An indel molecular marker related to soybean grain weight trait, a primer pair for detecting the marker and application thereof

Abstract

This invention provides an Indel molecular marker associated with soybean grain weight, its detection primer pair, and its application, belonging to the field of soybean breeding technology. The invention provides an Indel molecular marker associated with soybean grain weight, the nucleotide sequence of which is shown in SEQ ID NO:1; SEQ ID NO:1 contains 1-2 repeating sequences, the nucleotide sequences of which are shown in SEQ ID NO:2. The invention also provides primer pairs for amplifying the Indel molecular marker. The InDel molecular marker developed in this invention is highly significantly correlated with soybean grain weight and can be used for marker-assisted selection breeding and progeny selection, improving the selection efficiency of high grain weight materials.

Description

Technical Field

[0001] This invention belongs to the field of soybean breeding technology, specifically relating to an Indel molecular marker related to soybean grain weight traits and its application. Background Technology

[0002] Soybeans (Glycine max) provide nearly 60% of global oilseed crop production and account for more than 25% of global protein consumption in food and animal feed, making them a major economic crop for vegetable oil and protein production. Soybeans originated in China, where they have been cultivated for over 5,000 years, and from there spread to other countries around the world.

[0003] Soybean 100-seed weight is not only an important yield component of soybeans, but also a characteristic that determines soybean grade and the quality of soybean-containing foods. However, 100-seed weight is a complex quantitative trait with high heritability, controlled by multiple genes, making it difficult to screen soybeans with high 100-seed weight based on single-gene molecular testing. Furthermore, traditional breeding methods are time-consuming, difficult, and require significant human and material resources. Summary of the Invention

[0004] The purpose of this invention is to provide an Indel molecular marker that is highly correlated with soybean grain weight, which can be used for soybean-assisted breeding and progeny screening, thereby improving the selection efficiency of high-yield materials.

[0005] This invention provides an Indel molecular marker associated with soybean grain weight trait, the nucleotide sequence of which is shown in SEQ ID NO:1;

[0006] There are 1 to 2 repeating sequences in SEQ ID NO:1, and the nucleotide sequences of the repeating sequences are shown in SEQ ID NO:2.

[0007] The present invention provides a primer pair for amplifying the Indel molecular marker, the primer pair comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:4.

[0008] This invention provides a kit for detecting soybean grain weight, including the primer pair.

[0009] Preferably, it also includes DNA polymerase, buffer solution and dNTPs.

[0010] This invention provides an application of the Indel molecular marker, the primer pair, or the kit in soybean breeding and / or germplasm resource identification.

[0011] This invention provides an application of the Indel molecular marker, the primer pair, or the kit in detecting soybean grain weight advantage.

[0012] Preferably, the soybean variety includes at least one of the following: Jiyu 508, Zhongji 603, Fengdou 9, Heinong 26, PI614833, Xingkangxian 1, Suinong 14, Hefeng 40, Beidou 20, PI638511, Dongnong 4, Fengshou 10, Hongfeng 2, PI567224, PI602897, Heihe 3, Neidou 3, Heihe 52, Zhongzuo 90957, Nen'ao 08-1092, FC001, Haojiang 10-1270, Huinong 10-06, Heifu 10-221, Heihe 22, Zhonghuang 908, Zhonghuang 907, Zhonghuang 903, Jiusan 09-25, Jiunong 33, Heinong 61, Heinong 44, Suifu 09-5016, Heinong 69, Heihe 4. Heihe No. 44, Heihe No. 35, Heihe No. 54, Heihe No. 29, Kenjiandou No. 25, Jiufeng No. 1, Heihe No. 45, Jiufeng No. 3, Heihe No. 5, Jiufeng No. 4, Beijiang No. 9 No. 1, Fengdou No. 24, Longken No. 306, Jiufeng No. 6, Jiufeng No. 5, Mengdou No. 39, Jiyu No. 701, Kenjiandou No. 26, Longken No. 330, Kendou No. 27, Hefeng No. 42, Longken No. 332, Fengshou No. 18 Mengdou 26, Kedou 23, Beidou 36, Fengshou 11, Dongnong 48, Zhonghuang 901, Fengshou 25, Beifeng 11, Baofeng 8, Longken 336, Fengshou 27, Canadian Protein Beans, Hefeng 30, Mengdou 33, Kennong 2, Kejiao 07-1, Huajiang 6155, Shi 10-94, Shundou 5, Dongnong 42, Mengdou 15, Dongnong 59, Heisheng 1 01, Ken 11-7155, Ken K11-7456, Sheng 168, Fengshou 12, Dongnong 4211, Kenfeng 17, Kenfeng 20, Heihe 38, Dengke 4, Kendou 30, Kenfeng 23, Suinong 34, Suinong 27, Suinong 26, Keshan 1, Kenfeng 22, Kenfeng 16, Heinong 55, Kejiao 09-95, Mengdou 13, Dengke 5 Mengdou 14, Heihe 18, Huajiang 2, Mengdou 16, Nenfeng 16, Beidou 37, Heihe 55, Mengdou 30, Dengke 1, Beidou 19, Heinong 62, Heinong 64, Longpin 06-130, Nongda 75188, Fengdou 23, Suinong 30, Henong 60, Ken 07-5203, Kangxian 9, Kenjiandou 4, Jiyuanyin 3, Suinong 4 No., Sui 08-5356, Hefeng 48, Yinbei'an, 09-1126, Beijiang 08-280, 1438, 1358, Mengdou 12, Suinong 35, Mengdou 36, Beidou 18, Kangxian 5, He 08-1524, Beiguo 168, Beiguo 919, Heihe 36, Henong 55, Suinong 31, Mengdou 32, Heihe 34, Mengdou 37, PI592524, PI572245, Zhongzuoyin 1, PI561858, PI567786, PI614831, PI587091, PI542403, PI615585, Heinong 16, PI548560, Dongnong 72-806, PI548534, PI548501, PI548545PI532467, Beihudou, Mengdou 19, Dongnong 44, PI602896, PI562372, PI548582, PI548607, Longda 10-73, Jiyu 702, Jiusan 09-4, Kenfeng 18, Kenjiandou 33, Suiwuxingdou 2, Suinong 32, Nongda 85213, Hehang 10-239, Heihe 56, Dongda 1, Fengshou 23, Mengdou 9, Beifeng 2, Heihe 51, Mengdou 5, Longken 316, Kendou 59, Beifeng 16, Nenliang 7, Kendou 40, Longken 333, Fengshou 9, Dongsheng 7, Huajiang 4, Neidou 4, Heihe 49, Heihe 43, Heihe 53, Mengdou 28, Manguidou, 09-1230, Gan 248, 2488, 09-1120, Dengke 6 (2027), Sui 03-3068, Hujiao 282, 2465, Henong 65 (05-450), and Hehe 05-729.

[0013] This invention provides a method for screening soybeans with grain weight advantage based on the Indel molecular marker, comprising the following steps:

[0014] Using the genomic DNA of the soybean sample to be tested as a template, PCR amplification was performed using the primer pair to obtain the PCR product;

[0015] The grain weight advantage of soybean samples is determined based on the fragment length of the PCR product: when the length of the PCR product is 738 bp, the soybean sample to be tested is judged to have an advantageous grain weight trait; when the length of the PCR product is 798 bp, the soybean sample to be tested is judged to have an inferior grain weight trait.

[0016] Preferably, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles; 72℃ extension for 5 min.

[0017] Preferably, the total volume of the PCR amplification reaction system is 20 μl, comprising the following components: 2 μl of 50 ng / μL template DNA, 10 μl of 2×EasyTaqPCR SuperMix for PAGE, 0.5 μl each of upstream and downstream primers, and 7 μl of sterile water.

[0018] Beneficial effects

[0019] This invention provides an Indel molecular marker associated with soybean grain weight trait. The nucleotide sequence of the Indel molecular marker is shown in SEQ ID NO:1; SEQ ID NO:1 contains 1-2 repeating sequences, the nucleotide sequences of which are shown in SEQ ID NO:2. The InDel molecular marker of this invention is located at 2644774 bp on chromosome 7 of the soybean reference genome (Glyma.Wm82.a2v1), and is associated with soybean grain weight trait. The Indel molecular marker divides the GmGA3ox1 gene into GmGA3ox1... Hap1 and GmGA3ox1 Hap2 Two main haplotypes, of which GmGA3ox1 Hap1 The sequence length of this type is 738 bp, exhibiting a dominant grain weight trait; GmGA3ox1 Hap2 The sequence length of this type is 798 bp, indicating a disadvantaged grain weight trait. The Indel molecular markers were used to identify the parents of Jiyu 508 × Zhongji 603 and the segregating progeny population. Combined with 100-grain weight phenotypic analysis, it was found that GmGA3ox1... Hap1 Haplotype soybean compared to GmGA3ox1 Hap2 The haplotype significantly increased the 100-seed weight of soybeans, indicating that the InDel molecular marker of this invention is significantly correlated with soybean seed weight. It can be used for marker-assisted selection breeding and progeny selection, significantly improving the selection efficiency of high-seed-weight materials.

[0020] This invention provides the application of the Indel molecular marker, the primer pair, or the kit in soybean breeding and / or germplasm resource identification. This invention used the Indel molecular marker to identify 207 cultivated soybean accessions, including varieties such as Fengdou 9, Heinong 26, PI614833, Xingkangxian 1, Suinong 14, Hefeng 40, Beidou 20, PI638511, Dongnong 4, Fengshou 10, Hongfeng 2, Heihe 3, Neidou 3, Heihe 52, Zhongzuo 90957, Nen'ao 08-1092, FC001, Haojiang 10-1270, Huinong 10-06, Heifu 10-221, and Zhonghuang 908. Combined with 100-seed weight phenotypic analysis, it was found that GmGA3ox1 was present in the 207 cultivated soybean accessions. Hap1 Haplotype soybean compared to GmGA3ox1 Hap2 The haplotype of soybean showed a significant increase in 100-seed weight, indicating that the Indel molecular marker provided by this invention can detect the seed weight advantage of soybean varieties, which is beneficial for the rapid screening of varieties with higher seed weight and larger seed size, and is of great significance for the breeding of high-yield and high-quality new varieties. Attached Figure Description

[0021] Figure 1QTL mapping of 100-grain weight for Jiyu 508 × Zhongji 603;

[0022] Figure 2 Map showing the differential loci of Jiyu 508 and Zhongji 603 in the GmGA3ox1 exon;

[0023] Figure 3 Electrophoresis results for identifying different haplotypes of GmGA3ox1 using the Indel molecular markers of this invention. A represents GmGA3ox1 (GmGA3ox1). Hap1 B is Zhongji 603 (GmGA3ox1) Hap2 H represents the heterozygous genotype;

[0024] Figure 4 The figure shows the comparative analysis results of the 100-seed weight of soybeans with different haplotypes of GmGA3ox1, where A represents Jiyu 508 (GmGA3ox1). Hap1 B is Zhongji 603 (GmGA3ox1) Hap2 ). Detailed Implementation

[0025] This invention provides an Indel molecular marker associated with soybean grain weight trait, the nucleotide sequence of which is shown in SEQ ID NO:1

[0026]

[0027]

[0028] As shown;

[0029] There are 1 to 2 repeating sequences in SEQ ID NO:1, and the nucleotide sequences of the repeating sequences are as shown in SEQ ID NO:2. TCAGCGGTTAGGCTTTCTGCGTCTATTAACGGTTTGTTTGA TATAAACGAGGATCAGAAT As shown in the figure.

[0030] Existing research indicates that GmGA3ox1 is the 3β-hydroxylase of soybean gibberellin (GA), a key enzyme in the soybean gibberellin biosynthesis pathway, and that GmGA3ox1 gene knockout plants have reduced seed weight per 100 seeds. This invention constructs mixed pools for large-seed and small-seed genes through a cross between Jiyu 580 and Zhongji 603, screens for polymorphic SSR loci between parents, and analyzes the large-seed and small-seed "gene pools" using the screened SSR markers. It was found that qsw7-1 on chromosome 7 is linked to 100-seed weight, including the cloned 100-seed weight gene GmGA3ox1 (see...). Figure 1 Sequencing of the coding regions of the Jiyu 508 and Zhongji 603 genes revealed an InDel variant at a position 1863 bp from the start codon (see...). Figure 2The InDel molecular marker of this invention was developed for this differential locus, located at 2644774 bp on chromosome 7 of the soybean reference genome (Glyma.Wm82.a2v1). This InDel molecular marker can classify the GmGA3ox1 gene into two main haplotypes: the wild-type GmGA3ox1... Hap1 There is one repetitive sequence SEQ ID NO:2, the nucleotide sequence of which is shown in the sequence listing SEQ ID NO:5 (GCCTCATGTTGGCTTCCCTTGGAATTACAAAGGAAGACACTAAATGGGC TGGGCCAAAAGGAGAATTCAATGGGGCTTGTGCGGCCTTGCACTTGAATTCTTACCCGAGTTGCCCGGATCCGGATCGAGCCATGGGTCTGGCCGCACACACCGACTCCACTCTCCTCACAATCCTACACCAAAACAATGTCAATGGGCTTCAAGTTCTCAAGGAAGGAGAAGGGTGGGTGGCAGTGCCGCCGCTTCACGGAGGGCTCGTGATTAACGTTGGCGA TCTGCTCCACATTTTGTCAAACGGGTTGTACCCGAGTGTGCTCCATCGGGTTTCGGGTGAACCGAACCCAACAGCGGTTCTCGGTTGCTTATCTATATGGGCCCCCAGCAAACGTCCAAATCAGTCCACATGTCAAGTTGGTGGGCCCAACAAGGCCCGCTCTTTATCGACCAGTGACTTGGAACGAGTACCTTGGCACCAAAGCAAACCTTTTTAATAAGGCTCTT TCAGCGGTTAGGCTTTCTGCGTCTATTAACGGTTTGT TTGATATAAACGAGGATCAGAAT The sequence shown is 738 bp in length, exhibiting a dominant grain weight trait; the mutant haplotype GmGA3ox1 of the GmGA3ox1 gene... Hap2A duplicate sequence SEQ ID NO:2, GmGA3ox1, was inserted at position 2644774 bp on chromosome 7 of the soybean reference genome Glyma.Wm82.a2.v1. Hap2 The nucleotide sequence is shown in the sequence listing SEQ ID NO:6

[0031]

[0032] As shown, the sequence length is 798 bp, which indicates a poor grain weight trait.

[0033] This invention provides a primer pair for amplifying the Indel molecular marker, comprising a forward primer with the nucleotide sequence shown in SEQ ID NO:3 (GCCTCATGTTGGCTTCCCTT) and a reverse primer with the nucleotide sequence shown in SEQ ID NO:4 (TTGAACCCCCACCTCAAACC). This invention does not impose any particular limitation on the source of the primer pair; primer pairs well-known in the art can be used. In this embodiment, the primer pair was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0034] This invention provides a kit for detecting soybean grain weight, including the primer pair.

[0035] In this invention, the kit preferably further includes DNA polymerase, buffer, and dNTPs. This invention does not have specific restrictions on the source of the DNA polymerase, buffer, and dNTPs. In this embodiment, a 2×EasyTaqPCRSuperMix forPAGE kit containing DNA polymerase, buffer, and dNTPs is used. The 2×EasyTaqPCRSuperMix forPAGE kit was purchased from Beijing TransGen Biotech Co., Ltd., catalog number AS112-11. The kit preferably also includes a Genomicon 508 amplification fragment standard and / or a Genomicon 603 amplification fragment standard. The Genomicon 508 amplification fragment standard comprises a DNA fragment of 738 bp in length, and the Genomicon 603 amplification fragment standard comprises a DNA fragment of 798 bp in length.

[0036] This invention provides an application of the Indel molecular marker, the primer pair, or the kit in detecting soybean grain weight advantage.

[0037] This invention provides a method for screening soybeans with grain weight advantage based on the Indel molecular marker, comprising the following steps:

[0038] Using the genomic DNA of the soybean sample to be tested as a template, PCR amplification was performed using the primer pair to obtain the PCR product;

[0039] The grain weight advantage of soybean samples is determined based on the fragment length of the PCR product: when the length of the PCR product is 738 bp, the soybean sample to be tested is judged to have an advantageous grain weight trait; when the length of the PCR product is 798 bp, the soybean sample to be tested is judged to have an inferior grain weight trait.

[0040] This invention uses the genomic DNA of the soybean sample to be tested as a template and performs PCR amplification using the primer pair to obtain PCR products.

[0041] In this invention, the preferred soybean varieties include any one of the following: Jiyu 508, Zhongji 603, Fengdou 9, Heinong 26, PI614833, Xingkangxian 1, Suinong 14, Hefeng 40, Beidou 20, PI638511, Dongnong 4, Fengshou 10, Hongfeng 2, PI567224, PI602897, Heihe 3, Neidou 3, Heihe 52, Zhongzuo 90957, Nen'ao 08-1092, FC001, Haojiang 10-1270, Huinong 10-06, Heifu 10-221, Heihe 22, Zhonghuang 908, Zhonghuang 907, Zhonghuang 903, Jiusan 09-25, Jiunong 33, Heinong 61, Heinong 44, Suifu 09-5016, Heinong 69. Heihe No. 4, Heihe No. 44, Heihe No. 35, Heihe No. 54, Heihe No. 29, Kenjiandou No. 25, Jiufeng No. 1, Heihe No. 45, Jiufeng No. 3, Heihe No. 5, Jiufeng No. 4, Beijiang No. 9 No. 1, Fengdou No. 24, Longken No. 306, Jiufeng No. 6, Jiufeng No. 5, Mengdou No. 39, Jiyu No. 701, Kenjiandou No. 26, Longken No. 330, Kendou No. 27, Hefeng No. 42, Longken No. 332 Fengshou 18, Mengdou 26, Kedou 23, Beidou 36, Fengshou 11, Dongnong 48, Zhonghuang 901, Fengshou 25, Beifeng 11, Baofeng 8, Longken 336, Fengshou 27, Canadian Protein Beans, Hefeng 30, Mengdou 33, Kennong 2, Kejiao 07-1, Huajiang 6155, Shi 10-94, Shundou 5, Dongnong 42, Mengdou 15, Dongnong 59, Heisheng 101, Ken 11-7155, Ken K11-7456, Sheng 168, Fengshou 12, Dongnong 4211, Kenfeng 17, Kenfeng 20, Heihe 38, Dengke 4, Kendou 30, Kenfeng 23, Suinong 34, Suinong 27, Suinong 26, Keshan 1, Kenfeng 22, Kenfeng 16, Heinong 55, Kejiao 09-95, Mengdou 13 No. 5, Dengke 5, Mengdou 14, Heihe 18, Huajiang 2, Mengdou 16, Nenfeng 16, Beidou 37, Heihe 55, Mengdou 30, Dengke 1, Beidou 19, Heinong 62, Heinong 64, Longpin 06-130, Nongda 75188, Fengdou 23, Suinong 30, Henong 60, Ken 07-5203, Kangxian 9, Kenjiandou 4, Jiyuan Yin 3, Suinong 4, Sui 08-5356, Hefeng 48, Yin Beian, 09-1126, Beijiang 08-280, 1438, 1358, Mengdou 12, Suinong 35, Mengdou 36, Beidou 18, Kangxian 5, He 08-1524, Beiguo 168, Beiguo 919, Heihe 36, Henong 55, Suinong 31, Mengdou 32, Heihe 34, Mengdou 37, PI592524, PI572245, Zhongzuo Yin 1, PI561858, PI567786, PI614831, PI587091, PI542403, PI615585, Heinong 16, PI548560, Dongnong 72-806, PI548534, PI548501PI548545, PI532467, Beihudou, Mengdou 19, Dongnong 44, PI602896, PI562372, PI548582, PI548607, Longda 10-73, Jiyu 702, Jiusan 09-4, Kenfeng 18, Kenjiandou 33, Suiwuxingdou 2, Suinong 32, Nongda 85213, Hehang 10-239, Heihe 56, Dongda No. 1, Fengshou 23, Mengdou No. 9, Beifeng 2, Heihe 51 The soybean varieties tested are: Mengdou 5, Longken 316, Kendou 59, Beifeng 16, Nenliang 7, Kendou 40, Longken 333, Fengshou 9, Dongsheng 7, Huajiang 4, Neidou 4, Heihe 49, Heihe 43, Heihe 53, Mengdou 28, Manguidou, 09-1230, Gan 248, 2488, 09-1120, Dengke 6 (2027), Sui 03-3068, Hujiao 282, 2465, Henong 65 (05-450), and He 05-729. The preferred types of soybean samples to be tested include at least one of the following: seeds, leaves, roots, and stems.

[0042] This invention does not impose any particular limitation on the method for extracting genomic DNA from the soybean sample to be tested; any plant genomic DNA extraction method well-known in the art can be used, such as the kit method. In this embodiment of the invention, DNA was extracted using the N96 novel plant genomic DNA extraction kit, purchased from Tiangen Biotech (Beijing) Co., Ltd., catalog number DP337.

[0043] In this invention, the preferred PCR amplification reaction program is: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles; 72℃ extension for 5 min. The total volume of the PCR amplification reaction system is preferably 20 μl, and preferably includes the following components: 2 μL of 50 ng / μL template DNA, 10 μL of 2×EasyTaq PCR SuperMix for PAGE, 0.5 μL each of forward and reverse primers, and 7 μL of sterile water.

[0044] After obtaining the PCR product, the present invention analyzes the length of the PCR product. The analysis is preferably performed using at least one of the following methods: 2% (w / w) agarose gel electrophoresis, 6%–10% (w / w) polyacrylamide gel electrophoresis, capillary electrophoresis, or sequencing. When using agarose gel electrophoresis or polyacrylamide gel electrophoresis, it is preferable to set up two control groups: the electrophoretic band of Jiyu 508 as a control for the dominant grain weight trait, and the electrophoretic band of Zhongji 603 as a control for the inferior grain weight trait. After electrophoresis, the grain weight dominance of the soybean sample is determined based on the fragment length of the PCR product: when the length of the PCR product is 738 bp, the soybean sample is determined to have a dominant grain weight trait; when the length of the PCR product is 798 bp, the soybean sample is determined to have an inferior grain weight trait.

[0045] Based on the close linkage between the Indel molecular marker and soybean grain weight trait, this invention provides the application of the Indel molecular marker, the primer pair, or the kit in soybean breeding and / or germplasm resource identification.

[0046] In this invention, the preferred method for soybean breeding and / or germplasm resource identification is to use the primer pair or the kit to perform PCR amplification on the DNA of soybean hybrid offspring and / or germplasm resources, analyze the length of the PCR product according to the above method, and screen soybean germplasm resources or hybrid offspring with grain weight advantage for breeding.

[0047] In one embodiment of the present invention, the Indel molecular marker was used to identify the parents of Jiyu 508 × Zhongji 603 and the segregating progeny population. Combined with 100-grain weight phenotypic analysis, it was found that Jiyu 508 is GmGA3ox1. Hap1 Haplotype, Zhongji 603 is GmGA3ox1 Hap2 Haplotype GmGA3ox1 in the parents and their segregating progeny groups Hap1 Haplotype soybean compared to GmGA3ox1 Hap2 The 100-seed weight of haploid soybeans was significantly increased (see...) Figure 4 As can be seen, the InDel molecular marker of this invention is highly correlated with soybean grain weight and can be used for marker-assisted selection breeding and progeny selection, significantly improving the selection efficiency of high grain weight materials.

[0048] In another embodiment of the present invention, the Indel molecular markers were used to identify 207 cultivated soybean accessions, including varieties such as Fengdou 9, Heinong 26, PI614833, Xingkangxian 1, Suinong 14, Hefeng 40, Beidou 20, PI638511, Dongnong 4, Fengshou 10, Hongfeng 2, Heihe 3, Neidou 3, Heihe 52, Zhongzuo 90957, Nen'ao 08-1092, FC001, Haojiang 10-1270, Huinong 10-06, Heifu 10-221, and Zhonghuang 908. Combined with 100-seed weight phenotypic analysis, it was found that some of the 207 cultivated soybean accessions contained GmGA3ox1. Hap1 Haploid soybean varieties have a 100-seed weight lower than GmGA3ox1 Hap2 Haploid soybean varieties may be affected because soybean grain weight is a quantitative trait controlled by multiple genes; additionally, variety and environmental conditions also influence grain weight. In the group, GmGA3ox1... Hap1 Haplotype soybean compared to GmGA3ox1 Hap2 The haplotype of soybean showed a significant increase in 100-seed weight, indicating that the Indel molecular marker provided by this invention can detect the seed weight advantage of soybean varieties, providing a theoretical basis for molecular-assisted breeding of soybeans and having important significance for cultivating high-yield and high-quality new varieties.

[0049] Example 1

[0050] InDel molecular marker development

[0051] A population of 217 families was constructed by comparing Jiyu 508 × Zhongji 603 F2. Using the BSA method, 20 extremely large-grained families were selected to construct a large-grained gene pool, and 20 extremely small-grained families were selected to construct a small-grained gene pool. Genomic DNA from the parents, Jiyu 508 and Zhongji 603, was amplified using 807 pairs of SSR primers. A total of 326 polymorphic SSR loci were identified between the parents, accounting for 40.4% of the total SSR markers screened. Analysis of the large-grained and small-grained gene pools using the selected SSR markers revealed linkage between qsw7-1 and 100-grain weight on chromosome 7, including the cloned 100-grain weight gene GmGA3ox1 (see...). Figure 1 Sequencing of the coding regions of the Jiyu 508 and Zhongji 603 genes revealed an InDel variant at a position 1863 bp from the start codon (see...). Figure 2 ), and divide it into GmGA3ox1 Hap1 and GmGA3ox1 Hap2 The two main haplotypes, Jiyu 508, are GmGA3ox1. Hap1 Haplotype, Zhongji 603 is GmGA3ox1 Hap2 Haplotype, GmGA3ox1 Hap1The nucleotide sequence is shown in SEQ ID NO:5 of the sequence listing, with a sequence length of 738 bp, GmGA3ox1 Hap2 The nucleotide sequence is shown in SEQ ID NO:6 of the sequence listing, and the sequence length is 798 bp.

[0052] InDel molecular markers were developed for differential sites. The InDel molecular markers are located at 2644774 bp on chromosome 7 of the soybean reference genome (Glyma.Wm82.a2v1).

[0053] The soybean reference genome sequences, located 500 bp upstream and downstream of the InDel location, were obtained from the phytozome website. Primers were designed using Primer5 software, and the primer sequences designed for this InDel location are as follows:

[0054] F: 5'-GCCTCATGTTGGCTTCCCTT-3' (SEQ ID NO: 3);

[0055] R: 5'-TTGAACCCCCACCTCAAACC-3' (SEQ ID NO: 4).

[0056] Example 2

[0057] Using the primer pairs from Example 1, the genotypes of the two parents and 217 families in the Jiyu 508 × Zhongji 603 population were detected. The detection method was as follows:

[0058] (1) Extract genomic DNA from the soybeans to be tested;

[0059] (2) Use the above primers to perform PCR amplification on soybean genomic DNA to obtain PCR amplification products;

[0060] (3) Sequencing the PCR amplification products to detect the genotype of the InDel site.

[0061] (4) The PCR amplification program is as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles, and finally 72℃ extension for 5 min, and stored at 4℃.

[0062] (5) The PCR reaction system is 20 μL, including 10.0 μL of 2×EasyTaqPCR SuperMix for PAGE, 0.5 μL of each primer (10 μmol / L), 2.0 μL of DNA (50 ng / μL), and 7.0 μL of sterile water.

[0063] (6) The PCR amplification products were electrophoresed on a 2% agarose gel at 120V for 68 min. Images were taken using a gel imaging system. The electrophoresis results are shown in […]. Figure 3 .

[0064] Based on the genotyping results of the parents Jiyu 508 × Zhongji 603 and the segregating offspring population ( Figure 3 Phenotypic analysis of 100 grains revealed that in the parental strain, the PCR product of Jiyu 508 showed a single band at 738 bp, and the amplified product was shown in SEQ ID NO:5, namely GmGA3ox1. Hap1 The haplotype is characterized by high grain weight; the PCR product of Zhongji 603 shows a single band at 798 bp, and the amplified product is shown in SEQ ID NO:6, which is GmGA3ox1. Hap2 The haplotype was characterized by low grain weight; some PCR products of the progeny population were identical to Jiyu 508, and some were identical to Zhongji 603. Furthermore, the proportion of grain weight per 100 grains in the lines with the large grain allele (identical to Jiyu 508) was significantly increased compared to the proportion of grain weight per 100 grains in the lines with the small grain allele (identical to Zhongji 603) (see...). Figure 4 Furthermore, the electrophoretic bands were clear and showed significant differences. It is evident that the InDel molecular marker developed in this invention can accurately identify progeny genotypes, and the InDel molecular marker of this invention is highly significantly correlated with soybean grain weight. It can be used for marker-assisted selection breeding and progeny selection, significantly improving the selection efficiency of high-grain-weight materials, and providing a new, most economical and effective molecular breeding approach for further improving soybean grain size and weight.

[0065] Example 3

[0066] Application of InDel molecular markers in soybean germplasm identification

[0067] The genotypes of 207 cultivated soybeans were identified using the primer pairs and detection methods described in Example 1.

[0068] After identification ( Figure 3 Of the 207 cultivated soybean samples, 140 were similar to Jiyu 508 (GmGA3ox1). Hap1 The genotype is consistent with that of the Zhongji 603 gene, and the amplification product is shown in SEQ ID NO:5; 67 samples are consistent with the Zhongji 603 genotype (GmGA3ox1). Hap2 The amplified product was SEQ ID NO:6. The 100-grain weight ratio of the line with the large grain allele consistent with Jiyu 508 was significantly increased compared with the 100-grain weight ratio of the line with the small grain allele consistent with Zhongji 603. The 100-grain weight phenotype of the two groups of materials was compared by T-test, and the difference was extremely significant (P=4.78908E-09) (see Table 1). It can be seen that the Indel molecular marker provided by the present invention can detect the grain weight advantage of soybean varieties.

[0069] Table 1. Soybean germplasm genotyping results

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. Other embodiments can be obtained based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of an Indel molecular marker, primer pair, or kit containing said primer pair in soybean grain weight breeding and / or germplasm resource identification; The nucleotide sequence of the Indel molecular marker is shown in SEQ ID NO:1, and there are 1 to 2 repeating sequences in SEQ ID NO:1, the nucleotide sequence of the repeating sequences is shown in SEQ ID NO:2; The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

4.

2. The application of an Indel molecular marker, primer pair, or kit containing said primer pair in detecting soybean grain weight dominance; The nucleotide sequence of the Indel molecular marker is shown in SEQ ID NO:1, and there are 1 to 2 repeating sequences in SEQ ID NO:1, the nucleotide sequence of the repeating sequences is shown in SEQ ID NO:2; The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

4.

3. The application according to claim 1 or 2, characterized in that, The kit also includes DNA polymerase, buffer, and dNTPs.

4. A method for screening soybeans with a grain weight advantage, characterized in that, Includes the following steps: Using the genomic DNA of the soybean sample to be tested as a template, PCR amplification was performed using primer pairs to obtain PCR products; the primer pairs include a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:4; The grain weight advantage of soybean samples was determined based on the fragment length of the PCR product. When the length of the PCR product is 738 bp, the soybean sample to be tested is judged to have a dominant grain weight trait; when the length of the PCR product is 798 bp, the soybean sample to be tested is judged to have a disadvantageous grain weight trait.

5. The method according to claim 4, characterized in that, The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles; 72℃ extension for 5 min.

6. The method according to claim 4 or 5, characterized in that, The total volume of the PCR amplification reaction system is 20 μl, including the following components: 2 μL of 50 ng / μL template DNA, 10 µL of 2×EasyTaq PCR SuperMix for PAGE, 0.5 μL each of forward and reverse primers, and 7 μL of sterile water.

Images