Musha Rosil musk strain with high camphor content and application of musha Rosil musk strain
By selecting and asexually propagating the Kilimanjaro basil strain GWYC11, and utilizing the KOTPS1 gene, we have achieved efficient extraction of high-content dextrorotatory camphor, solving the problems of natural camphor resource shortage and safety, and providing a way to solve the problem of high camphor content materials.
Patent Information
- Application Number
- CN202511847387.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-09
- Publication Date
- 2026-02-17
AI Technical Summary
Existing technologies make it difficult to obtain high levels of natural dextrorotatory camphor, while synthetic camphor presents safety concerns and is also limited in resources. Traditional breeding methods struggle to exceed camphor content thresholds, resulting in unmet market demand.
The Kilimanjaro basil strain GWYC11 with high camphor content was obtained through selection and asexual reproduction, and the KOTPS1 gene was used for efficient extraction and identification to establish an efficient camphor production system.
It significantly increased the relative content of dextrorotatory camphor to 97.218%, solving the problems of resource shortage and safety, and providing a way to solve the problem of high camphor content materials.
Smart Images

Figure CN121533335A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of camphor preparation technology, and in particular to a Kilimanjaro basil strain with high camphor content and its applications. Background Technology
[0002] Camphor (C 10 H 16 O) is a bicyclic monoterpenoid compound, used both as a traditional Chinese medicine and an industrial raw material. It has the effects of clearing the orifices, relieving stagnation of qi, dispelling foulness, killing parasites and relieving itching, reducing swelling and relieving pain. It is mainly used to treat fever with delirium, sudden collapse due to sudden illness, abdominal pain due to bloating and vomiting, beriberi due to cold and dampness, scabies and stubborn tinea, frostbite, burns, bruises and sprains, toothache, and conjunctivitis. It is widely used in the pharmaceutical, daily chemical, and food industries.
[0003] Camphor has optical properties and is classified into dextrorotatory camphor (also known as D-camphor) and levorotatory camphor (L-camphor). Currently, most camphor on the market is synthetic camphor, a mixture of the two, and is a racemic mixture. Synthetic camphor is mainly made from turpentine oil or petrochemical products. Although it is low-cost and produced in large quantities, harmful substances such as naphthalene and paradichlorobenzene may remain during the synthesis process. Due to safety concerns, the EU and other regions have gradually banned the sale of synthetic camphor products containing these substances. Furthermore, its poor compatibility with traditional Chinese medicine limits its application in high-end pharmaceutical fields. Natural camphor is dextrorotatory (content ≥96%), has good safety, and traditionally comes from camphor trees (…). Cinnamomum camphora Camphor is extracted from the roots, stems, branches, and leaves of camphor trees through distillation and refining. However, camphor trees have a long growth cycle, limited resource distribution, and excessive logging has caused ecological pressure. As a result, they are listed as a national second-class protected plant, and the logging of wild camphor trees for camphor extraction is prohibited nationwide. Therefore, the yield of natural camphor is extremely low and cannot meet market demand.
[0004] Kilimanjaro basil ( Ocimum kilimandscharicum Camphor basil is a shrub belonging to the Lamiaceae family, native to East Africa. Its essential oil, extracted from its above-ground parts and leaves, is rich in dextrorotatory camphor (17-54%), hence its other name, Camphor Basil. It has a short growth cycle and strong adaptability, making it a potential substitute for camphor trees in extracting natural camphor. However, its essential oil composition is complex (containing linalool, limonene, camphene, β-caryophyllene, β-pinene, etc.), resulting in high separation costs and hindering its widespread application. Furthermore, conventional breeding methods have struggled to exceed its camphor content threshold (existing varieties <60%).
[0005] Camphor, an important compound with both medicinal and industrial applications, is experiencing a continuous increase in market demand; however, the current supply of natural camphor is severely insufficient, limiting the application of synthetic camphor. Against this backdrop, obtaining materials with high camphor content is an urgent problem to be solved. Summary of the Invention
[0006] This invention provides a Kilimanjaro basil strain with high camphor content and its application, which can effectively solve the technical problems involved in the background art.
[0007] To solve the aforementioned technical problems, the present invention is implemented in the following manner: In a first aspect, the present invention provides a Kilimanjaro basil strain with high camphor content, the Kilimanjaro basil strain being named GWYC11, which was deposited at the China Center for Type Culture Collection on September 3, 2025, with accession number CCTCC NO:P202526.
[0008] A second aspect of the present invention also provides the use of the above-mentioned GWYC11 in the preparation of dextrorotatory camphor or in obtaining Kilimanjaro basil plants with high camphor content, the use comprising: The above-mentioned Kilimanjaro basil strain with high camphor content was cultured using asexual reproduction technology to obtain Kilimanjaro basil plants with high camphor content.
[0009] Furthermore, the application of GWYC11 in the preparation of dextrorotatory camphor also includes: The above-ground parts of the cultivated plants are used as extraction materials; the extraction materials are cut into pieces and then dextrorotatory camphor is extracted; the extraction materials are obtained by harvesting the above-ground parts of the plants when they enter the initial flowering stage; the bottom of the above-ground parts of the plants is 5-10 cm from the ground surface.
[0010] Furthermore, after the plant is harvested, the remaining part above ground retains 2 to 3 bud nodes.
[0011] Furthermore, the Kilimanjaro basil strain with high camphor content contains the KOTPS1 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0012] In a third aspect, the present invention also provides a protein encoded by the above-mentioned KOTPS1 gene.
[0013] Furthermore, the amino acid sequence of the protein encoded by the KOTPS1 gene is shown in SEQ ID NO.2.
[0014] In a fourth aspect, the present invention also provides the use of the protein encoded by the above-mentioned KOTPS1 gene in the preparation of dextrorotatory borneol, dextrorotatory camphor, or camphor.
[0015] In a fifth aspect, the present invention also provides the application of the above-mentioned KOTPS1 gene in obtaining Kilimanjaro basil plants, germplasm, and callus tissue with high dextrorotatory camphor content.
[0016] In a sixth aspect, the present invention also provides an application of the above-mentioned KOTPS1 gene in identifying the dextrorotatory camphor content among different Kilimanjaro basil materials, the application including determining the dextrorotatory camphor content among different Kilimanjaro basil materials based on the expression level of the KOTPS1 gene, wherein the Kilimanjaro basil material with a high KOTPS1 gene expression level corresponds to a high dextrorotatory camphor content. The Kilimanjaro basil plant with high camphor content and its application provided by this invention have the following advantages compared to the prior art: The Kilimanjaro basil strain GWYC11, which provides high camphor content, has a significantly higher relative camphor content than the existing common strains, which contain no more than 60%. The discovery of this strain provides a solution for obtaining materials with high camphor content. Attached Figure Description
[0017] Figure 1 The diagram shows the process of camphor extraction from the plant GWYC11; in the diagram, A corresponds to camphor solidification in the extractor, B corresponds to the moist camphor block taken out from the extractor, and C corresponds to the dried camphor powder. Figure 2 The image shows the morphological characteristics of GWYC11; in the figure, A: plant morphology and lignified stem of GWYC11, B: mature leaf, C: inflorescence, D: flower and pubescence, E: seed, F: anther, G: stigma, H: pollen structure. Figure 3 The image shows a comparison of GC-MS results between plant GWYC11 and the base material S0 essential oil; in the image, A corresponds to the detection result of base material S0, and B corresponds to the detection result of plant GWYC11. Figure 4 The diagram shows a schematic of the steam extraction method for natural camphor. Figure 5 The results of GC-MS analysis of camphor powder extracted from plants obtained through sexual reproduction GWYC11 are shown. Figure 6 The image shows a plant obtained through asexual propagation of GWYC11 (hydroponics); Figure 7 The results of GC-MS analysis of camphor powder extracted from plants obtained through asexual propagation of GWYC11 are shown. Figure 8 The results show the PCR amplification results; in the figure, the left lane is the maker, and the middle and right lanes are the PCR results of the KOTPS1 gene (used to eliminate false positives). Figure 9 Comparison of KOTPS1 gene expression levels in basil materials with different camphor contents; Figure 10The image shows the results of KOTPS1 protein expression identification; the left side of the image shows the SDS-PAGE analysis of KOTPS1 protein expression identification, and the right side shows the SDS-PAGE analysis of protein purification. Figure 11 The images show GC-MS comparisons of the in vitro induced expression products of KOTPS1; the top image is the GC-MS spectrum of the D-borneol standard, and the bottom image is the GC-MS spectrum of the KOTPS1 expression product. Detailed Implementation
[0018] The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operation processes. However, the scope of protection of the present invention is not limited to the following embodiments.
[0019] Example 1 The process of obtaining Kilimanjaro basil plant strain GWYC11 with high camphor content.
[0020] A new Kilimanjaro basil variety (line) with high camphor content was bred using an improved systematic breeding method (multi-generation single-plant selection method). The specific systematic breeding process is as follows: 1. Establish a basic breeding population (S0 generation): Kilimanjaro basil (imported from Kenya) Ocimum kilimandscharicum Seeds of the basic material G081 (S0 generation seeds) were used as the basis for subsequent single-plant selection. Sowing was carried out in seedling trays using a substrate of peat moss, vermiculite, and perlite in a 2:1:1 ratio. The substrate was evenly filled into the trays, and small holes were pressed into the substrate after filling. Three to four basil seeds were placed in each hole, and then the trays were covered with about 0.5 cm of substrate. Water was sprayed, and the trays were covered with a thin film. The corresponding sowing results are shown in Table 1. The resulting plant population was referred to as the S0 generation.
[0021] Table 1. Germination rate and seedling survival rate of basic material G081 in the greenhouse of the Institute of Tropical Crop Germplasm Resources, Chinese Academy of Tropical Agricultural Sciences, Haikou City, Hainan Province. 2. Directional selection of individual plants in the S1 generation: In the S0 generation population, individual plant selection was conducted at the initial flowering stage based on the breeding objective (camphor content). Individual plants with superior phenotypes (vigorous growth, strong resistance, and dense leaf hairs) were sampled (one plant was selected as the base material S0, and relevant analyses were performed in each example). Trace amounts of essential oil were rapidly extracted using steam distillation, and the camphor content was preliminarily determined using gas chromatography-mass spectrometry (GC-MS). Superior plants with high essential oil content and a camphor chromatographic peak area significantly higher than the population average were selected and tagged. Five lines with camphor content >50% were selected, self-pollinated using bagging, and their seeds were collected (as S1 generation seeds).
[0022] Preliminary rapid test results are as follows: The essential oil extraction rate of leaves in the S0 generation population ranged from 0.72 to 3.8 mg / g, and the relative camphor content ranged from 30.21% to 56.23%.
[0023] 3. S1 Generation Strain Identification and Re-selection: Seeds from the five selected superior individual plants (S1 generation seeds) were planted according to the aforementioned conditions, and the resulting plant population was called the S1 generation strain. The uniformity and stability of traits among the strains were observed and compared. Within each strain, 20 individual plants with the best overall performance and high camphor characteristics were selected, for a total of 100 plants, for micro-essential oil extraction and GC-MS analysis.
[0024] The extraction and testing results are as follows: Among the 100 selected plants, the essential oil extraction rate per plant ranged from 1.24 to 5.52 mg / g. One naturally mutated plant was detected; unlike the other plants whose extracted essential oils remained liquid upon cooling to room temperature, the essential oil extracted from this plant solidified into a white, transparent, waxy substance at a high temperature of approximately 70-100 degrees Celsius. (See attached image) Figure 1 As shown in A and B, the possible reason is that the high content of dextrorotatory camphor causes the essential oil to solidify into a waxy substance. After drying the obtained waxy substance in a cool, ventilated place (or by blowing it with cold air), a white, blocky powder is obtained (see attached image). Figure 1 As shown in C), the collected powder was dissolved in ethanol and analyzed by GC-MS. The relative content of dextrorotatory camphor was 97.218%, and the trace substances contained were camphene and 4-terpineol, which were 1.365% and 1.417%, respectively.
[0025] The plant was named GWYC11 and deposited at the China Center for Type Culture Collection on September 3, 2025, with accession number CCTCC NO:P202526.
[0026] Morphological characteristics of GWYC11 (reference) Figure 2The plant is 1-1.5m tall; leaves are opposite, ovate or nearly elliptical, with pointed tips, a few serrations on the edges, prominent veins, and pubescence on both sides; the leaves are green; the stem is quadrangular, easily lignified from the base to about 0.5-1m, brown in color, and green above that; the inflorescence is 10-20cm long, the stem is pinkish-purple, the corolla is pinkish-white, the pistil is purple at the base and white at the tip; the stamens are white at the base and the anthers are red; the stem, inflorescence, and receptacle are all pubescent; the seeds obtained by self-pollination in bags are black, 0.3-1.0cm long and 0.1-0.3cm wide.
[0027] The essential oil content and camphor content of plant GWYC11 were compared with those of the base material S0. The comparison results are shown in Table 2 and [Table data missing]. Figure 3 .
[0028] It can be seen that the relative content of dextrorotatory camphor in GWYC11 reaches 97.218%, which is much higher than the 43.249% in the base material S0. Secondly, this also indirectly verifies that the reason why the essential oil obtained from GWYC11 quickly forms a waxy substance after being below the extraction temperature is due to its high content of dextrorotatory camphor.
[0029] Table 2 Comparison of essential oil chemical composition between selected plants from the S0 generation population and GWYC11 The essential oil extraction method in the above process is as follows: As shown in the attached document Figure 4 The essential oil extractor shown (electric heating mantle ZNHW type, produced by Zhengzhou Dongsheng Instrument Equipment Co., Ltd., 5000ml round bottom flask, splitting and spherical condenser glass device, uniform diameter $29 / 32, produced by Hangzhou Jiande Shuju Trading Company) cuts 1-1.5kg of raw material into 1-2cm pieces, with a material-to-liquid ratio of 1:1, heats to boiling for 0.5-2h, and refluxes the steam to the essential oil recovery device, where camphor essential oil is suspended on the water surface; after the condenser cools to room temperature, the aqueous phase is separated, and the camphor solid is taken out and dried in a fume hood for 5-20 minutes to form a white solid powder; The raw materials for extraction were all obtained using the following methods: Harvest plants that are growing uniformly and have entered the initial flowering stage, that is, harvest the above-ground parts of the plant (the bottom of the above-ground part is 5-10cm from the ground surface), and retain 2-3 buds in the remaining above-ground part of the plant.
[0030] The camphor content detection technique is as follows: Weigh 0.1 g of extracted dextrorotatory camphor powder, dissolve it in 20 ml of methanol solution, add 1 g of anhydrous sodium sulfate and let it stand for 12 h, then take 1.5 ml of the camphor-containing methanol solution and place it in a sample vial for later use.
[0031] The instruments used were: an Agilent Gas Chromatography-Mass Spectrometer (7890B-5977A), a Clerco Fully Automated Multi-functional Sampler System (AS-3902), an SGE GC autosampler syringe (10µL) with a 10F-VA8400-5 / 0.63C autosampler needle, and an HP-5MS column.
[0032] The operating parameters of GC-MS are as follows: (1) Chromatographic conditions: HP-5MS elastic quartz capillary column (30 m×0.25 mm×0.25 μm), carrier gas is high-purity helium, carrier gas flow rate is 1.0 ml / min, injection volume is 1 μl, injection port temperature is 220 ℃. Temperature program: start temperature is 40 ℃, hold for 3 min; increase to 210 ℃ at 10 ℃ / min, hold for 2 min. Mass spectrometry conditions: EI source, solvent delay 5 min, ion source temperature is 230 ℃, scan range is 45~500 amu. The obtained mass spectra are compared with the NIST database (matching degree ≥80%), and the relative content of each volatile component is calculated by gas chromatography peak area normalization method.
[0033] Example 2 Stability testing of GWYC11 1. Sexual reproduction GWCY11 was bagged and self-pollinated. Seeds were collected 30-40 days after flowering when the seed bracts turned from green to yellow and gradually lost water (as S2 generation seeds). Basil seeds have no dormancy period. After harvesting, they were sown immediately, and the resulting plant population was the S2 generation. Sowing conditions: Seeds were sown in seedling trays filled with standard seedling substrate (peat moss:vermiculite = 3:1) and placed in an artificial climate chamber for cultivation. Cultivation conditions were set as follows: day / night temperature 28℃ / 25℃, relative humidity 70%, photoperiod 16 hours light / 8 hours dark, and light intensity approximately 150 μmol·m⁻¹. -2 ·s -1 After the seedlings have grown 2-4 true leaves, transplant them into nutrient pots. The cultivation substrate is a mixture of garden soil, humus and perlite (ratio 2:1:1); see Table 3 for planting results.
[0034] Table 3 shows that the germination rate of S2 generation seeds is lower than that of the basic material, only 5%-10%, and the seedling survival rate is also lower, at 20%-30%, far lower than the corresponding characteristics of S0 generation seeds. The plants are also susceptible to pests and diseases such as whiteflies and spider mites during their growth.
[0035] Table 3 Comparison of planting results between S0 generation seeds and S2 generation seeds. Twenty individual plants were selected from the S2 generation population (one of which was chosen as a GWYC11 seedling for relevant analysis and detection in the examples) for essential oil trace extraction and camphor content detection (extraction and detection methods are as described in Example 1). The extraction results are as follows: The essential oil extraction rate was 1.22-3.02 mg / g, and the relative camphor content was between 57.491% and 70.892% (see test results). Figure 5 (As shown in Table 4), some plants exhibited certain degeneration (mainly manifested as a significant decrease in camphor content).
[0036] 2. Asexual reproduction To address the degeneration observed in GWYC11 seed propagation, asexual propagation methods such as cuttings, hydroponics, and tissue culture are considered for rapid propagation to establish a clonal population. In this embodiment, hydroponic propagation is employed, and the following procedures are performed: Use semi-lignified young shoots from healthy mother plants as cuttings, approximately 5-12 cm long, retaining 2-4 nodes and 2-4 terminal leaves. Make a slanted cut about 0.5 cm below each node, removing the lower leaves. Immerse the cut end of the cutting in a rooting powder solution (e.g., 500 ppm IBA) for 5-15 minutes. Then place the cutting in sterile water in a light-proof container, ensuring the water level covers the lower 1-2 nodes (approximately 3-5 cm deep). Cultivate at 10-20℃ (note that excessively high temperatures can cause the cut to blacken and rot) under diffused light. Roots will develop in 5-10 days, and the root system will reach 3-5 cm in 15-20 days. Figure 6 Then transplant them into loose, nutrient-rich soil, mainly a mixture of garden soil, humus, and perlite (in a ratio of 2:1:1). The survival rate after transplanting can reach 70%-80%. Prune the plant when it reaches about 10cm in height to remove apical dominance and encourage lateral branch growth. Fertilize one week after pruning, primarily with well-rotted farmyard manure (such as sheep or chicken manure), at 500-800kg per acre. One to two months later, when the plant reaches about 20cm, prune it a second time to encourage more branching, reduce lodging, and increase above-ground biological yield. During this period, observe the plant's resistance to diseases and pests, lodging, cold, and drought. Manually remove weak or cold-sensitive plants, leaving only vigorous, lodging-resistant, and disease- and pest-resistant plants. Around four months later, when the plant enters its initial flowering stage, conduct the first harvest (selecting one harvested plant as the GWYC11 clone for relevant analysis and testing in the examples). Harvest the above-ground parts of the plant (with the bottom of the above-ground part 5-10cm from the ground surface), retaining 2-3 buds in the remaining above-ground portion. In Hainan, this can be done 3-4 times a year.
[0037] Fertilize 3-5 days after harvesting the above-ground parts (until the wounds have initially healed and to prevent infection), primarily using well-rotted farmyard manure (such as sheep or chicken manure), at 500-800 kg per acre. 30-40 days later, perform the first topping of the new shoots and apply a top dressing of balanced NPK fertilizer at 10-15 kg per acre to promote shoot growth; this can be dissolved and applied via irrigation or broadcasting. Perform a second topping 60-70 days later to further promote lateral branch differentiation and growth. Depending on the plant's growth, foliar fertilizer can be applied later as needed. Harvest when the terminal inflorescence enters its initial flowering stage. GWYC11 is a high-frequency harvesting variety and requires proper fertilization to maintain sustained high yields. Kilimanjaro basil is a perennial plant that can maintain high yields for 2-3 years, but yields decrease as the rhizomes age and branching weakens. Therefore, replanting is necessary after 3-5 years.
[0038] Relevant tests were conducted on the harvested materials (extraction and testing methods are as described in Example 1). The results showed that the essential oil extracted from the asexual material could still be completely solidified at a high temperature of about 70-100 degrees Celsius, with an extraction rate of 3.85-5.29 mg / g. After drying, it was dissolved in ethanol, and GC-MS analysis showed that the relative camphor content was between 87.201% and 97.714% (see attached). Figure 7 (and Table 4).
[0039] As shown in Table 4, the asexually propagated offspring of GWYC11 retain the genetic characteristic of high camphor content, with an average camphor content >90% (obtained from multiple asexually propagated offspring), significantly higher than the camphor content of the seedling offspring of GWYC11 (57.491%). This indicates that asexual propagation is the preferred method for maintaining the high camphor content of GWYC11.
[0040] Table 4 Example 3 By mining and analyzing key genes of the terpene metabolic pathway in the transcriptome data of plant GWYC11, it was found that the gene KOTPS1 (terpene synthase gene) with nucleotide sequence as shown in SEQ ID NO.1 had significant expression differences in materials with different camphor contents. In order to perform functional analysis, the following operations were performed.
[0041] 1. Obtaining the KOTPS1 gene: Total RNA was extracted from the leaves of plant GWYC11 according to the Plant RNA Kit instructions. The first strand of cDNA was synthesized using the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix kit, following the kit steps.
[0042] Design amplification primer pair targeting the KOTPS1 gene: Upstream primer SEQ ID NO.3: GGATGTATAGCTTGGTGAAAATAT; Downstream primer SEQ ID NO.4: TTAACATTTAGCTTCGAAGGATC; The cDNA obtained using the primer pair consisting of SEQ ID NO. 3~4 was used as a template for PCR amplification. Amplification system: The reaction template consisted of 1.5 μL, upstream primer (15 μM) 1.5 μL, downstream primer (15 μM) 1.5 μL, Trans Taq® HiFi DNA Polymerase 0.5 μL, 10×Trans Taq® HiFi Buffer I 5.0 μL, 2.5 mM dNTPs 5.0 μL, ddH2O 35 μL, and a total volume of 50.0 μL. PCR conditions were: 94℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 45 s, for 30 cycles; extension at 72℃ for 5 min, followed by extension at 4℃ for 1 min. A band of approximately 1700 bp was obtained under UV light (see attached diagram). Figure 8 In the image, the left lane is the marker lane, while the middle and right lanes represent amplification results to avoid false positives.
[0043] The target fragment was located under a UV lamp and photographed using an Image Quant300 gel imaging system. The method for recovering the target fragment was described in the Omega Gel Extraction Kit instruction manual.
[0044] The recovered product was linked to the pEASY-T1 vector to obtain pEASY-T1-KOTPS1; the linkage system consisted of 3 µL of the recovered product and 1 µL of the pEASY-T1 Cloning Vector, and the linkage conditions were: gentle mixing and reaction at room temperature (20 ℃~37 ℃) for 5 min.
[0045] The specific steps for transforming DH5α competent E. coli cells with pEASY-T1-KOTPS1 are as follows: Thaw DH5α competent cells on ice, add 1-5 μL of pEASY-T1-KOTPS1 plasmid, mix gently, and incubate on ice for 30 minutes. Next, precisely heat shock the mixture in a 42°C water bath for 90 seconds, then immediately return it to ice to cool for 2-5 minutes. Then, add 450 μL of antibiotic-free LB medium and incubate at 37°C on a shaker for 45-60 minutes. Finally, spread an appropriate amount of bacterial culture onto solid LB medium containing 60 µg·mL ampicillin resistance, invert the plate, and incubate overnight at 37°C. Select white positive colonies for PCR detection of positive clones. Expand the positive colonies and send them to Nanjing Genscript Biotech Co., Ltd. for sequencing. Obtain the recombinant vector pEASY-T1-KOTPS1, clone and sequence it, and verify the sequence.
[0046] 2. Analysis of KOTPS1 gene expression levels To detect the correlation between the KOTPS1 gene and camphor content in Kilimanjaro basil, quantitative real-time PCR was performed.
[0047] 2.1) Design the following quantitative fluorescence primers: KOPTS1 qPCR upstream primer PF: TCCAGCTCGCCAATGAATTCGCCACSEQ ID NO.5; KOPTS1 qPCR downstream primer PR: GATGTTGGCCTTGGTGGCCATCATCSEQ ID NO.6; 2.2) Obtaining Extracted Materials: Sweet basil G002 and sweet basil G015 were planted using the method shown in Example 1. After they entered the initial flowering period, plants with normal growth were selected for harvesting to obtain the corresponding extracts. 2.3) The basic material S0 obtained in Example 1, the GWYC11 obtained in Example 1, the GWYC11 clone obtained in Example 2, and the GWYC11 seedling obtained in Example 2 were used as the extraction materials for the corresponding raw materials. The camphor content and KOTPS1 gene expression level of the six extracted materials were determined. The method for determining the camphor content was the same as in Example 1. The KOTPS1 gene expression level was measured as follows: Using cDNA from each extracted material as templates, qPCR quantitative PCR was performed using primers shown in 2.1 (with Actin as an internal control to correct experimental errors) to analyze the expression level of the KOTPS1 gene. The reaction system consisted of 10 µL: 0.1 µL template cDNA, 0.3 µL forward and reverse primers, 5 µL 2×TransStart@Tip Green qPCRsupermix, and 3.4 µL ddH2O. The reaction program was: 94 ℃ for 30 s; 95 ℃ for 5 s, 60 ℃ for 15 s, 72 ℃ for 10 s, for 40 cycles.
[0048] The results are shown in Table 5 and Figure 9 It can be concluded that the expression level of the KOTPS1 gene is high in GWYC11 itself and in the corresponding clonal plants of GWYC11, followed by the corresponding plants of the S0 generation with relatively low camphor content and the offspring of GWYC11 seedlings (the clonal lines of GWYC11). However, in common sweet basil with extremely low camphor content... Ocimum basilicum In materials G002 and G015, the expression level of this gene was also the lowest. This indicates that the expression level of the KOTPS1 gene is significantly positively correlated with the camphor content in Kilimanjaro basil (P<0.01).
[0049] In other words, by using quantitative real-time PCR to detect and compare the expression levels of the KOTPS1 gene among different Kilimanjaro basil materials, the camphor content among the materials can be determined, which is helpful for the later selection and breeding of germplasm.
[0050] Table 5. Relative camphor content in different materials Example 4 The amino acid sequence of the protein encoded by the KOTPS1 gene is shown in SEQ ID NO.2. The functional analysis of this protein will be performed using a prokaryotic expression system. The main steps include: Step 1: Construction of expression vector Primers with the signal peptide removed were designed for constructing a prokaryotic expression vector; the designed primers are as follows: KOPTS1 expression upstream primer PF: CAAGCGAGCTGCGGAGCTGSEQ ID NO.7; The downstream primer is the same as the downstream primer used to clone the full-length KOTPS1 gene sequence: TTAACATTTAGCTTCGAAGGATCSEQ ID NO.4.
[0051] Prokaryotic expression was performed using the pCOLDII vector with ampicillin resistance. The vector was linearized by double digestion with BamHI and XbaI restriction enzymes, and the linear vector fragment was recovered and purified by gel electrophoresis to obtain the linear pCOLDII vector.
[0052] The KOTPS1 gene was ligated into a linearized pCOLDII vector using seamless cloning technology. The ligation system consisted of 20 µL: 50 ng of linear pCOLDII vector, 100 ng of the KOTPS1 gene fragment to be inserted, 1 µL of 10× T4 DNA ligase buffer, 1 µL of T4 DNA ligase, and sterile deionized water to make up the volume. The specific procedure was as follows: In a sterile microcentrifuge tube, water, buffer, vector DNA, and the DNA fragment to be inserted were added sequentially, followed by the addition of T4 DNA ligase. The mixture was gently mixed, briefly centrifuged, and incubated overnight (12–16 h) at 16°C.
[0053] The recombinant prokaryotic expression plasmid pCOLDII-KOTPS1 was obtained through the above steps.
[0054] Step 2: Recombinant plasmid transformation and positive clone screening The obtained plasmid pCOLDII-KOTPS1 was transformed into ArcticExpress (DE3)RP chemocompetent cells using a heat shock method. The cells were plated on ampicillin-containing plates, incubated overnight, and single colonies were picked. Positive clones were identified by colony PCR or plasmid restriction enzyme digestion. An engineered bacterial strain containing the pCOLDII-KOTPS1 recombinant plasmid was obtained.
[0055] Step 3: Induction of Expression and Collection of Bacterial Cells In Terrific Broth medium supplemented with 0.5% glycerol, 0.25M D-sorbitol, and 2.5mM betaine, 0.5mM of the aforementioned engineered strain was added for induction, followed by heterologous protein production at 37°C and 220 rpm for 4 hours. Cells were collected by centrifugation at 4°C and 10,000 rpm for 2 min. Bacterial cells containing the target protein (KOTPS1) were obtained.
[0056] Step 4: Purification of KOTPS1 protein The bacterial pellet containing the target protein (KOTPS1) was resuspended in 3 mL of lysis buffer (20 mM NaH2PO4, 0.5 M NaCl, 50 mM imidazole, 10% glycerol, 3 mM DTT, pH 7.4) and lysed by sonication. The resulting suspension was centrifuged at 4,000 rpm for 15 minutes, and the supernatant was collected as the crude extract for subsequent affinity purification.
[0057] Purification was performed using a Ni-IDA affinity chromatography column (HIS-trap FF, Ni-IDA-Sepharose CL-6B). First, the column was equilibrated with Ni-IDA binding buffer (20 mM Tris-HCl, 20 mM imidazole, 0.15 M NaCl, pH 8.0). Then, the crude extract was loaded into the equilibrated column. After loading, the column was thoroughly washed with binding buffer at a flow rate of 0.5 mL / min to remove non-specifically bound proteins. Recombinant KOTPS1 protein was then eluted with elution buffer (20 mM Tris-HCl, 250 mM imidazole, 0.15 M NaCl, pH 8.0) at a flow rate of 1 mL / min, and the elution fractions were collected aliquots.
[0058] The purity of recombinant KOTPS1 protein in each eluted fraction was assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The gels were stained with Coomassie Brilliant Blue R-50, and the results are shown below. Figure 10 As shown in the figure (the left side of the figure shows the SDS-PAGE analysis for KOTPS1 protein expression identification, and the right side shows the SDS-PAGE analysis for protein purification).
[0059] Figure 10 The middle (left) image shows a band at approximately 60 kDa, consistent with the predicted band size (the amino acid sequence of the target protein is shown in SEQ ID NO.2), indicating that the target gene KOTPS1 has been ligated to pCOLDII and successfully expressed in the prokaryotic system; the target protein KOTPS1 band was obtained through isolation and purification (see reference). Figure 10 (Right side) indicates that the KOTPS1 gene expression protein can be successfully obtained through the prokaryotic expression system.
[0060] The concentration of the purified protein solution was further determined using the Bradford assay (Bio-Rad Protein Assay Kit), and the result showed a concentration of 1.1 mg / mL. Thus, the preliminarily purified and quantified KOTPS1 recombinant protein was obtained and stored at -80°C for further enzyme activity assays.
[0061] Step 5: Enzyme activity assay and functional verification of KOTPS1 In a 500 µL reaction system, 50 mM MOPS buffer (pH 7.1), 10% glycerol, 5 mM DDT, and 10 mM MgCl2 were added to establish the basic reaction environment. Then, 20 µg of the KOTPS1 recombinant protein purified in step four was added. Finally, 50 µM geranylide (GPP) was added to initiate the reaction.
[0062] To facilitate subsequent analysis of volatile terpenoid products, 500 µL of n-hexane containing 20 µg / mL methyl undecanoate was placed on the reaction mixture and incubated at 30°C for 1 hour. The reaction system was then vigorously mixed, allowed to stand for separation, and the upper n-hexane phase was collected and concentrated.
[0063] Using D-borneol standard purchased from Sigma-Aldrich as a control, the concentrated n-hexane phase sample was analyzed by GC-MS. The detection was performed according to the gas chromatography-mass spectrometry (GC-MS) conditions and methods described in Example 1, with the specific chromatographic and mass spectrometric parameters remaining the same. The GC / MS analytical results are as follows: Figure 11 (The top image is the GC-MS chromatogram of D-borneol standard, and the bottom image is the GC-MS chromatogram of KOTPS1 in vitro expression product.)
[0064] refer to Figure 11 The results showed that the recombinant KOTPS1 expression product had the same retention time and mass spectrometry as the D-borneol standard, and the product expression level was higher. Figure 11 (See below). Besides the major product D-borneol, the expression products of KOTPS1 contain small amounts of byproducts such as camphor and pinene. However, the relative content of these byproducts is low, with D-borneol accounting for over 70% of the total composition. This indicates that the protein encoded by the KOTPS1 gene can catalyze the production of D-borneol from the substrate GPP, and is a key enzyme in the core pathway of camphor biosynthesis in GWYC11.
[0065] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A Kilimanjaro basil strain with high camphor content, the Kilimanjaro basil strain being named GWYC11, was deposited at the China Center for Type Culture Collection on September 3, 2025, with accession number CCTCC NO:P202526.
2. The application of GWYC11 as described in claim 1 in the preparation of dextrorotatory camphor or in obtaining Kilimanjaro basil plants with high camphor content, characterized in that, The applications include: The Kilimanjaro basil strain with high camphor content described in claim 1 was cultured using asexual reproduction technology to obtain Kilimanjaro basil plants with high camphor content.
3. The application according to claim 2, characterized in that, Applications of GWYC11 in the preparation of dextrorotatory camphor also include: The above-ground parts of the cultivated plants are used as extraction materials; the extraction materials are cut into pieces and then dextrorotatory camphor is extracted; the extraction materials are obtained by harvesting the above-ground parts of the plants when they enter the initial flowering stage; the bottom of the above-ground parts of the plants is 5-10 cm from the ground surface.
4. The application according to claim 3, characterized in that, After the plant is harvested, the remaining part above ground retains 2-3 buds.
5. The Kilimanjaro basil strain with high camphor content according to claim 1, characterized in that, The Kilimanjaro basil strain with high camphor content contains the KOTPS1 gene, the nucleotide sequence of which is shown in SEQ ID NO.
1.
6. The protein encoded by the KOTPS1 gene as described in claim 5.
7. The protein encoded by the KOTPS1 gene according to claim 6, characterized in that, The amino acid sequence of the protein encoded by the KOTPS1 gene is shown in SEQ ID NO.
2.
8. The use of the protein encoded by the KOTPS1 gene as described in claim 6 in the preparation of dextrorotatory borneol, dextrorotatory camphor, or camphor.
9. The application of the KOTPS1 gene as described in claim 5 in obtaining Kilimanjaro basil plants, germplasm, and callus tissue with high dextrorotatory camphor content.
10. The application of the KOTPS1 gene as described in claim 5 in identifying the dextrorotatory camphor content among different Kilimanjaro basil materials, characterized in that, The application includes determining the level of dextrorotatory camphor content among different Kilimanjaro basil materials based on the level of KOTPS1 gene expression, wherein the Kilimanjaro basil material with a high level of KOTPS1 gene expression corresponds to a high level of dextrorotatory camphor content.