Wheat thousand grain weight major SNP and molecular marker, detection method and application thereof

Abstract

The invention discloses a wheat thousand grain weight major SNP (single nucleotide polymorphism) and a molecular marker, a detection method and application thereof, an SNP site corresponds to a 1921th basic group from 5'terminal of a sequence shown as SEQ ID NO.1, and when the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; the thousand seed weight of the wheat with the homozygous genotype B is greater than or candidate to be greater than that of the wheat with the homozygous genotype A. The SNP has high effectiveness and potential application value, wheat with high thousand seed weight can be found by detecting the SNP, and the SNP has important value in research or application of cultivation of high-yield wheat varieties.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to molecular markers based on newly discovered and validated major SNPs related to thousand-grain weight in wheat, their detection methods, and their applications. Background Technology

[0002] Wheat (Triticum aestivum L.) is one of the world's most important crops, and also the most consumed and produced crop globally. In my country, wheat is the second largest grain crop after rice. Wheat yield is composed of the number of spikes per unit area, the number of grains per spike, and the thousand-grain weight. Among these, the increase in thousand-grain weight has been the most significant factor contributing to the increase in wheat yield over the past 60 years, and thousand-grain weight is closely related to yield traits. Thousand-grain weight is a crucial factor in wheat yield and an important indicator for determining wheat variety yield; therefore, improving wheat thousand-grain weight is vital for wheat breeding. Thus, exploring superior allelic variations in thousand-grain weight and developing functional markers has significant theoretical guidance and practical application value for breeding high-yielding wheat varieties.

[0003] Currently, numerous QTLs regulating thousand-grain weight have been identified in studies. Wang used 142 F9:10 recombinant inbred lines (RILs) of Heshangmai / Yu8679 and their parents as experimental materials, detecting a total of 35 QTLs, which explained 4.36%–16.80% of the phenotypic variation. These QTLs were found on wheat chromosomes 1A, 1B, 2A, 2D, 3A, 3B, 4A, 4D, 5A, 5B, 6D, and 7D. In particular, QTLs on chromosomes 1B, 2A, and 3B were stably expressed under various conditions, laying the foundation for fine mapping of thousand-grain weight QTLs and marker-assisted selection. Li detected 18 unconditional QTLs for thousand-grain weight and grain shape, located on chromosomes 1B, 1D, 3B, 4B, 5A, 5B, 6A, 6B, and 6D. Among them, QTKW4B.4-14, located in the chromosomal interval RAC875_611-EX_C1_705, was detectable in all environments and explained 26.52%-39.07% of the phenotypic variation. Wang et al. obtained F9 recombinant inbred lines through 01-35×6044 hybridization and detected 13 QTLs for wheat grain filling rate and thousand-grain weight. Most of these QTLs were located on chromosome 2A, and some were located on chromosomes 6A, 5A, and 4A, including two thousand-grain weight QTLs. Zhang et al. used a spring wheat Avocet / Sujata recombinant inbred line population and detected 20 QTLs, one of which (QTkw-5A.1 / QKl-5A) also controlled grain length among the thousand-grain weight-related QTLs.

[0004] Despite the large number of QTLs associated with wheat thousand-grain weight that have been identified, most of these QTLs have a small phenotypic contribution and poor repeatability across different years and environments, making them difficult to apply to the genetic improvement of wheat thousand-grain weight. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide major SNPs of wheat thousand-grain weight, their molecular markers, detection methods and applications.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0007] In a first aspect, the present invention includes a method for developing SNP loci, which involves data processing of genetic variations of specific genes in a natural wheat variant population to obtain relevant SNP locus information, and verifying that different genotypes at the obtained SNP loci correspond to significant phenotypic differences; the significant phenotypic differences are specifically significant differences in the thousand-grain weight trait of wheat; the developed SNP locus corresponds to the 1921st base from the 5' end of the sequence shown in SEQ ID NO.1, and when this locus is T / T homozygous, the corresponding genotype is A; when this locus is C / C homozygous, the corresponding genotype is B; the thousand-grain weight is: wheat homozygous for genotype B is greater than or candidate to be greater than wheat homozygous for genotype A.

[0008] On the other hand, the present invention also includes a primer combination, specifically comprising primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the following SNP sites: the SNP site corresponds to the 1921st base from the 5' end of the sequence shown in SEQ ID NO.1, when this site is T / T homozygous, the corresponding genotype is A; when this site is C / C homozygous, the corresponding genotype is B; the thousand-grain weight is: wheat homozygous for genotype B is greater than or candidate greater than wheat homozygous for genotype A.

[0009] On the other hand, the present invention also includes a gene detection kit for the SNP site, wherein the gene detection kit contains a PCR amplification specific primer combination and enzyme digestion component corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0010] As a preferred embodiment of the present invention, the target DNA fragment for PCR amplification in the gene detection kit is designed to be the 5' end 1593-2337bp in SEQ ID NO.1.

[0011] As a preferred embodiment of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0012] As a preferred embodiment of the present invention, the enzyme digestion component is the restriction endonuclease NdeI.

[0013] On the other hand, the present invention also includes a method for identifying or assisting in the identification of wheat thousand-grain weight in the early stage of breeding. Based on the SNP site, in the early stage of molecular marker-assisted selection breeding, primers are designed to amplify any DNA fragment containing the SNP site in the genomic DNA of the wheat to be tested by PCR. The wheat genotype is identified by enzyme digestion of the PCR amplification product. The wheat thousand-grain weight phenotype is identified or assisted in the identification based on the following correlation between genotype and phenotype: the thousand-grain weight of wheat homozygous for genotype B is greater than or can be greater than that of wheat homozygous for genotype A.

[0014] As a preferred embodiment of the present invention, the DNA fragment amplified by PCR is the 5' end 1593-2337bp of SEQ ID NO.1; the specific primer pair for PCR amplification is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the restriction endonuclease NdeI is used for enzyme digestion.

[0015] As a preferred embodiment of the present invention, the enzyme digestion includes the following steps: using wheat genomic DNA as a template, amplifying with primers 1F and 1R to obtain a PCR product; diluting this PCR product 100 times, using it as a template, amplifying with primers 2F and 2R to obtain a PCR product; digesting the PCR product with the restriction endonuclease NdeI; if the PCR product can be cleaved, the nucleotide polymorphism site is T / T, and the genotype is A; if the PCR product cannot be cleaved, the nucleotide polymorphism site is C / C, and the genotype is B; the thousand-grain weight of wheat homozygous for genotype B is greater than or candidate to be greater than that of wheat homozygous for genotype A.

[0016] On the other hand, the present invention also includes the use of the above-mentioned wheat SNP sites, primer combinations, and gene detection kits, wherein the use is to screen or assist in screening the thousand-grain weight phenotype of wheat in the early stage of molecular marker-assisted selection breeding.

[0017] As a preferred embodiment of the present invention, the application further includes: theoretical research on the developmental principle of wheat thousand-grain weight based on the SNP site, and / or research on the molecular regulatory pathway of wheat thousand-grain weight development based on the SNP site; including: based on the SNP site, identifying, characterizing and / or distinguishing downstream related effector molecules through genotypic differences, and constructing a molecular regulatory pathway for wheat thousand-grain weight; the effector molecules include, but are not limited to, messenger RNA, proteins, associated biological enzymes, various molecular regulatory components, and various molecular signaling components; further, based on the construction of the molecular regulatory pathway for wheat thousand-grain weight, identifying and confirming major or key regulatory nodes and their corresponding biomolecules or small molecule components; the application also includes regulating wheat thousand-grain weight in the agricultural industry according to production needs based on the SNP site, specifically including: increasing wheat thousand-grain weight based on genotype B and decreasing wheat thousand-grain weight based on genotype; potential application scenarios for increasing wheat thousand-grain weight are: improving wheat quality, with high-quality wheat used in high-end food manufacturing or high-end beverage brewing; potential application scenarios for decreasing wheat thousand-grain weight are: increasing total wheat yield, with high-yield wheat used in livestock feed industry.

[0018] The beneficial effects of adopting the above technical solution are as follows: The research team of this invention, through genetic variation analysis of natural wheat variant populations, discovered a SNP corresponding to position 1921 from the 5' end of sequence listing 1. This SNP has two genotypes: genotype A (T) and genotype B (C). Association analysis showed that among the homozygous types of these two genotypes, the thousand-grain weight is: wheat homozygous for genotype B > wheat homozygous for genotype A. This invention also provides a dCAPS marker for detecting the aforementioned SNP. Experiments have shown that by detecting this SNP, wheat with a higher thousand-grain weight can be identified. This invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yielding wheat varieties or in research. The SNP site developed in this invention not only expands the genetic resource tools for wheat, but also has good and broad application potential verified by our scientific research experiments and data statistics. Attached Figure Description

[0019] Figure 1 It is a schematic diagram of gene structure and a schematic diagram of SNP sites;

[0020] Figure 2 The electrophoretic detection results of the SNP-developed dCAPS-labeled enzyme digestion products of this invention are shown below; where M is the molecular weight standard; lane C is the band that cannot be cleaved by NdeI, and lane T is the band that is cleaved by NdeI.

[0021] Figure 3 This is a schematic diagram of the thousand-grain weight correlation analysis;

[0022] Figure 4 This is a schematic diagram of gene SNP sites and genotypes in 385 wheat population materials. Detailed Implementation

[0023] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that, as used in this specification and appended claims, the term "comprising" indicates the presence of the described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that the term "and / or" as used in this specification and appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0024] As used in this specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrases "if determined" or "if [the described condition or event] is detected" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once [the described condition or event]," or "in response to detection." Furthermore, in the description of this specification and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" described in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in yet other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms “including,” “comprising,” “having,” and variations thereof all mean “including but not limited to,” unless otherwise specifically emphasized.

[0025] Example 1: Detection of SNP sites and PCR-enzyme digestion polymorphisms related to wheat thousand-grain weight

[0026] 1. Specific primers and sequence analysis for amplifying the genomic fragment containing this wheat SNP.

[0027] like Figure 1As shown, a single SNP was found in the gene coding region of the wheat genome, corresponding to position 1921 from the 5' end of SEQ ID NO. 1 in the sequence listing. By designing dCAPS markers for this SNP site, two genotypes were found at this site in the naturally occurring wheat population:

[0028] Genotype A: T (TT homozygous marker is type I or type III)

[0029] Genotype B: C (CC homozygous marker is type II)

[0030] Based on the sequence differences in different wheat genomes, specific primers were designed for PCR amplification of DNA fragments containing the SNP site:

[0031] F1: GTGTGATCTTTTCATCGTTTTGGCCCT (SEQ ID NO.2)

[0032] R1: AGATTCAGGATCAAACTGCATGTGGT (SEQ ID NO.3)

[0033] F2: GTGATTGATTACTGCACTCATA (SEQ ID NO.4)

[0034] R2: CTTAAGCAAATACATCATATAACCTC (SEQ ID NO.5)

[0035] The target sequences for PCR amplification using primer pairs F1 and R1 are shown in Sequence 1 of the sequence listing, positions 1593-2337; the target sequences for PCR amplification using primer pairs F2 and R2 are shown in Sequence 1 of the sequence listing, positions 1899-2032. Enzyme digestion analysis showed that this polymorphism could be recognized by NdeI.

[0036] 2. Establishment of PCR-restriction polymorphism detection and genotyping methods

[0037] 1) Extract genomic DNA from the wheat to be tested;

[0038] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (10 μL) consists of: ddH2O μL, 10×PCR Buffer 1 μL, primer F1 (5 μmol / L) and primer R1 (5 μmol / L) 0.3 μL each, dNTP (2.5 μmol / L) 0.6 μL, Taq enzyme 0.1 μL, and template (20 ng / μL) 0.5 μL.

[0039] PCR amplification conditions were: 94℃ for 4 min; 94℃ for 30 s, 56℃ for 30 s, 72℃ for 30 s, for 32 cycles; 72℃ for 10 min; and storage at 16℃.

[0040] 3) Dilute the PCR product from step 2) 100 times and use it as a template for PCR amplification with primers F2 and R2. The PCR amplification system (10 μL) consists of: ddH2O μL, 10×PCR Buffer 1 μL, primer F2 (5 μmol / L) and primer R2 (5 μmol / L) 0.3 μL each, dNTP (2.5 μmol / L) 0.6 μL, Taq enzyme 0.1 μL, and template (20 ng / μL) 0.5 μL.

[0041] PCR amplification conditions were: 94℃ for 4 min; 94℃ for 30 s, 56℃ for 30 s, 72℃ for 10 s, for 32 cycles; 72℃ for 10 min, and stored at 16℃.

[0042] 4) Digest the PCR product obtained in step 3) with NdeI enzyme to obtain the digested product. Perform 4% agarose gel electrophoresis to detect whether the PCR product was digested into two fragments. Determine and record the status of the wheat sample at the specified sites according to the following method:

[0043] If the enzyme digestion product is a large fragment, then the wheat being tested is homozygous for C at the specified site (represented as C / C). Figure 2 Lane C in the middle of the swimming lane).

[0044] If the enzyme digestion product is a small fragment, then the wheat being tested is T homozygous at the specified site (represented as T / T). Figure 2 Lane T in the swimming lane.

[0045] Based on the results of step 4), wheat is classified into two types at the stated site: I, II, and III.

[0046] I:T / T (i.e., homozygous genotype A);

[0047] II: C / C (i.e., homozygous genotype B);

[0048] III: T / T (i.e., homozygous genotype A)

[0049] The part before the " / " represents the case on one homologous chromosome, and the part after the " / " represents the case on another homologous chromosome.

[0050] 3. Genotyping of natural populations using dCAPs markers and association analysis with thousand-grain weight trait.

[0051] Each wheat variety in a natural population consisting of 320 hexaploid wheat samples was used as a test wheat variety. Genotyping was performed according to the method in step 2. The amplification products of a random sample of wheat varieties were sequenced for verification. The results are shown in Table 1.

[0052] Table 1. Information on the polymorphic sites described in natural wheat populations.

[0053]

[0054]

[0055]

[0056]

[0057]

[0058] Example 2: Association Analysis of Gene Polymorphism Sites and Thousand-Grain Weight in Natural Populations

[0059] The technical team of this invention conducted exon capture sequencing on 385 materials and performed specific genotyping on these materials. Genotyping included two cases: homozygous T / T genotype A and homozygous C / C genotype B. For example... Figure 4 Of the 385 materials, 266 materials could be clearly distinguished as homozygous T / T genotype A or homozygous C / C genotype B, while the remaining 119 materials could not be genotyped.

[0060] Furthermore, of these 385 materials, 320 had agronomic trait data from multiple years and locations, while the remaining 65 materials lacked sufficient data to meet the requirements for subsequent analysis. Therefore, as shown in Table 2 and... Figure 3 As shown, only these 320 data points were used in the association analysis between natural population gene polymorphism sites and thousand-grain weight. However, among these 320 data points, 112 materials did not have genotyping, so the actual number of samples for association analysis was 208.

[0061] In 2018, wheat was planted at the Luancheng Experimental Station of the Agricultural Resources Research Center, Chinese Academy of Sciences (Luancheng, Hebei); in 2019, at the Hengshui Experimental Farm of the Agricultural Resources Research Center, Chinese Academy of Sciences (Luancheng and Hengshui, Hebei); and in 2020, at the Institute of Crop Science, Chinese Academy of Agricultural Sciences (Zhaoxian Experimental Station). The thousand-grain weight of each wheat variety was investigated. A correlation analysis was performed using Tassel 2.1 software to analyze the thousand-grain weight and the polymorphic loci. A mixed linear model + population structure (MLM + (Q + K)) method was selected for analysis, with P < 0.05 considered significant. The results are shown in Table 2. Figure 3 As shown.

[0062] Table 2. Association analysis results between gene polymorphism sites and thousand-grain weight in natural populations.

[0063]

[0064] The association analysis results in Table 2 show that the differences in thousand-grain weight between the two types of hexaploid wheat populations shown in Table 1 were significant (P<0.05) or highly significant (P<0.01). Specifically, type II wheat had a higher number of spikelets per spike and a higher thousand-grain weight than type I wheat. In eight environments, the thousand-grain weight of type II wheat was 1.44, 1.42, 1.42, 1.49, 1.55, 1.70, 1.47, and 1.44 grams higher than that of type I wheat, respectively. This study of the natural populations indicates that type II is a superior genotype for increasing thousand-grain weight in wheat.

[0065] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.

[0066] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. A method for developing SNP sites, characterized in that: Based on data processing of genetic variations of specific genes in a natural wheat population, relevant SNP locus information was obtained, and it was verified that different genotypes at the obtained SNP loci correspond to significant phenotypic differences. The significant phenotypic differences are specifically significant differences in the thousand-grain weight trait of wheat. The developed SNP locus corresponds to the 1921st base from the 5' end of the sequence shown in SEQ ID NO.

1. When this locus is T / T homozygous, the corresponding genotype is A; when this locus is C / C homozygous, the corresponding genotype is B. The thousand-grain weight is as follows: wheat homozygous for genotype B is greater than or candidate to be greater than wheat homozygous for genotype A.

2. Primer combination, characterized in that: The primer pair includes primers 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primers 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.

5. This primer combination is used to detect the following SNP sites: the SNP site corresponds to the 1921st base from the 5' end of the sequence shown in SEQ ID NO.

1. When this site is T / T homozygous, the corresponding genotype is A; when this site is C / C homozygous, the corresponding genotype is B. The thousand-grain weight is: wheat homozygous for genotype B is greater than or candidate greater than wheat homozygous for genotype A.

3. A gene detection kit, characterized in that: For detecting the SNP site described in claim 1, the gene detection kit contains a PCR amplification specific primer combination and enzyme digestion component corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection; the target DNA fragment for PCR amplification in this gene detection kit is designed to be 1593-2337bp from the 5' end in SEQ ID NO.

1.

4. The gene detection kit according to claim 3, characterized in that: The PCR amplification specific primer combination includes: primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.

5.

5. The gene detection kit according to claim 3, characterized in that: The enzyme digestion component is the restriction endonuclease NdeI.

6. A method for identifying or assisting in the identification of the thousand-grain weight of wheat in the early stages of breeding, characterized in that: Based on the SNP site described in claim 1, in the early stage of molecular marker-assisted selection breeding, primers are designed to amplify any DNA fragment containing the SNP site in the wheat genomic DNA to be tested by PCR. The wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat thousand-grain weight phenotype is identified or assisted in identification based on the following correlation between genotype and phenotype: the thousand-grain weight of wheat homozygous for genotype B is greater than or can be greater than that of wheat homozygous for genotype A.

7. The method according to claim 6, characterized in that: The DNA fragment amplified by PCR is the 5' end 1593-2337bp of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the restriction endonuclease NdeI is used for enzyme digestion.

8. The method according to claim 6, characterized in that: The enzyme digestion includes the following steps: using wheat genomic DNA as a template, amplifying with primers 1F and 1R to obtain PCR products; diluting this PCR product 100-fold, using it as a template, amplifying with primers 2F and 2R to obtain PCR products; digesting the PCR product with the restriction endonuclease NdeI; if the PCR product can be cleaved, the nucleotide polymorphism site is T / T, and the genotype is A; if the PCR product cannot be cleaved, the nucleotide polymorphism site is C / C, and the genotype is B; the thousand-grain weight of wheat homozygous for genotype B is greater than or candidate to be greater than that of wheat homozygous for genotype A.

9. The use of the primer combination according to claim 1 and the gene detection kit according to any one of claims 2-5, characterized in that: The application is to screen or assist in screening the thousand-grain weight phenotype of wheat in the early stage of molecular marker-assisted selection breeding.

10. Use of the primer combination of claim 1 and the gene detection kit of any one of claims 2-5, wherein the use further includes: The theoretical study of the developmental principle of wheat thousand-grain weight based on the SNP site described in claim 1, and / or the study of the molecular regulatory pathway of wheat thousand-grain weight development based on the SNP site; including: based on the SNP site, identifying, characterizing and / or distinguishing downstream related effector molecules through genotypic differences, and constructing a molecular regulatory pathway for wheat thousand-grain weight; the effector molecules include, but are not limited to, messenger RNA, proteins, associated biological enzymes, various molecular regulatory components, and various molecular signaling components; further, based on the construction of the molecular regulatory pathway for wheat thousand-grain weight, identifying and confirming major or key regulatory nodes and their corresponding biomacromolecules or small molecule components; the application also includes regulating wheat thousand-grain weight in the agricultural industry according to production needs based on the SNP site, specifically including: increasing wheat thousand-grain weight based on genotype B and decreasing wheat thousand-grain weight based on genotype; potential application scenarios for increasing wheat thousand-grain weight are: improving wheat quality, high-quality wheat for high-end food manufacturing or high-end beverage brewing; potential application scenarios for decreasing wheat thousand-grain weight are: increasing total wheat yield, high-yield wheat for livestock feed industry.

Images