Marker for identifying storage and preservation effects of strawberries as well as screening method and application of marker

Abstract

The invention belongs to the technical field of genes, and particularly relates to a marker for identifying storage and preservation effects of strawberries as well as a screening method and application of the marker. The expression quantity of various cell wall degradation related genes in strawberry fruits treated by a storage method is measured, fruit preservation physiological indexes are combined, and comprehensive sorting is performed by homogenizing data through an assignment method; and analyzing the correlation between gene expression and assignment scores of fruit preservation physiological indexes in different treatments, and screening out genes with remarkable correlation as strawberry preservation markers. The marker disclosed by the invention can be used for quickly and accurately evaluating and predicting the quality and the fresh-keeping effect of the picked strawberries.

Description

Technical Field

[0001] This invention belongs to the field of gene technology, specifically relating to a biomarker for identifying the storage and preservation effect of strawberries, its screening method, and its application. Background Technology

[0002] Strawberries are perennial herbaceous plants belonging to the genus *Fragaria* of the Rosaceae family. They are berry fruits with bright color and excellent flavor, but their high water content, soft texture, and lack of outer skin protection make them prone to dehydration and wilting, microbial infection, and softening and aging after harvest. This results in a short storage period, significant transportation losses, and substantial post-harvest economic losses. The fruit softening process is mainly related to the degradation of cell wall structures, involving changes in the expression and activity of various cell wall modifying enzymes such as polygalacturonase (PG), pectin lyase (PL), expansin (EXP), and cellulase (CEL). The expression levels of key genes directly participate in regulating the strawberry fruit softening process.

[0003] Currently, assessing postharvest quality and preservation effectiveness of strawberries mainly relies on measuring physiological and biochemical indicators such as firmness, weight loss rate, and soluble solids content. While these methods are effective, they suffer from a time lag; by the time apparent quality deteriorates, irreversible damage has often already occurred internally, making early warning impossible. Therefore, identifying molecular markers that show significant changes early in the softening and deterioration process and are highly correlated with the preservation process is crucial for accurately assessing the effectiveness of preservation technologies and predicting fruit shelf life. However, under conventional storage conditions, the expression levels of these softening-related genes typically change relatively gradually, making them unsuitable as highly sensitive early warning markers. Therefore, developing an integrated technology that can effectively delay softening and, based on this, screen for highly sensitive preservation molecular markers is of significant value in improving the quality and control of postharvest storage of strawberries. Summary of the Invention

[0004] To address the problem that existing technologies primarily evaluate the post-harvest quality and preservation effect of strawberries using physiological and biochemical indicators with strong lag, making it difficult to detect internal decay and accurately assess quality in the early stages of deterioration, this invention provides a highly sensitive marker for identifying the storage and preservation effect of strawberries, along with its screening method and application. The technical solution is as follows:

[0005] A primer for detecting the above-mentioned marker includes a forward primer with the sequence shown in SEQ ID NO: 2, SEQ ID NO: 2 being: TACCCGCAGAGGATTCACCA; and a reverse primer with the sequence shown in SEQ ID NO: 3, SEQ ID NO: 3 being: ATTAGGTCCGCCCACAACC.

[0006] A kit for identifying the storage and preservation effect of strawberries includes the aforementioned forward and reverse primers.

[0007] Application of one of the above-mentioned markers in strawberry quality identification.

[0008] Application of one of the aforementioned markers in strawberry cultivation.

[0009] A method for screening the above-mentioned markers includes the following steps: (1) Determine and compare the expression levels of fruit softening-related genes in strawberries after natural storage and preservation treatment; screen for genes with significant differences in expression levels; (2) Analyze the correlation between the expression levels of fruit softening-related genes and fruit physiological indicators in strawberries after preservation treatment; screen for genes with significant correlation. (3) Combining steps (1) and (2), we screened out genes with large differences in expression levels and significant correlations.

[0010] Furthermore, the fruit softening-related genes include one or more of FaEXP7, FaPG2, FaPLA, FaCEL1-1, or FaCEL1-3.

[0011] Furthermore, the significant correlation means that the absolute value of the correlation coefficient between gene expression level and fruit comprehensive physiological indicators is not less than 0.90.

[0012] A method for evaluating strawberry freshness using the aforementioned biomarkers involves comparing and quantifying the biomarker expression levels of the strawberries to be evaluated with those of untreated, naturally stored strawberries and fresh strawberries to obtain an evaluation index. Evaluation Index The larger the strawberry, the fresher it is; conversely, the smaller the strawberry, the worse it is.

[0013] Furthermore, according to the formula: The calculation is performed; where X represents the expression level of the biomarker used in the strawberry to be evaluated. The biomarker expression level of untreated, naturally placed strawberries.

[0014] By adopting the above scheme, the method of the present invention has the following advantages: 1. This invention screens for highly sensitive and reproducible biomarker genes by comparing the effects of storage treatment and no treatment on the physiological and gene expression patterns of strawberry fruit quality. Genes screened after treatment using the method of this invention exhibit excellent expression control and, as biomarker genes for detecting fruit preservation, possess the characteristics of early response, predictability, and high sensitivity.

[0015] 2. Compared with other related genes, the biomarker FaCEL1-3 of this invention showed the most significant control effect on relative expression at the end of storage, with the lowest expression level among all treatments. FaCEL1-3 showed the most significant inhibition effect under preservation treatment and had the most significant correlation with the comprehensive physiological indicators of the fruit. Using this gene as a preservation biomarker to detect the freshness of strawberry fruit has high sensitivity.

[0016] 3. The relative expression levels of cell wall degradation-related genes (FaEXP7, FaPG2, FaPLA, FaCEL1-1, FaCEL1-3) were significantly negatively correlated with fruit firmness. Among them, the cellulase gene FaCEL1-3, a marker of this invention, was most significantly correlated with fruit preservation, with a correlation coefficient of 0.9723, which was significantly higher than that of other genes.

[0017] 4. The method of the present invention is used to evaluate the freshness of strawberries. The results are consistent with the results of comprehensive evaluation by multiple physiological and biochemical methods, while the results of evaluation by other genes will be biased. This shows that the method of the present invention can correctly evaluate the freshness of strawberries.

[0018] 5. Compared with the traditional method that requires testing multiple indicators and then performing weighted summation, the evaluation method of this invention only needs to detect one gene indicator, which is more efficient and solves the problems of high requirements for manual operation, many operations, and easy data interference caused by the traditional method, resulting in smaller errors. Attached Figure Description

[0019] Figure 1 This is a comparison of strawberry fruit phenotypes before and after treatment in the blank examples and each treatment example; Figure 2 A comparative analysis chart showing the change rates of titratable acid content, soluble sugar content, vitamin C content, and firmness in strawberry fruits of the blank example and each treatment example. Figure 3 A comparison of the relative expression levels of biomarkers in strawberry fruits from the blank sample and each treatment sample; Figure 4 A comparison of the relative expression levels of other softening-related genes in strawberry fruits from the blank sample and each treatment sample; Figure 5The graph shows the trend of assigning scores to physiological indicators and all gene indicators, as well as a linear scatter plot of five genes and physiological indicators. Detailed Implementation

[0020] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] Example 1: Store strawberries in groups of 8 in PE plastic wrap in a refrigerator at 4°C.

[0022] Treatment Example 2: Coat the surface of strawberries with 0.05~0.1% sorbic acid and store them in a refrigerator at 4°C.

[0023] Example 3: (1) Preparation of coating agent: Accurately weigh 0.9 g of chitosan and dissolve it in 100 mL of 0.6% glacial acetic acid solution. Stir magnetically until completely dissolved. Separately weigh 1.25 g of gelatin and place it in a 50 mL beaker. Add an appropriate amount of water and stir to dissolve in a 55°C water bath. Pour the gelatin solution into the chitosan solution and mix and stir for 30 minutes in a 55°C water bath. Then add 0.4 mL of glycerin and continue stirring for 1 hour until the system is homogeneous. Cool to obtain chitosan-gelatin composite coating agent. (2) Select a number of 'Suizhu' strawberries, and choose fruits that are uniform in size, maturity, color and without damage; immerse the strawberries in the above coating agent to ensure that the entire fruit surface is covered, take them out after soaking for 60 seconds, and let them air dry naturally in a sterile and ventilated place for about 30 minutes to form a transparent film, and store them in a refrigerator at 4°C.

[0024] Example 4: Eight strawberries were stored in a group in a nano-titanium dioxide preservation film and placed in a refrigerator at 4°C.

[0025] Example 5: Coat the surface of strawberries with 0.05-0.1% sorbic acid; after drying, store eight strawberries in a group in nano-titanium dioxide preservation film material and store in a refrigerator at 4°C.

[0026] Example 6: (1) Preparation of coating agent: Accurately weigh 0.9 g of chitosan and dissolve it in 100 mL of 0.6% glacial acetic acid solution. Stir magnetically until completely dissolved. Separately weigh 1.25 g of gelatin and place it in a 50 mL beaker. Add an appropriate amount of water and stir to dissolve in a 55°C water bath. Pour the gelatin solution into the chitosan solution and mix and stir for 30 minutes in a 55°C water bath. Then add 0.4 mL of glycerin and continue stirring for 1 hour until the system is homogeneous. Cool to obtain chitosan-gelatin composite coating agent. (2) Select a number of 'Suizhu' strawberries, and choose fruits that are uniform in size, maturity, color and without damage; immerse the strawberries in the above coating agent to ensure that the entire fruit surface is covered, take them out after soaking for 60 seconds, and air dry them naturally in a sterile and ventilated place for about 30 minutes to form a transparent film; store the strawberries in groups of 8 in nano titanium dioxide preservation film material and store them in a refrigerator at 4°C.

[0027] Comparative example: Untreated, placed naturally in a refrigerator at 4°C.

[0028] Evaluation Example: RNA was extracted from samples taken from each treatment on days 0, 3, and 7 of storage. The expression levels of FaCEL1-3 were quantitatively analyzed. Three samples were taken each time, and the mean value was used. Evaluation index X eva According to the formula: X eva = (X CK -X) / X CK The calculation is performed; where X represents the biomarker expression level of strawberries stored using this method. CK The biomarker expression levels are for untreated, naturally placed strawberries. The results are shown in Table 1.

[0029] Table 1: Evaluation Scores of Markers

[0030] Evaluation Comparative Example 1: RNA was extracted from samples taken from each treatment on storage days 0, 3, and 7, and the expression levels of softening-related genes such as FaEXP7, FaPG2, FaPLA, and FaCEL1-1 were quantitatively analyzed. FaEXP7 uses the following formula: Perform the calculations; FaPG2, FaPLA, FaCEL1-1 according to the formula: Perform calculations; among which, denoted as the evaluation index; X represents the expression level of the corresponding gene in strawberries stored using this method. The expression levels of the corresponding genes in untreated, naturally placed strawberries are shown in Table 2.

[0031] Table 2: Evaluation Scores of Other Genes

[0032] Evaluation Comparative Example 2: Samples were taken from each treatment and control example on days 0, 3, and 7 of storage to determine the firmness, soluble solids content, titratable acid content, and vitamin C content of strawberries. The evaluation indices for the rate of change in titratable acid content and vitamin C content are calculated using the following formula: Calculations are performed; the evaluation indices for the rate of change in hardness and the rate of change in soluble sugar content are calculated using the following formula:

[0033] Perform calculations; among which, Let X be the evaluation index of the i-th indicator, and let X be the measured value of the corresponding indicator for strawberries stored using this method. These are the measured values ​​for indicators corresponding to untreated, naturally left strawberries. The average of the calculated rates of change for each indicator is taken. A comprehensive evaluation of strawberry quality was conducted. The results are shown in Table 3.

[0034] Table 3: Results of Physiological Indicator Evaluation Scores

[0035] All experimental strawberries in each treatment were selected from the 'Suizhu' strawberry variety, harvested from the planting base at 90% maturity, uniform size, and free from mechanical damage and pests. Storage experiments were conducted according to the methods used in each treatment.

[0036] Depend on Figure 1 It can be seen that, firstly, the blank control showed obvious signs of decay by day 7; Group 1, which used ordinary plastic wrap, also showed some signs of decay; the appearance of the strawberry fruits in the other treatments remained good, especially the treatments 4-6, which used the new nano titanium dioxide plastic wrap, showed no obvious signs of decay on the surface during the 7-day shelf life, with bright green stems, plump fruits, and bright colors, showing a significant advantage.

[0037] Comparing Tables 1 and 2, among the five softening-related genes, the chitosan + novel nano-titanium dioxide preservation film treatment group (treatment example 5) showed excellent performance in controlling the expression of softening genes such as FaEXP7, FaPG2, FaPLA, FaCEL1-1, and FaCEL1-3, significantly inhibiting the expression of softening-related genes and helping to maintain fruit firmness, indicating a significant preservation effect. Furthermore, the biomarker of this invention showed the most significant control effect on relative expression levels at the end of storage, with the lowest expression level among all treatments.

[0038] Figure 2 It can be clearly seen that the changes in various physiological indicators of strawberries are different during the storage process. Therefore, to evaluate the storage quality of strawberries, it is necessary to combine multiple physiological indicators for comprehensive evaluation in order to improve the accuracy of the evaluation. However, this leads to problems such as the need to integrate and calculate the indicators, excessively long testing procedures, low efficiency, and increased errors. Figure 2 Table 3 comprehensively evaluates the storage quality of strawberries treated with different preservation methods using multiple physiological indicators. The results show that Treatment Example 5 > Treatment Example 4 > Treatment Example 6 > Treatment Example 2 > Treatment Example 3 > Treatment Example 1. Figure 3 and Figure 5It can be seen that the results have a high degree of matching with the results evaluated using the markers of the present invention. The trend of large score differences between treatment examples 5, 4, and 6 and the remaining treatment examples is the same as in the embodiments, and the trend of small score differences among treatment examples 3, 2, and 1 is also the same as in the embodiments. This demonstrates that the method of the present invention, with fewer steps, can achieve accuracy comparable to conventional methods for comprehensive evaluation of multiple physiological indicators.

[0039] at the same time, Figure 4 and Figure 5 It can be seen that the evaluation results of other genes do not match Table 3 in many ways. For example, the storage quality of treatments 2 and 3 measured by FaEXP7 is close to that of treatment 6 and much higher than that of treatment 4; the storage quality of treatments 4 and 5 of FaPG2 is the same; the storage quality of treatments 4 and 6 of FaPLA differs greatly from that of treatment 6; and the storage quality of treatment 3 in FaCEL1-1 is higher than that of treatments 4 and 6. This shows that the results obtained from these gene measurements produce various unexpected discrepancies with the results of traditional multi-factor combined evaluation, indicating that even if they are all softening-related genes, they cannot directly and accurately evaluate strawberry quality.

[0040] For those skilled in the art, various other corresponding changes and modifications can be made based on the technical solutions and concepts described above, and all such changes and modifications should fall within the protection scope of the claims of this invention.

Claims

1. A marker for assessing the effectiveness of strawberry storage and preservation, characterized in that, The sequence is shown in SEQ ID NO: 1 for the cellulase gene.

2. A primer for detecting the marker of claim 1, characterized in that, It includes a forward primer with a sequence as shown in SEQ ID NO: 2 and a reverse primer with a sequence as shown in SEQ ID NO:

3.

3. A reagent kit for identifying the storage and preservation effects of strawberries, characterized in that, Includes the primers described in claim 2.

4. The application of the marker described in claim 1 in strawberry quality identification.

5. The application of the marker according to claim 1 in strawberry cultivation.

6. A method for screening markers according to claim 1, characterized in that, Includes the following steps: (1) Determine and compare the expression levels of fruit softening-related genes in strawberries after natural storage and preservation treatment; screen for genes with significant differences in expression levels; (2) Analyze the correlation between the expression levels of fruit softening-related genes and fruit physiological indicators in strawberries after preservation treatment; screen for genes with significant correlation. (3) Combining steps (1) and (2), we screened out genes with large differences in expression levels and significant correlations.

7. The method for screening markers according to claim 6, characterized in that, The fruit softening-related genes include one or more of FaEXP7, FaPG2, FaPLA, FaCEL1-1, or FaCEL1-3.

8. The method for screening markers according to claim 6, characterized in that, The significant correlation refers to the absolute value of the correlation coefficient between gene expression level and fruit comprehensive physiological indicators being no less than 0.

90.

9. A method for evaluating the freshness of strawberries using the markers described in claim 1, characterized in that, The expression levels of biomarkers in strawberries to be evaluated were compared with those in untreated, naturally placed strawberries and fresh strawberries, and the results were quantified to obtain an evaluation index. ; Evaluation Index The larger the strawberry, the fresher it is; conversely, the smaller the strawberry, the worse it is.

10. The method for evaluating the freshness of strawberries according to claim 9, characterized in that, According to the formula: The calculation is performed; where X represents the expression level of the biomarker in the strawberry being evaluated. The biomarker expression level of untreated, naturally placed strawberries.

Images