Application of MTB01 g gene or homologous gene thereof in promoting plant growth or increasing yield

Abstract

The invention discloses application of an MTB01 g gene or a homologous gene of the MTB01 g gene in promoting plant growth or increasing yield. The MTB01 g gene in the rice is mutated in a gene editing mode to construct the rice MTB01 g gene mutant strain, and compared with wild type rice, the rice MTB01 g gene mutant strain shows the phenotype that the plant height is increased, the tiller number in the growing period is increased, the effective tiller number is increased, the spike length is increased, the hundred-grain weight is increased, and the like. It is proved that the MTB01 g gene or the homologous gene thereof has the functions of promoting plant growth or increasing plant yield and the like. The method has application prospects in the aspects of promoting plant growth, increasing plant yield or cultivating high-yield plant varieties and the like.

Description

Technical Field

[0001] This invention relates to novel uses of genes isolated from grasses, particularly from rice (…). Oryza sativa Separated from ) MTB01g The use of a gene or its homologous gene in promoting plant growth or increasing yield belongs to MTB01g New applications of genes or their homologs. Background Technology

[0002] Rice ( Oryza sativa L. Rice is one of the world's most important food crops. In recent years, due to the slow increase in rice yield per unit area, some regions have experienced stagnant yield growth. An even greater challenge is how to significantly increase yield per unit area with existing or even reduced planting areas. During rice cultivation, physiological indicators such as plant height, effective tiller number, panicle length, and 100-grain weight can all affect the final rice yield.

[0003] By mining rice gene banks and screening for genes that can regulate physiological indicators such as plant height, effective tiller number, panicle length, and 100-grain weight, we can have promising applications in regulating rice growth and increasing rice yield. Summary of the Invention

[0004] The main objective of this invention is to screen out genes from the rice gene bank that can regulate physiological indicators such as rice plant height, effective tiller number, panicle length and 100-grain weight, and apply them to promote plant growth and increase plant yield.

[0005] To achieve the above objectives, the main technical solutions adopted by the present invention include: One aspect of the present invention is to MTB01g Genes, MTB01g protein or MTB01g Homologous genes are used to promote plant growth or increase plant yield.

[0006] A preferred embodiment of the present invention includes: taking plants MTB01g Mutation or interference of genes or their homologs MTB01g Gene or its homologous gene expression reduces the concentration of certain genes in plants. MTB01g The expression level or amount of the gene or its homologous gene can cause defects in the normal function or activity of the MTB01g protein or its homologous protein.

[0007] The invention described MTB01g The nucleotide sequence of the gene's CDS is selected from any one of the nucleotide sequences described in (a) or (b) below: (a) The polynucleotide sequence shown in SEQ ID No. 1; (b) A polynucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 3.

[0008] The invention described MTB01g The nucleotide sequence of the gene's genome is shown in SEQ ID No. 2.

[0009] The invention described MTB01g The homologous gene is selected from any of the following polynucleotide sequences (c), (d), or (e): (c) A polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under strict hybridization conditions, and that polynucleotide sequence still has the function of promoting plant growth or increasing yield; (d) A polynucleotide sequence that has at least 90% or more identity with any of the polynucleotide sequences shown in (a), (b) or (c) above, and that polynucleotide sequence still has the function of promoting plant growth or increasing plant yield; (e) A polynucleotide sequence that is complementary to any of the polynucleotide sequences described in (a), (b), (c) or (d) above, and that polynucleotide sequence still has the function of promoting plant growth or increasing plant yield.

[0010] The amino acid sequence of the MTB01g protein or its homologous protein described in this invention is selected from any of the following amino acid sequences (I)-(IV): (I) The amino acid sequence shown in SEQ ID No. 3; (II) Protein variants obtained by deleting or replacing one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 3, wherein the protein variants still have the function or activity of regulating plant growth or yield; (III) Protein variants obtained by inserting one or more amino acid residues into the amino acid sequence shown in SEQ ID No. 3, wherein the protein variants still have the function or activity of regulating plant growth or yield; (IV) A protein that has 80% or more of the same amino acid sequence as the one shown in SEQ ID No. 3, and that still has the function or activity of regulating plant growth or yield.

[0011] The percentage of sequence identity described in this invention can be obtained using well-known bioinformatics algorithms, including the Myers and Miller algorithm, the Needleman-Wunsch global alignment method, the Smith-Waterman local alignment method, the Pearson and Lipman similarity search method, and the Karlin and Altschul algorithm, which are well known to those skilled in the art.

[0012] In addition, the nucleotides described in this invention can be DNA, such as cDNA, genomic DNA, or recombinant DNA; or they can be RNA, such as mRNA or hnRNA.

[0013] The mutations include MTB01g The mutation involves the substitution, deletion, and / or addition of one or more nucleotides in the nucleotide sequence of a gene or its homologous gene or promoter; preferably, the mutation can be obtained by physical mutagenesis, chemical mutagenesis, or gene editing; the physical mutagenesis includes, but is not limited to, radiation mutagenesis and space breeding; the chemical mutagenesis methods include mutagenesis caused by treatment with mutagens such as EMS; the gene editing methods include, but are not limited to, ZFN, TALE, and / or CRISPR / Cas.

[0014] Those skilled in the art can use conventional methods such as gene knockout or gene editing techniques to target genes in plants. MTB01g Knockout mutations are performed on genes or their homologs, for example, by constructing... MTB01g Gene knockout vectors or gene editing technologies are used to construct MTB01g CRISPR / Cas9 gene editing vectors, etc., for genes or their homologous genes, can be used to edit plants. MTB01g Knockout or mutation of genes or their homologs are methods that are well known to those skilled in the art.

[0015] For reference, the present invention provides MTB01g Methods for constructing genes or their homologous gene editing vectors, including: containing... MTB01g The target sequence for introducing mutations into a gene or its homologous gene, along with fragments of homologous arms, are linked to the vector backbone to obtain... MTB01g Genes or their homologous gene editing vectors.

[0016] Those skilled in the art will understand that the main principle of CRISPR / Cas gene editing systems or methods is to use a nucleic acid fragment called guide RNA (gRNA) to locate the site for gene editing in the host genome, i.e., the target DNA sequence, and then use Cas proteins to cut the DNA. In this application, the Cas proteins include, but are not limited to, Cas9, Cas12, Cas12a, Cas12j, Cas12e, Cas13, and / or Cas14 proteins.

[0017] The interference MTB01gNormal expression or function of a gene or its homologous gene can be disrupted by RNA interference (RNAi) technology. This interference can interfere with the normal expression of the gene encoding the MTB01g protein or its homologous protein or its promoter, or cause defects in its normal function. RNA interference technology is a common technique in this field. It uses 21-23 bp short double-stranded RNA (siRNA) or long double-stranded RNA (dsRNA; double-strand RNA) to specifically bind to the homologous region of the mRNA expressing the target gene, thereby degrading the mRNA and inhibiting gene expression.

[0018] The gene editing vector described in this invention may further contain selective marker genes for selecting transformed cells or tissues. These marker genes include genes encoding antibiotic resistance and genes conferring resistance to herbicides. Furthermore, the marker genes may also include phenotypic markers, such as β-galactosidase and fluorescent proteins.

[0019] The transformation scheme and the scheme for introducing the polynucleotide or polypeptide into the plant can vary depending on the type of plant or plant cell used for transformation. Suitable methods for introducing the polynucleotide into plant cells include microinjection, electroporation, Agrobacterium-mediated transformation, direct gene transfer, and high-speed ballistic bombardment. In specific embodiments, various transient transformation methods can be used to transform rice. MTB01g Genes are provided to plants. Transformed cells can be regenerated into stably transformed plants using conventional methods (McCormick et al. Plant Cell Reports. 1986. 5:81-84).

[0020] The plant described in this invention is preferably a grass, and more preferably rice.

[0021] In a preferred embodiment of the present invention, the promotion of plant growth is the promotion of rice growth; wherein, the promotion of rice growth includes increasing rice plant height or shortening the tillering angle.

[0022] In a preferred embodiment of the present invention, the increase in plant yield refers to the increase in rice yield, specifically including: increasing the number of effective tillers in rice, increasing panicle length and / or increasing 100-grain weight.

[0023] This invention uses wild-type rice as experimental material and employs gene editing techniques to... MTB01g Gene mutations resulted in mutant strains with defective normal function of the MTB01g protein; compared to the wild type, MTB01g The mutant strains exhibited increased plant height, increased effective tiller number, increased ear length, and increased 100-grain weight, indicating a significant improvement in both growth performance and yield. This demonstrates that the gene mutation... MTB01gOr its homologous genes have the function of negatively regulating plant growth or yield. This invention has promising applications in promoting plant growth, increasing plant yield, or breeding high-yielding rice varieties.

[0024] Definitions of terms involved in this invention Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods, apparatus, and materials similar to or equivalent to those described herein may be used in the practice or testing of this invention, preferred methods, apparatus, and materials are now described.

[0025] The terms "polynucleotide" or "nucleotide" refer to deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and their polymers, either in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also refers to oligonucleotide analogs, including PNAs (peptide nucleic acids), DNA analogs (phosphate thioesters, phosphoramidites, etc.) used in antisense techniques. Unless otherwise specified, specific nucleic acid sequences implicitly encompass variants of their conserved modifications (including, but not limited to, degenerate codon substitutions) and complementary sequences, as well as explicitly specified sequences. Specifically, degenerate codon substitution can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with a mixed base and / or deoxyinosine residue.

[0026] In this invention, "rigorous hybridization conditions" refers to conditions of low ionic strength and high temperature known in the field. Typically, under rigorous conditions, the detectability of the probe hybridizing with its target sequence is significantly higher than that with other sequences (e.g., at least twice the background level). Rigorous hybridization conditions are sequence-dependent and will vary under different environmental conditions; longer sequences hybridize specifically at higher temperatures. By controlling the rigor of hybridization or washing conditions, target sequences that are 100% complementary to the probe can be identified. Detailed guidance on nucleic acid hybridization can be found in relevant literature (Tijssen, Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid hybridization"). (acidassays. 1993). More specifically, the stringent conditions are typically chosen to be approximately 5-10°C below the thermal melting point (Tm) of the specific sequence at a specified ionic strength pH. Tm is the temperature at which 50% of the probe complementary to the target sequence hybridizes to the target sequence in equilibrium (at a specified ionic strength, pH, and nucleic acid concentration) (because the target sequence is in excess, 50% of the probe is occupied at Tm in equilibrium). Stringent conditions may include a salt concentration below approximately 1.0 M sodium ion concentration at pH 7.0 to 8.3, typically approximately 0.01 to 1.0 M. The concentration of sodium ions (or other salts) must be M, and the temperature must be at least about 30°C for short probes (including, but not limited to, 10 to 50 nucleotides) and at least about 60°C for long probes (including, but not limited to, more than 50 nucleotides). Strict conditions can also be achieved by adding a destabilizing agent such as formamide. For selective or specific hybridization, the positive signal can be at least twice the background hybridization, and, where appropriate, ten times the background hybridization. Exemplary strict hybridization conditions may be as follows: 50% formamide, 5×SSC and 1% SDS, incubated at 42°C; or 5×SSC, 1% SDS, incubated at 65°C, washed in 0.2×SSC and washed in 0.1% SDS at 65°C. The washing can be performed for 5, 15, 30, 60, 120 minutes or longer.

[0027] In this invention, "a plurality of" generally means 2-8, preferably 2-4; "replacement" means replacing one or more nucleotide residues with different nucleotide residues respectively; "deletion" means a reduction in the number of nucleotide residues, that is, the absence of one or more nucleotide residues respectively; "insertion" means a change in the sequence of nucleotide residues, which, relative to the natural molecule, results in the addition of one or more nucleotide residues.

[0028] The terms "recombinant host cell line" or "host cell" refer to a cell containing the polynucleotides of the present invention, regardless of the method used for insertion to produce the recombinant host cell, such as direct uptake, transduction, f-pairing, or other methods known in the art. The exogenous polynucleotides may be maintained as, for example, a non-integrating vector of a plasmid or may be integrated into the host genome. The host cell may be a prokaryotic or eukaryotic cell, and may also be a monocotyledonous or dicotyledonous plant cell.

[0029] The term "operable connection" refers to a functional connection between two or more elements, which can be adjacent or non-adjacent.

[0030] The term "conversion" refers to the method of introducing a heterologous DNA sequence into a host cell or organism.

[0031] The term "expression" refers to the transcription and / or translation of endogenous genes or transgenes in plant cells.

[0032] The term "gene editing vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to in the art as binary vectors. Binary vectors, along with vectors containing helper plasmids, are commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selection markers engineered for expression in plant cells, etc. Attached Figure Description

[0033] Figure 1 For rice MTB01g Flowchart for constructing gene mutant strains.

[0034] Figure 2 Wild-type rice and rice MTB01g A comparison of the phenotypes of gene mutant strains at different time points; among them... Figure 2 -A represents wild-type rice and rice. MTB01g Phenotypic comparison of the MT3-1 mutant strain at 120 days; Figure 2 -B represents wild-type rice and rice. MTB01g Phenotypic comparison of the MT3-2 mutant strain at 120 days; Figure 2 -C represents wild-type rice and rice. MTB01g Statistical chart of plant height of gene mutant strains at 120 days.

[0035] Figure 3 Wild-type rice and rice MTB01g A statistical chart showing the yield of gene mutant strains; among which, Figure 3 -A represents wild-type rice and rice. MTB01g Comparison of effective tiller numbers in gene mutant strains after 120 days; Figure 3 -B represents wild-type rice and rice. MTB01g Statistical chart of effective tiller number in gene mutant strains; Figure 3 -C represents wild-type rice and rice. MTB01g Comparison of ear length between gene mutant plants; Figure 3 -D represents wild-type rice and rice. MTB01g Statistical graph of ear length in mutant plants; Figure 3 -E represents wild-type rice and rice. MTB01g Comparison of 100-grain weight of gene mutant strains; Figure 3 -F represents wild-type rice and rice. MTB01g Statistical chart of 100 grains weight of gene mutant strain. Detailed Implementation

[0036] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, it should be understood that the embodiments described are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but such modifications or substitutions all fall within the protection scope of the present invention.

[0037] Experimental Example 1: Rice MTB01G Construction of gene mutant strains and identification of growth and yield phenotypes. 1. Rice MTB01G Construction of gene editing vectors according to MTB01g The target sequence (TACGGGAGATAACTCAAGGGTGG (SEQ ID No. 4)) was designed based on the nucleotide sequence of the gene's CDS (SEQ ID No. 1), and the sequence containing... MTB01G The target sequence with introduced mutations and the target fragment with homologous arms were ligated to the linearized vector backbone WMC025-pCBSG032. The ligation system is shown in Table 1. After mixing on ice, the mixture was placed in a PCR instrument at 37°C for 30 min and then stored on ice or at 4°C.

[0038] MTB01g The nucleotide sequence of the gene's CDS is shown in SEQ ID No. 1; MTB01g The nucleotide sequence of the gene genome is shown in SEQ ID No. 2; the amino acid sequence of the MTB01g protein is shown in SEQ ID No. 3.

[0039] Table 1 Recombinant Linkage System

[0040] After removing the competent DH5α cells from the refrigerator, quickly place them on ice. After 5 minutes, once the bacterial block has dissolved, add 10 µL of the ligation product, let stand on ice for 25 min, heat shock at 42℃ for 45 s, place on ice for 2 min (without shaking), add 100 µL of antibiotic-free LB liquid medium, and incubate at 37℃ with shaking at 200 rpm for 1 h. Spread the culture onto LB solid medium containing 50 μg / mL kanamycin and incubate at 37℃ for one day.

[0041] Twelve single clones were randomly selected from the cultured plates and placed into 2 mL sterile EP tubes. 500 µL of LB liquid medium was added to the sterile EP tubes in advance, and the tubes were incubated at 37°C and 200 rpm for 6 h. 5 µL of bacterial culture was taken from each sample for PCR. The reaction system for bacterial culture PCR is shown in Table 2. Positive clones with the correct band size were selected by gel electrophoresis for sequencing.

[0042] The nucleotide sequences of the primers QC-F / QC-R used for colony PCR are as follows: QC-F: CTGGCGAAAGGGGGATGTGCTGCAA (SEQ ID No. 5); QC-R: TTCAAACAAGTGTGACAAAAA (SEQ ID No. 6).

[0043] Table 2 Reaction system for bacterial culture PCR

[0044] Plasmids with correct sequencing results were stored at -20°C to complete the construction of gene editing vectors.

[0045] 2. Genetic transformation of rice Infection solution: 50 g sucrose, 2.2 g MS powder, 0.5 g MES, 500 μL Silwet L-77. First, add 800 mL distilled water, adjust the pH to 5.7 with 1 M KOH, add distilled water to make up to 1000 mL, and autoclave to obtain the solution.

[0046] Induction medium: N6 max 100 mL of stock solution (10×), N6 min 10 mL of stock solution (100×), Fe 2+- 10 mL of EDTA stock solution (100×), 10 mL of vitamin stock solution (100×), 2.5 mL of 2,4-D stock solution, 0.6 g of proline, 0.8 g of CH4, 30 g of sucrose, and 3 g of plant gel. First, add 900 mL of distilled water, adjust the pH to 5.8 with 1 M KOH, add distilled water to make up to 1 L, then boil and dispense into 100 mL Erlenmeyer flasks, and autoclave to obtain the final product.

[0047] Solid co-culture medium: N6 max Stock solution (10×) 12.5 mL, N6 min Stock solution (100×) 1.25 mL, Fe 2+ Prepare 1.25 mL of EDTA stock solution (100×), 2.5 mL of vitamin stock solution (100×), 0.625 mL of 2,4-D stock solution, 0.15 g of proline, 0.2 g of CH4, 7.5 g of sucrose, and 2 g of agar powder. First, add 200 mL of distilled water and adjust the pH to 5.6 with 1 M KOH. Then, add distilled water to a final volume of 250 mL and autoclave. Before use, add 5 mL of 50% glucose and 250 μL of LAS stock solution.

[0048] Screening medium: N6 max Stock solution (10×) 25 mL, N6 min Stock solution (100×) 2.5 mL, Fe 2+ Prepare 2.5 mL of EDTA stock solution (100×), 2.5 mL of vitamin stock solution (100×), 0.625 mL of 2,4-D stock solution, 0.15 g of proline, 0.2 g of CH4, 7.5 g of sucrose, and 2 g of agar powder. First, add 200 mL of distilled water and adjust the pH to 6.0 with 1 M KOH. Then, add distilled water to a final volume of 250 mL and autoclave. Before use, add 250 μL of Hn (50 mg / mL) and 500 μL of Cn (250 mg / mL), pour into a sterile petri dish, and dry on a clean bench for approximately 2 hours.

[0049] Differentiation medium: MS max Stock solution (10×) 100 mL, MS min 10 mL of stock solution (100×), Fe 2+- EDTA stock solution (100×) 10 mL, vitamin stock solution (100×) 10 mL, KT stock solution 2.0 mL, NAA stock solution 0.2 mL, proline 0.6 g, CH 0.8 g, D-sorbitol 30 g, sucrose 30 g, plant gel 3.0 g. First, add 900 mL of distilled water, adjust the pH to 5.8 with 1 M KOH, add distilled water to make up to 1 L, then boil and dispense into 100 mL Erlenmeyer flasks, and autoclave to obtain the final product.

[0050] Rooting medium: MS max Stock solution (10×) 50 mL, MS min Stock solution (100×) 5 mL, Fe 2+ - 5 mL of EDTA stock solution (100×), 5 mL of vitamin stock solution (100×), 20 g of sucrose, and 3.0 g of plant gel were added to 900 mL of distilled water. The pH was adjusted to 5.8 with 1 M KOH, and the volume was brought up to 1 L with distilled water. The solution was then boiled and dispensed into rooting tubes and autoclaved.

[0051] Will MTB01G Transform Agrobacterium tumefaciens into gene editing vector: 1 µL MTB01G The gene-editing vector was placed in 20 µL of Agrobacterium tumefaciens culture (EHA105-WM), incubated on ice for 5 min, flash-frozen in liquid nitrogen for 5 min, incubated in water at 37°C for 5 min, and then incubated on ice for 5 min. 100 µL of antibiotic-free LB liquid medium was added, and the mixture was incubated at 28°C with shaking at 200 rpm for 2 h. The culture was then directly plated onto LB solid medium containing 50 μg / mL kanamycin and 50 μg / mL rifampin, and incubated at 28°C for two days.

[0052] Two days later, select one single colony and place it into a 5 mL sterile EP tube. Add 2 mL of LB liquid medium containing 50 μg / mL kanamycin and 50 μg / mL rifampin to the sterile EP tube beforehand, and incubate overnight. Add 100 µL of 75% sterile glycerol to 400 µL of the bacterial culture, label it, and store it at -80°C.

[0053] Select mature rice seeds, remove the husks, and pour them into 50 mL centrifuge tubes. Add 75% ethanol for 1 min to sterilize, discard the ethanol, rinse once with sterile water, discard the ethanol, then add 30% sodium hypochlorite for 20 min to sterilize, discard the sodium hypochlorite, and rinse 5-6 times with sterile water. Pipette away excess water and transfer the seeds to induction medium, 20-25 seeds per dish. After callus formation, the original embryos can be directly used for transformation.

[0054] Agrobacterium EHA105 containing the target gene vector was streaked onto LB agar containing 50 μg / mL kanamycin and incubated in the dark at 28°C for 2 days until single colonies appeared. The infection solution was prepared by using a pipette to aspirate the infection solution and wash the Agrobacterium off the plate; this yielded the Agrobacterium suspension for co-culture transformation of rice.

[0055] Select a sufficient number of callus tissues (good callus condition, bright yellow color, round and firm texture, and particle diameter of about 3 mm are preferred) and place them in a 100 mL sterile Erlenmeyer flask. Add an appropriate amount of Agrobacterium suspension (ensure sufficient bacterial suspension to contact the material). Incubate at room temperature for 20 minutes, shaking occasionally. Discard the bacterial suspension, place the callus tissues on sterile filter paper to absorb excess bacterial suspension, and then transfer them to a solid co-culture medium lined with a layer of sterile filter paper. Incubate at 26°C in the dark for 3 days.

[0056] MTB01g The flowchart for constructing gene mutant strains is as follows: Figure 1 As shown, the specific steps are as follows: After co-culturing for 3 days, the callus tissue is cleaned. Using a 1 mL blue pipette tip, the callus on the solid co-culture medium is transferred to a sterilized Erlenmeyer flask. Sterile water is added to rinse both sides, and a third rinse is made with sterile water containing 500 μL / L carbenicillin. Excess water is removed by pipette, and the callus is transferred to sterile filter paper. The water on the callus is dried using the air blower in a laminar flow hood for about 30 minutes. After the callus is dried, it is transferred to selection medium for selection culture. The culture conditions are 28-30℃, dark culture. The selection time is 3-4 weeks. After one month of selection, bright yellow positive callus can be seen growing. At this time, the positive callus can be picked and transferred to differentiation medium for differentiation and regeneration. 16 positive callus are placed on each differentiation dish and placed in a greenhouse at 28-30℃ under light. Generally, green spots will appear on the callus after about 10 days, and seedlings will differentiate after another 10 days. Once the differentiated seedlings have grown to about 2-3cm and have obvious roots, they can be transferred to a rooting medium to allow them to grow. The rooting medium should be poured into a relatively tall bottle or tube so that the rooted seedlings have enough space to grow tall. The rooting culture conditions are 28-30℃ and sterile light culture.

[0057] After transplanting, PCR detection of resistance genes and target sites was performed on T0 plants. The reaction system and procedure for PCR detection are shown in Tables 3 and 4. The primers for detecting resistance genes were HYG-F1 / HYG-R1, and the primers for detecting target sites were J2281074-A1-F1 / R1. The nucleotide sequences of the two primer sets are as follows: HYG-F1: CAAAGATCGTTATGTTTATCGGCACT (SEQ ID No. 7); HYG-R1: TTGGCGACCTCGTATTGGGAA (SEQ ID No. 8).

[0058] J2281074-A1-F1: AATAAGAGGAAGGGTTTGA (SEQ ID No. 9); J2281074-A1-R1: TAGGACCATGTTGAGGAA (SEQ ID No. 10).

[0059] Table 3 Reaction system for PCR detection Table 4 Reaction Procedure for PCR Detection

[0060] 3. Rice MTB01g Functional identification test of gene mutant strains 3.1 Rice MTB01g Growth performance identification results of gene mutant strains Rice seeds were spread evenly in a petri dish lined with moist filter paper and germinated at 28°C. After 3 days, the rice seeds had basically germinated and were transferred to a rice culture box and cultured at 28°C for about 30 days. Then, they were transferred to a rice field to continue growing. The distance from the root to the tip of the rice was measured with a measuring ruler at maturity (120 days after germination).

[0061] Phenotypic results of rice at the post-germination maturity period (120 days) are as follows: Figure 2 As shown, where, Figure 2 -A represents wild-type rice and rice. MTB01g Phenotypic comparison of the MT3-1 mutant strain at 120 days; Figure 2 -B represents wild-type rice and rice. MTB01g Phenotypic comparison of the MT3-2 mutant line at 120 days; compared with wild-type rice, rice MTB01g The mutant strains exhibited the trait of greater plant height; Figure 2 -C represents wild-type rice and rice. MTB01g A statistical chart showing the growth of gene mutant strains; the plant height statistics are as follows: Figure 2 As shown in -C, compared with wild-type rice, rice MTB01g The plant height of the MT3-1 mutant rice line increased by 3.03%. MTB01g The mutant MT3-2 line showed a 0.16% increase in plant height; therefore, compared to wild-type rice, the rice... MTB01g The growth performance of the gene mutant strain was significantly improved.

[0062] 3.2 Rice MTB01g Yield identification results of gene mutant strains Rice seeds were spread evenly in petri dishes lined with moist filter paper and germinated at 28°C. After 3 days, the rice seeds had mostly germinated and were transferred to rice culture boxes for cultivation at 28°C for about 30 days. They were then transferred to rice paddies to continue growing for up to 120 days. A timer was used to count the number of tillers per rice plant. Until the rice matured, the distance from the base to the tip of the panicle was measured using a ruler, the number of effective tillers per plant was counted using a timer, and the weight of 100 plump rice seeds was weighed using an analytical balance.

[0063] Wild-type rice and rice MTB01g Yield indicators of mutant rice strains, such as Figure 3 As shown, where, Figure 3 -A is a phenotypic comparison of the number of effective tillers in rice after 120 days; 3-B is the statistical result of the number of effective tillers in rice after 120 days, compared with wild-type rice. MTB01g The effective tiller number of the gene mutant strain was significantly increased, especially in rice. MTB01g The effective tiller number of the MT3-1 mutant line increased by 0.66% in rice. MTB01g The effective tiller number of the MT3-2 mutant line increased by 11.92%; Figure 3 -C is a phenotypic comparison of panicle length in rice at 120 days; Figure 3 -D represents the statistical results of panicle length at 120 days for rice. Compared with wild-type rice, rice... MTB01g The panicle length of the mutant rice strain is significantly elongated, among which rice MTB01g The spikelet length of the MT3-1 mutant rice line increased by 3.00%. MTB01g The ear length of the mutant MT3-2 line increased by 0.29%; Figure 3 -E is a phenotypic comparison of 100-grain weight of rice after 120 days. Figure 3 -F represents the statistical results of the 100-grain weight of rice after 120 days, compared with wild-type rice. MTB01g The 100-grain weight of the gene mutant strain was significantly increased in rice. MTB01g The 100-grain weight of the mutant MT3-1 line was increased by 1.82% in rice. MTB01g The 100-grain weight of the mutant MT3-2 line was increased by 0.81%. Therefore, compared with wild-type rice, rice... MTB01g The yield of the gene mutant strain was significantly increased.

Claims

1. MTB01g genes, MTB01g genes, homologues of the genes, MTB01g proteins or homologues thereof for use in promoting plant growth or increasing plant yield.

2. Use according to claim 1, characterized in that, comprising: mutating, or interfering with expression of a gene or its homolog in a plant, MTB01g or reducing the amount or level of expression of a gene or its homolog in a plant, MTB01g such that the normal function or activity of the MTB01g protein or its homolog is defective. MTB01g mutating, or interfering with expression of a gene or its homolog in a plant, MTB01g or reducing the amount or level of expression of a gene or its homolog in a plant, MTB01g such that the normal function or activity of the MTB01g protein or its homolog is defective. MTB01g 3. Use according to claim 1, characterized in that, The method of claim 1 MTB01g The nucleotide sequence of the CDS of the gene is selected from any one of the nucleotide sequences described in (a) or (b) below: (a) a polynucleotide sequence as shown in SEQ ID No. 1; (b) a polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID No.

3.

4. Use according to claim 1, characterized in that, The method of claim 1 MTB01g The homologous gene of the gene is selected from any one of the polynucleotide sequences of (c), (d), or (e): (c) a polynucleotide sequence capable of hybridizing to the polynucleotide sequence as recited in (a) or (b) of claim 3 under stringent hybridization conditions, which polynucleotide sequence still has the function of promoting plant growth or increasing yield; (d) a polynucleotide sequence which is at least 90% or more identical to the polynucleotide sequence as recited in (a) or (b) of claim 3 or any one of the polynucleotide sequences recited in (c) above, which polynucleotide sequence still has the function of promoting plant growth or increasing yield; (e) a polynucleotide sequence which is complementary to the polynucleotide sequence as recited in (a) or (b) of claim 3 or any one of the polynucleotide sequences recited in (c) or (d) above, which polynucleotide sequence still has the function of promoting plant growth or increasing yield.

5. Use according to claim 1, characterized in that, The amino acid sequence of the MTB01g protein or its homologous protein is selected from any one of the following (I) - (IV): (I) the amino acid sequence as shown in SEQ ID No. 3; (II) a protein variant obtained by deletion or substitution of one or more amino acid residues in the amino acid sequence as shown in SEQ ID No. 3, which protein variant still has the function or activity of regulating plant growth or yield; (III) a protein variant obtained by insertion of one or more amino acid residues in the amino acid sequence as shown in SEQ ID No. 3, which protein variant still has the function or activity of regulating plant growth or yield; (IV) a protein having 80% or more identity to the amino acid sequence as shown in SEQ ID No. 3, which protein still has the function or activity of regulating plant growth or yield.

6. Use according to claim 1, characterized in that, The plant is a plant of the family Poaceae; preferably, the plant of the family Poaceae is rice.

7. A method of promoting growth of rice, characterized by, comprising: In rice MTB01g Mutation or interference of genes or their homologs MTB01g Expression of the gene or its homologous gene; reducing the expression of the gene in rice. MTB01g The expression level or amount of the gene or its homologous gene can cause defects in the normal function or activity of the MTB01g protein or its homologous protein.

8. The method of claim 7, wherein, The promoting rice growth comprises increasing the plant height of rice.

9. A method for increasing yield or breeding high yield rice variety, characterized in that, comprising: mutating, or interfering with expression of a gene or its homolog in rice MTB01g or a homolog thereof; reducing the amount or level of expression of a gene or its homolog in rice MTB01g or a homolog thereof; and / or reducing the amount or level of expression of a gene or its homolog in rice MTB01g or a homolog thereof, so that the normal function or activity of the MTB01g protein or a homolog thereof is impaired.

10. The method of claim 9, wherein, The increasing rice yield comprises: increasing the effective tiller number of rice, increasing the panicle length or / and increasing the 100-grain weight. The increasing rice yield comprises: increasing the effective tiller number of rice, increasing the panicle length or / and increasing the 100-grain weight.

Images