A SNP site combination related to soybean hundred-grain weight, a KASP molecular marker combination and application thereof

Abstract

The application discloses a SNP site combination related to soybean hundred-grain weight, a KASP molecular marker combination and application thereof, relates to the technical field of molecular assisted breeding, and provides a SNP site combination closely related to soybean hundred-grain weight and a corresponding KASP molecular marker combination, which can accurately identify the hundred-grain weight trait of soybean. The achievement not only lays a theoretical foundation for the directional selection breeding of soybean hundred-grain weight, but also provides an important basis for accelerating the application of molecular markers in breeding practice. The KASP marker provided by the application can help scientifically screen soybean germplasm resources with different hundred-grain weight characteristics, efficiently carry out soybean molecular breeding work, significantly improve the cultivation efficiency of soybean varieties with target hundred-grain weight, and provide strong technical support for soybean high-yield and high-quality breeding.

Description

Technical Field

[0001] This invention relates to the field of molecular-assisted breeding technology, and in particular to a combination of SNP sites and KASP molecular markers related to the 100-seed weight of soybeans and their applications. Background Technology

[0002] As an important oilseed and feed crop, soybean yield formation and quality improvement have always been core research directions in the field of soybean genetics and breeding. Seed size is a key agronomic trait affecting soybean yield, and 100-seed weight, as a core indicator for measuring seed size, is not only directly related to the yield per soybean plant, but also closely related to seed plumpness and commercial value, making it an important selection factor in high-yield soybean breeding.

[0003] Traditional breeding relies primarily on phenotypic selection to improve traits, but it suffers from inherent drawbacks such as lengthy breeding cycles, high manual workload, and limited selection precision. In contrast, molecular-assisted selection (MAG) breeding technology enables targeted tracking and precise editing of target genes. When combined with conventional breeding techniques, it can significantly improve breeding efficiency and demonstrates enormous application potential.

[0004] Therefore, identifying key sites regulating soybean 100-seed weight and developing molecular markers with breeding applications are core prerequisites for providing theoretical support and technical assurance for high-yield soybean breeding. Thus, developing KASP molecular markers and applying them to the joint identification and assisted selection of soybean 100-seed weight traits, thereby contributing to the progress of high-yield soybean breeding, has become a critical issue urgently needing to be addressed by those skilled in the art. Summary of the Invention

[0005] The purpose of this invention is to provide a combination of SNP sites and KASP molecular markers related to soybean 100-seed weight, and their applications, to solve the problems existing in the prior art. This combination of SNP sites or KASP molecular markers can accurately identify the 100-seed weight trait in soybeans, providing strong technical support for high-yield and high-quality soybean breeding.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a combination of SNP sites associated with 100-seed weight of soybean, including the following SNP sites located in the soybean reference genome Glycine max Wm82.a2.v1:

[0008]

[0009] The present invention also provides a KASP molecular marker combination related to the 100-seed weight of soybeans, including KASP molecular markers with nucleotide sequences as shown in SEQ ID NO.1-5.

[0010] The present invention also provides a KASP primer combination for identifying the 100-seed weight trait of soybeans, comprising KASP primers with nucleotide sequences as shown in SEQ ID NO.6-20.

[0011] The present invention also provides the application of the above-mentioned KASP primer combination in the preparation of a detection product for identifying the 100-seed weight trait of soybeans.

[0012] Furthermore, the product is a reagent kit.

[0013] The present invention also provides a detection product for identifying the 100-seed weight trait of soybeans, comprising the above-mentioned KASP primer combination.

[0014] Furthermore, the product is a reagent kit.

[0015] The present invention also provides the application of the above-mentioned SNP site combination or KASP molecular marker combination in identifying the 100-seed weight trait of soybean.

[0016] The present invention also provides the application of the above-mentioned KASP primer combination or detection product in identifying the 100-seed weight trait of soybean.

[0017] This invention also provides a method for identifying the 100-seed weight trait of soybeans, comprising the following steps:

[0018] Genomic DNA was extracted from the soybean sample to be tested;

[0019] Using the genomic DNA as a template, KASP amplification was performed using the above-mentioned KASP primer combination. Based on the detection results, the 100-seed weight of soybeans with the TT / GG / GG / CC / CC genotype and the CC / AA / AA / CC / CC genotype was higher than that of the CC / GG / AA / TT / TT genotype.

[0020] The present invention discloses the following technical effects:

[0021] This invention provides a combination of SNP sites closely associated with soybean 100-seed weight and a corresponding combination of KASP molecular markers, enabling precise identification of the soybean 100-seed weight trait. This achievement not only lays a theoretical foundation for soybean 100-seed weight redirection selection breeding but also provides important evidence for accelerating the application of molecular markers in breeding practice. The KASP markers provided by this invention can assist in the scientific screening of soybean germplasm resources with different 100-seed weight characteristics, efficiently carry out soybean molecular breeding work, significantly improve the breeding efficiency of soybean varieties with target 100-seed weights, and provide strong technical support for high-yield and high-quality soybean breeding. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 Genotyping diagram of KASP molecular markers at the SNP1 site in natural population materials;

[0024] Figure 2 Genotyping diagram of KASP molecular markers at SNP2 loci in natural population materials;

[0025] Figure 3 Genotyping diagram of KASP molecular markers at SNP3 loci in natural population materials;

[0026] Figure 4 Genotyping diagram of KASP molecular markers at SNP4 locus in natural population materials;

[0027] Figure 5 Genotyping diagram of KASP molecular markers at SNP5 locus in natural population materials;

[0028] Figure 6 Figure showing the association between KASP molecular marker genotyping results and phenotypes in natural population materials. Detailed Implementation

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0032] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0033] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0034] Example 1

[0035] This invention screened and obtained 5 SNP sites related to the 100-seed weight of soybean, which are located in the soybean reference genome Glycine max Wm82.a2.v1, as shown in Table 1.

[0036] Table 1. SNP sites associated with 100-seed weight of soybean

[0037]

[0038] Based on the above SNP sites, KASP molecular markers and primers for KASP detection were developed. The primer sequences are detailed in Table 2, and the KASP molecular markers are as follows:

[0039] KASP molecular marker 1 (SEQ ID NO.1):

[0040] ATTTTAGTAAACAAGAGAGTAAACTCACATTAAATGGTAGTTCTGGTTTGYGTATGTGGAAAGGGGCAACAATTGAGCCTATTACAGTGTCTTCTGGATTC; Y is C or T.

[0041] KASP molecular marker 2 (SEQ ID NO.2):

[0042] GAAAGAGTCCAAGGCAGGTGAGTCATCTGGAGAAATGGAACTGTTGACATRTTCAGCAACACCAGAATTTGTAGATATAGATCTTGCTTTCGTTGTAAGAG; R is G or A.

[0043] KASP molecular marker 3 (SEQ ID NO.3):

[0044] TCCTAACACTGGAAACTTTGCTGTTGATGAACGAGAAATTCCTCCCCTTCRGAAGAATTCATCTTGTCCATTCTCAGATGATGCTGATCCTGAACTTGCCATA; R is G or A.

[0045] KASP molecular marker 4 (SEQ ID NO.4):

[0046] TACATACAAGCCACAATTCCCATTTGGTGGATGTTCATTTGAAGAATGGCYGACCCTTTTGGAGTGATCAATTCTCTGTACTTGTTCAACATGACCCTTTT; Y is C or T.

[0047] KASP molecular marker 5 (SEQ ID NO.5):

[0048] GTCCATATTTGTGTCTTGTTACCAATGCATTTCCATATTGACTTTGATGGYTGTCATTCTCATGGATCATGTTTTTTGATGCATCAAATCTGTTAATATAA; Y is C or T.

[0049] Table 2 KASP primer sequences

[0050]

[0051] Note: F1 and R1 are labeled with FAM fluorescent groups, and F2 and R2 are labeled with HEX fluorescent groups.

[0052] Example 2

[0053] The weight of 100 grains in the natural population materials (Table 3) was determined, and genotyping was performed using the KASP molecular marker designed in Example 1.

[0054] 1. Method for testing 100-seed weight: After the seeds are fully mature, harvest the seeds, randomly select 20 representative seeds from each strain, weigh them, and calculate the weight of 100 seeds.

[0055] 2. Genotyping methods:

[0056] (1) DNA extraction

[0057] Genomic DNA was extracted from natural populations using the CTAB method. The specific steps are as follows:

[0058] Take a piece of leaf and put it into a 2 mL centrifuge tube, and add a steel ball to each tube.

[0059] The centrifuge tube containing the sample and steel balls was quickly immersed in liquid nitrogen for freezing and then thoroughly broken up.

[0060] Add 600 μL of CTAB extraction buffer (which has been pre-added with 2% (v / v) β-mercaptoethanol) to each of the crushed samples, shake vigorously to mix the sample and buffer thoroughly, and incubate the resulting mixture in a 65°C water bath for 60 min.

[0061] Add 5 μL (10 mg / μL) of RNase A solution to the mixture after water bath and mix well;

[0062] The mixture was placed in a 37°C water bath for 30 min to degrade the RNA.

[0063] Add 600 μL of phenol:chloroform mixture (volume ratio 25:24) to the mixture for extraction and shake thoroughly to mix.

[0064] Centrifuge the mixture at 12000 rpm for 10 min, carefully transfer 400 μL of the supernatant to a new 2 mL centrifuge tube, add 600 μL of isopropanol, gently invert the centrifuge tube several times to mix, centrifuge at 12000 rpm for 10 min, and discard the supernatant.

[0065] Add 500 μL of 70% (v / v) ethanol to the centrifuge tube containing the DNA precipitate, shake well to suspend the DNA precipitate, remove the supernatant, and wash twice.

[0066] Finally, remove any remaining liquid, air-dry the DNA precipitate, and add 100 μL of ultrapure water to the dried DNA precipitate to dissolve it completely. Store the dissolved genomic DNA solution at -20°C for later use.

[0067] (2) Genotyping

[0068] Using genomic DNA as a template, PCR amplification was performed using the KASP primers shown in Table 2.

[0069] Reaction system: 5 μL 2×Master Mix, 0.14 μL KASP primers, 20-30 ng template, and sterile water to a final volume of 10 μL.

[0070] Reaction program: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61℃-55℃, decreasing by 0.6℃ per cycle, annealing extension for 40 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing extension for 40 s, 30 cycles.

[0071] PCR amplification was performed on an ABI QuantStudio 7 Pro, using FAM and HEX as reporter fluorescence and ROX as reference fluorescence. After reading the fluorescence signals on the ABI QuantStudio 7 Pro, the KASP detection results were interpreted. The KASP detection results are shown below. Figures 1-5 And Table 3.

[0072] Table 3. KASP molecular marker genotyping results of natural population materials

[0073]

[0074] The KASP molecular marker genotyping results and phenotypic association validation results of natural population materials are attached. Figure 6 As shown, the average grain weight of the high-grain-weight material in the natural population was 22.17 g, belonging to haplotype Hap1 (homozygous TT / GG / GG / CC / CC genotype); the average grain weight of the medium-grain-weight material in the natural population was 20.16 g, belonging to haplotype Hap2 (homozygous CC / AA / AA / CC / CC genotype); and the average grain weight of the low-grain-weight material in the natural population was 10.61 g, belonging to haplotype Hap3 (homozygous CC / GG / AA / TT / TT genotype).

[0075] The test results showed that the 100-seed weight of soybeans with homozygous TT / GG / GG / CC / CC genotype and CC / AA / AA / CC / CC genotype was significantly higher than that of soybeans with CC / GG / AA / TT / TT genotype.

[0076] In summary, the KASP molecular marker developed in this invention can detect different genotypes of materials with different 100-grain weights in natural populations, further clarifying that this molecular marker can be used for molecular-assisted selection breeding of soybean materials with different 100-grain weights.

[0077] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A combination of KASP molecular markers associated with soybean hundred kernel weight, characterized in that, This includes KASP molecular markers with nucleotide sequences such as SEQ ID NO.1-5.

2. A KASP primer combination for discriminating soybean seed weight traits, characterized in that, This includes KASP primers with nucleotide sequences as shown in SEQ ID NO. 6-20.

3. The application of the KASP primer combination as described in claim 2 in the preparation of a detection product for identifying the 100-seed weight trait of soybeans.

4. Use according to claim 3, characterized in that, The product in question is a reagent kit.

5. An assay product for identifying soybean seed count traits, comprising, Includes the KASP primer combination as described in claim 2.

6. The testing product according to claim 5, characterized in that, The product in question is a reagent kit.

7. The application of a combination of SNP sites or the KASP molecular marker combination as described in claim 1 in identifying the 100-seed weight trait of soybean, characterized in that, The SNP locus combination includes the following SNP loci located in the soybean reference genome Glycine maxWm82.a2.v1: 。 8. The application of a KASP primer combination as described in claim 2 or the detection product as described in claim 5 or 6 in identifying the 100-seed weight trait of soybeans.

9. A method for identifying the 100-seed weight trait of soybeans, characterized in that, Includes the following steps: Genomic DNA was extracted from the soybean sample to be tested; Using the genomic DNA as a template, KASP amplification was performed using the KASP primer combination described in claim 2. Based on the detection results, the 100-seed weight of soybeans with the TT / GG / GG / CC / CC genotype and the CC / AA / AA / CC / CC genotype was higher than that of the CC / GG / AA / TT / TT genotype.

Images