively selected in global wheat germplasm resources, and shows a relatively high frequency distribution (Hap1>Hap2>Hap3) Figure 3 -B). And the above-mentioned haplotype and grain weight, grain length and grain width are significantly different, among which Hap1 shows higher grain weight, Hap2 and Hap3 show lower grain weight, and the grain length and grain width of Hap1 are also significantly higher than those of Hap2 and Hap3 (Hap1>Hap2, Hap3) Figure 3 -C). The above results show that the genetic variation of TaWRKY4-5D is closely related to the formation of grain weight, and has the value of being developed as a molecular marker and a target gene for genetic improvement.
[0035] Example 3 Development and application of KASP primer According to Figure 3 -A, wherein the 10th polymorphic site is G in Hap1 and A in Hap2 and Hap3, thereby distinguishing Hap1 from Hap2 and Hap3. Based on the key SNP site, the present application designs and develops an allele-specific KASP (Kompetitive Allele-Specific PCR) primer.
[0036] The SNP site is located at 135660077 bp of wheat 5D chromosome (reference genome: IWGSC RefSeqv1.0 (Taishan Spring) reference genome), and there is G / A polymorphism at 135660077 bp. Specifically, the SNP site is located at the 19th position of the sequence shown in SEQ ID NO: 1, and there is G / A polymorphism: CCATTTACTTAACCCCCT(G / A)GCTATGTTTTAGACCTATGGTGTTGCTAACATAGACGAACGGAACATAGTGTGCCTGCACAGCAGCCATGTGGCCAATTTTTACCACGTAACATCACACGTAGACAATGAAATCATCAACTGCAGCAGTGTAGCGTCAATTTGAACTCATGTCCTACAACTCTGGCAGAC (SEQ ID NO: 1) The KASP primer is shown in the sequence table SEQ ID NO: 2-4, specifically: Forward primer F1 (with HEX fluorescent label): CCATTTACTTAACCCCCTG (SEQ ID NO: 2) Forward primer F2 (with FAM fluorescent label): CCATTTACTTAACCCCCTA (SEQ ID NO: 3) Common reverse primer R: GTCTGCCAGAGTTGTAGGACA (SEQ ID NO: 4) Two different forward primers can be combined with different genotypes and amplified respectively, and the fluorescent labels carried by each forward primer are different, so different genotypes corresponding to different haplotypes can be distinguished by detecting the fluorescent signals. If HEX fluorescent signal is detected, it indicates that the detected genotype is GG, which corresponds to the higher grain weight haplotype Hap1, and if FAM fluorescent signal is detected, it indicates that the detected genotype is AA, which corresponds to the lower grain weight haplotypes Hap2 and Hap3.
[0037] The KASP primer combination provided by the application is used to amplify sample DNA in a PCR reaction system, and after amplification and fluorescence detection, genotype determination is performed: the genotype corresponding to Hap1 is GG type; the genotype corresponding to Hap2 and Hap3 is AA type. The PCR reaction system is as follows: The reaction system (5 μL) includes: 2.5 μL KASP premix (KASP master mixture, LGCGenomics, UK), 2.4 μL DNA template (60 ng / μL), 0.04 μL 50 mM Mg 2 ⁺, and 0.06 μL primer mixture. The ratio (volume ratio) of the primer mixture is: forward primer F1 (100 μM): forward primer F2 (100 μM): common reverse primer R (100 μM): ddH2O = 12:12:30:46.
[0038] The PCR reaction program is: initial denaturation at 95°C for 15 minutes, then 10 cycles of Touch-down reaction, each cycle including 95°C denaturation for 20 seconds and annealing for 30 seconds, and the annealing temperature starts from 65°C, and decreases by 0.5°C each cycle; followed by 30 cycles of standard amplification, each cycle at 95°C for 10 seconds, 57°C for annealing / extension for 60 seconds.
[0039] The detection results show that the KASP primer combination can accurately distinguish Hap1 and Hap2 (or Hap3) haplotypes in a recombinant inbred line population.
[0040] 400 parts of wheat recombinant inbred lines are used for genotype detection, such as Figure 4As shown in A, wherein the data points of red, blue and green correspond to homozygous LX987 genotype, homozygous eh1 genotype and heterozygous genotype respectively, the results show that the typing success rate of the KASP primer is more than 95%, and the genotype results are highly consistent with the phenotype measured thousand-grain weight data. Different haplotypes show stable differences under multiple environmental conditions, indicating that the marker has good applicability and stability Figure 4 -B).
[0041] In summary, the present application detects a gene TaWRKY4-5D significantly related to the phenotype of wheat grain weight on the 5D chromosome of wheat based on QTL positioning, finds that the gene has polymorphism in the regulatory region, and can be divided into three main haplotypes Hap1, Hap2 and Hap3 according to the polymorphism, and there is significant difference in grain weight among different haplotypes, wherein Hap1 shows higher grain weight, and Hap2 and Hap3 show lower grain weight. Further, the KASP primer of allelic specificity is developed based on the key SNP sites of the three haplotypes, and the sample DNA is amplified by using the primer, and different fluorescence signals are detected to distinguish the genotypes corresponding to different haplotypes, and the genotype corresponding to Hap1 is GG type; the genotype corresponding to Hap2 and Hap3 is AA type. The results show that the KASP primer set can accurately distinguish different genotypes, and the operation is simple, high-throughput, suitable for large-scale application in wheat breeding materials. It can be applied to molecular marker-assisted selection to realize rapid screening of excellent genotype of wheat material grain weight, rapid identification of excellent haplotype of grain weight in early breeding, acceleration of polymerization and breeding of excellent materials, and has wide application prospect and popularization value.
[0042] The above specific embodiments describe the implementation of the present application in detail, but the present application is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concepts of the present application, the technical solutions of the present application can be modified and changed in many simple ways, and these simple changes all belong to the protection scope of the present application.
Claims
1. A molecular marker associated with wheat grain weight, grain length, and / or grain width, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO:1, and the 19th base is either A or G, which results in polymorphism.
2. A KASP primer set for detecting the molecular marker described in claim 1, characterized in that, The KASP primer set includes: forward primer F1 as shown in SEQ ID NO:2; forward primer F2 as shown in SEQ ID NO:3; and common reverse primer R as shown in SEQ ID NO:
4.
3. The KASP primer set according to claim 2, characterized in that, The forward primers F1 and F2 are each connected to different fluorescent labels.
4. A kit for identifying wheat grain weight and / or wheat grain length and width, characterized in that, It contains the KASP primer set as described in claim 2 or 3.
5. The use of the molecular marker of claim 1, or any of the KASP primer sets of claims 2-3, or the kit of claim 4, in any of the following: A1) To identify or assist in the identification of wheat grain weight, grain length, and / or grain width; A2) Prepare products for identification or auxiliary identification of wheat grain weight, grain length and / or grain width; A3) Breeding high-grain-weight wheat germplasm; A4) Prepare and breed high-grain-weight wheat germplasm products.
6. A method for identifying or assisting in the identification of wheat grain weight, characterized in that, The method includes: detecting the molecular marker as described in claim 1, wherein when the genotype at position 19 is GG, it corresponds to high-grain-weight wheat, and when the genotype at position 19 is AA, it corresponds to low-grain-weight wheat.
7. The method according to claim 6, characterized in that, Molecular markers were obtained by PCR amplification of genomic DNA in wheat samples using the KASP primer set as described in any one of claims 2-3 or the kit as described in claim 4, and genotype was determined by fluorescence detection signals.
8. A method for breeding high-grain-weight wheat germplasm, characterized in that, The molecular marker described in claim 1 was detected, and wheat materials with the genotype GG at position 19 of the molecular marker were selected for breeding high-grain-weight wheat germplasm.
9. The method according to claim 8, characterized in that, Molecular markers were obtained by PCR amplification of genomic DNA from wheat samples using the KASP primer set as described in any one of claims 2-3 or the kit as described in claim 4, and the genotype was detected by fluorescence detection signal.
10. The method according to claim 7 or 9, characterized in that, The reaction system for PCR amplification of genomic DNA from wheat samples was as follows: 2.5 μL KASP premix, 2.4 μL 60 ng / μL genomic DNA, and 50 mM MgSO4. 2 ⁺ 0.04 μL and 0.06 μL primer mixture, wherein the volume ratio of the primer mixture is: 100 μM forward primer F1: 100 μM forward primer F2: 100 μM common reverse primer R: ddH2O = 12:12:30:46.