Creation and identification method of fully male hybrid pelteobagrus fulvidraco

Abstract

The invention discloses creation and identification methods of fully male hybrid pelteobagrus fulvidraco. The creation method comprises the step of treating the yellow catfish with the genetic type of YY by using estradiol to obtain the YY all-female yellow catfish. The male rate of the fully male hybrid pelteobagrus fulvidraco created by the creation method is stably kept at 100%, and compared with common hybrid pelteobagrus fulvidraco, the growth rate and the survival rate of the fully male hybrid pelteobagrus fulvidraco are remarkably improved. The invention further provides a molecular marker for identifying the sex of the pelteobagrus fulvidraco, and the molecular marker can be used for identifying the variety of the pelteobagrus fulvidraco and accurately distinguishing fully male hybrid pelteobagrus fulvidraco from common hybrid pelteobagrus fulvidraco; the molecular marker can also be used for evaluating the economic characters of the pelteobagrus fulvidraco.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of aquatic genetic breeding, in particular to a method for creating and identifying all-male hybrid Pelteobagrus fulvidraco. BACKGROUND

[0002] Pelteobagrus fulvidraco is an important characteristic economic freshwater aquaculture fish in China, with a huge industry scale. According to the 2024 China Fishery Statistical Yearbook, its annual output has reached 622,600 tons. Hybrid Pelteobagrus fulvidraco "Huangyou No. 1" (GS-02-001-2018) obtained by hybridization of the 2nd selected Pelteobagrus fulvidraco as the male parent and the 2nd selected Pelteobagrus fulvidraco as the female parent has rapidly become the mainstream breeding variety in the country due to its fast growth rate and transportation resistance. However, there are still two major technical problems to be solved in the current production and application of hybrid Pelteobagrus fulvidraco, which seriously restrict the high-quality development of the industry.

[0003] First, there is a lack of effective molecular identification means for fry identity and purity, leading to market chaos. At present, there is no core technical barrier for the production of hybrid Pelteobagrus fulvidraco, and many fry enterprises can breed. Due to the lack of a rapid and specific detection method that can accurately distinguish the specific hybrid offspring from ordinary Pelteobagrus fulvidraco or other hybrid combinations, the sources of fry in the market are complex, the purity is not the same, and the quality is uneven, and the phenomenon of "good seed and bad seed" is widespread, which seriously restricts the healthy development of the industry and the coverage rate of good seed.

[0004] Second, the existing technology cannot achieve efficient all-male breeding and cannot overcome the significant growth disadvantage. Hybrid Pelteobagrus fulvidraco, like its parent, has a serious sexual growth dimorphism. Studies have shown that under the same breeding conditions, the growth rate of male individuals is significantly faster than that of female individuals, and the growth of one-year-old and two-year-old males is 38.95% and 32.32% faster than that of females, respectively. This means that the presence of female individuals in the breeding population will significantly reduce the overall yield and economic benefits. At present, there is still a lack of a reliable technical solution that can efficiently and accurately identify the genetic sex of hybrid Pelteobagrus fulvidraco and guide the breeding of all-male fry. Traditional sex identification methods rely on dissection or waiting for the development of sex glands, which are inefficient and cannot be used for early selection; and the key prerequisite for developing all-male technology, i.e., the excavation of specific sex determination genes or markers in hybrid offspring, is still a difficult problem.

[0005] Therefore, it is a technical problem to be solved in the field to develop a molecular marker and technical method that can specifically identify the identity of hybrid Pelteobagrus fulvidraco and accurately identify its early genetic sex, thereby providing core technical support for the efficient breeding of all-male hybrid Pelteobagrus fulvidraco. SUMMARY

[0006] Therefore, the present application aims to provide a method for creating all-male hybrid yellow catfish, and provide a molecular marker and method for quickly identifying all-male hybrid yellow catfish and common hybrid yellow catfish. Since all-male hybrid yellow catfish and common hybrid yellow catfish have the same appearance and cannot be distinguished by morphological characteristics, and the production technology of common hybrid yellow catfish has low threshold and is easy to disrupt the market, the present application designs primers for the molecular marker, which can be visually distinguished in the gel electrophoresis diagram of the PCR amplification product of all-male hybrid yellow catfish and common hybrid yellow catfish.

[0007] To achieve the above-mentioned purpose, the present application at least provides the following technical solutions:

[0008] In a first aspect, the present application provides a method for creating all-male hybrid yellow catfish and common hybrid yellow catfish, comprising the following steps:

[0009] YY all-female yellow catfish is obtained by treating YY yellow catfish with estradiol;

[0010] All-male hybrid yellow catfish is obtained by artificially breeding common Wushih yellow catfish as the father and YY all-female yellow catfish as the mother;

[0011] Common hybrid yellow catfish is obtained by artificially breeding common Wushih yellow catfish as the father and XX female yellow catfish as the mother.

[0012] In a second aspect, the present application provides a molecular marker for identifying the gender of yellow catfish, which comprises a nucleotide sequence as shown in SEQ ID NO. 4, or a variant having at least 90% (such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity with SEQ ID NO. 4, and capable of being used as a yellow catfish Y chromosome specific marker.

[0013] The above-mentioned molecular marker is a difference sequence between the Y chromosome of yellow catfish, the X chromosome of yellow catfish and the corresponding Wushih yellow catfish chromosome, which is obtained by comparing the nucleotide sequence of SEQ ID NO. 1 derived from the Y chromosome genome of yellow catfish, SEQ ID NO. 2 derived from the X chromosome genome of yellow catfish, and SEQ ID NO. 3 derived from the 1st chromosome of Wushih yellow catfish genome. The obtained difference sequence is shown in SEQ ID NO. 4.

[0014] In a third aspect, the present application provides a primer pair for amplifying the molecular marker of the second aspect, which comprises:

[0015] Forward primer: the nucleotide sequence is shown in SEQ ID NO. 5;

[0016] The reverse primer has a nucleotide sequence as shown in SEQ ID NO. 6.

[0017] The forward primer is base-paired with the DNA molecule specific sequence of the Y chromosome of Pelteobagrus fulvidraco, and the reverse primer is base-paired with the DNA molecule of the Y chromosome and the X chromosome of Pelteobagrus fulvidraco, and the DNA molecule corresponding to the 1st chromosome of Wushibaogru.

[0018] In a fourth aspect, the present application provides a kit comprising the primer pair of the third aspect.

[0019] In a fifth aspect, the present application provides a method for identifying all-male hybrid Pelteobagrus fulvidraco and hybrid Pelteobagrus fulvidraco, comprising the following steps:

[0020] extracting a DNA sample of the hybrid Pelteobagrus fulvidraco to be detected;

[0021] using the DNA sample as a template, and performing PCR amplification by using the primer pair with the nucleotide sequences as shown in SEQ ID NO. 5 and 6;

[0022] performing gel electrophoresis on the obtained PCR product to determine the type of the hybrid Pelteobagrus fulvidraco to be detected.

[0023] Further, the method for determining the type of the hybrid Pelteobagrus fulvidraco to be detected is:

[0024] if the PCR amplification product appears as one band in the gel electrophoresis, the hybrid Pelteobagrus fulvidraco to be detected is all-male hybrid Pelteobagrus fulvidraco;

[0025] if the PCR amplification product does not appear as a band in the gel electrophoresis, the hybrid Pelteobagrus fulvidraco to be detected is common hybrid Pelteobagrus fulvidraco.

[0026] In some embodiments, the PCR amplification system is as follows: 2x TaqMasterMix 5 μL, Forward primer (10 μM) 0.5 μL, Reverse primer (10 μM) 0.5 μL, DNA template 1 μL, ddH2O 3 μL.

[0027] In some embodiments, the PCR amplification program is as follows: pre-denaturation: 95 ℃, 3 min; 35 cycles: 95 ℃, 25 s, 60 ℃, 30 s, 72 ℃, 15 s; extension: 72 ℃, 5 min; 4 ℃ preservation.

[0028] In a sixth aspect, the present application discloses a method for comparing the economic traits of all-male hybrid Pelteobagrus fulvidraco and hybrid Pelteobagrus fulvidraco, comprising the following steps:

[0029] equally mixing the all-male hybrid Pelteobagrus fulvidraco and the common hybrid Pelteobagrus fulvidraco, and raising them in the same breeding pond;

[0030] Through 2-4 months of the same pool culture, the body length, body weight of each hybrid Pelteobagrus fulvidraco is measured, and the corresponding tail fin is cut;

[0031] The all-male hybrid Pelteobagrus fulvidraco and the common hybrid Pelteobagrus fulvidraco are identified by using the primer pair of the third aspect, the kit of the fourth aspect and / or the method of the fifth aspect;

[0032] The economic traits of the all-male hybrid Pelteobagrus fulvidraco and the common hybrid Pelteobagrus fulvidraco are counted respectively.

[0033] Compared with the prior art, the technical scheme of the present application has at least the following beneficial effects:

[0034] 1. High sex induction efficiency and no damage to growth: The present application uses low concentration 17β-estradiol to induce the gonad of YY super male Pelteobagrus fulvidraco, which can efficiently induce it to functional ovary within 10 days, and the induction reversal rate and individual survival rate reach 100%, and the growth rate of the induced individual is not inhibited, which has no significant difference with the common female Pelteobagrus fulvidraco.

[0035] 2. Excellent all-male fry traits and significant economic benefits: The all-male hybrid Pelteobagrus fulvidraco produced by the present application has a stable male rate of 100%. Compared with the common hybrid Pelteobagrus fulvidraco, the growth rate and survival rate are significantly improved by 24.04% and 13.67% respectively, which shows outstanding economic value and broad application prospect.

[0036] 3. Accurate and convenient strain identification technology: The specific molecular marker and identification method provided by the present application can directly use genomic DNA as a template, and through conventional PCR and electrophoresis analysis, it can accurately identify the all-male hybrid Pelteobagrus fulvidraco and the common hybrid Pelteobagrus fulvidraco which cannot be distinguished by phenotype. This method is not limited by the development stage and the breeding environment of fish, and provides a reliable and accurate detection tool for fry production.

[0037] 4. Accurate and reliable economic trait evaluation: The present application evaluates the economic traits of all-male and common hybrid Pelteobagrus fulvidraco by co-culturing them in the same pool and combining the above-mentioned molecular marker identification technology, which can completely eliminate the interference of environmental heterogeneity, making the comparison results of key data such as growth performance more accurate and reliable. BRIEF DESCRIPTION OF DRAWINGS

[0038] Figure 1 The production schematic diagram of the all-male hybrid Pelteobagrus fulvidraco and the common hybrid Pelteobagrus fulvidraco provided by the present application is shown; wherein Pf represents the Latin abbreviation of Pelteobagrus fulvidraco; Pv represents the Latin abbreviation of Pelteobagrus vachelli.

[0039] Figure 2YY testis, YY ovary and XX ovary gonadal morphological observation and tissue section provided by the embodiments of the present application.

[0040] Figure 3 Y chromosome and X chromosome of yellow catfish and corresponding Wushihuangpangyu chromosome sequence difference alignment analysis provided by the embodiments of the present application; wherein Pf_Y represents yellow catfish Y chromosome; Pf_X represents yellow catfish X chromosome; Pv_Chr1 represents Wushihuangpangyu chromosome 1.

[0041] Figure 4 The agarose gel electrophoresis diagram of all-male hybrid yellow catfish and common hybrid yellow catfish provided by the embodiments of the present application; wherein the common hybrid yellow catfish includes Hubei breeding population, Sichuan breeding population and Guangdong breeding population. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application will be further described in detail below with examples. It should be understood that the specific examples described herein are only used to explain the present application and not to limit the present application.

[0043] The materials used in the following examples are not limited to the following list, and other similar materials can be used instead. If the specific conditions of the instruments are not specified, the conventional conditions or the conditions recommended by the manufacturers should be used. Those skilled in the art should master the relevant knowledge of using conventional materials and instruments.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter described in this application belongs. Before the present application is described in detail, the following definitions are provided to better understand the present application.

[0045] In order to better understand the present teachings and not to limit the scope of the present teachings, unless otherwise indicated, all numbers expressing quantities, percentages or ratios and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by the present teachings. At the very least, each numerical parameter should at least be construed in light of the number of significant digits it contains and by applying ordinary rounding techniques.

[0046] The technical scheme of the present application and the technical effects achieved are described in more detail below through more specific examples.

[0047] Example 1 Method for creating all-male hybrid yellow catfish

[0048] The present embodiment provides a method for creating all-male hybrid yellow catfish, and the creation process is as followsFigure 1 The specific steps are shown as follows:

[0049] 1. Directional induction of YY-type female Pelteobagrus fulvidraco

[0050] (1) Directional induction of female: A large number of YY genotype Pelteobagrus fulvidraco were obtained by artificial breeding of YY male and YY female Pelteobagrus fulvidraco parents [YY super male line derived from Pelteobagrus fulvidraco “full male No. 2” (GS-04-001-2023)]. When the Pelteobagrus fulvidraco larvae reached 4 days post hatching (dph), the yolk was completely gone, and the hatched Brine shrimp was artificially fed, with 3 times of satiety feeding per day. When reaching 8 dph, the 0.15 mm micro-pellet feed was domesticated, and the residual feed was sucked out after each feeding for 1 hour, 3 times a day. When reaching 10 dph, the fry was divided into hormone feeding groups and control groups. The hormone feeding groups were set as 10-20 dph, 10-25 dph, 10-30 dph, 10-40 dph, and 10-50 dph, and the rest of the time was fed with feed without hormones. The control group was fed with feed without hormones throughout the whole process. Each combination contained 3 parallel tanks, and each tank contained 120 fish. The hormone feed was prepared as follows: 15 mg of 17β-estradiol (E2) was dissolved in 400 mL of 95% ethanol, and was uniformly sprayed on 1 kg of micro-pellet feed using a watering can. The feed was dried in an oven at 40 ℃ and was ready for use.

[0051] (2) Measurement of growth traits and identification of phenotypic sex: When reaching 60 dph, 60 Pelteobagrus fulvidraco were randomly selected from each group (20 from each parallel tank) to measure body length and weight, and 30 of them were randomly selected for dissection for sex ratio statistics. Five of each gonad were randomly selected and stored in 4% paraformaldehyde at 4 ℃ overnight for hematoxylin-eosin (H.E) staining analysis.

[0052] (3) Result analysis: The sex of Pelteobagrus fulvidraco is controlled by genotype. The gonads of YY Pelteobagrus fulvidraco fed with normal feed all developed into testes, the gonads of XX Pelteobagrus fulvidraco fed with normal feed all developed into ovaries, and the gonads of each group of YY-type Pelteobagrus fulvidraco fed with hormone feed containing E2 all developed into ovaries. Figure 1 ).

[0053] The results of the growth traits and survival rate of Pelteobagrus fulvidraco are shown in Table 1, where a~e are significant difference identifiers (P<0.05).

[0054] Table 1 60 dph growth, survival rate and sex reversal ratio statistics of 15 mg / kg E2 feeding groups of Pelteobagrus fulvidraco

[0055] As can be seen from the above table, the length of feeding time seriously affects the growth rate of YY yellow catfish, the longer the feeding time, the slower the growth rate, among which YY female yellow catfish can be obtained by feeding E2 during 10-20 dph, and its growth rate has no significant difference with that of XX all-female yellow catfish (Table 1). Therefore, feeding 15 mg / kg E2 during 10-20 dph is most suitable for large-scale production of YY all-female yellow catfish.

[0056] 2. Creation of all-male hybrid yellow catfish and common hybrid yellow catfish

[0057] (1) Parent selection: As shown in Table 1, the creation of all-male hybrid yellow catfish is based on XY Wushih yellow catfish as the father and YY all-female yellow catfish as the mother, while the common hybrid yellow catfish is based on XY Wushih yellow catfish as the father and XX female yellow catfish as the mother. Figure 1

[0058] (2) Artificial breeding: The method of artificial breeding of yellow catfish refers to "Xiong Y, Wang X, Sun R, et al. Administration of Arginine Vasotocin and modified Isotocin improve artificial propagation and post-spawning survival of female yellow catfish [J]. Aquaculture, 2024, 587: 740849."

[0059] Example 2 Identification of all-male hybrid yellow catfish and common hybrid yellow catfish

[0060] This example provides a method for identifying the all-male hybrid yellow catfish and common hybrid yellow catfish described above, and the specific method is as follows:

[0061] ​(1) The source of the genome sequence: The yellow catfish Y chromosome genome sequence involved in the present application is derived from the nucleotide sequence of chromosome 2 from 25671933 to 25672504 of the yellow catfish genome HZAU_PFYY_1.0 (GenBank: GCA_023638525.1) (SEQ ID NO. 1); the corresponding yellow catfish X chromosome genome sequence is derived from the nucleotide sequence of chromosome 2 from 25991659 to 25992095 of the yellow catfish genome HZAU_PFXX_2.0 (GenBank: GCA_022655615.1) (SEQ ID NO. 2); and the corresponding Wasi genome sequence is derived from the nucleotide sequence of chromosome 1 from 25441860 to 25442540 of the Wasi yellow catfish genome HZAU_Pvac_v1 (GenBank: GCA_030014155.1) (SEQ ID NO. 3).

[0062] (2) Primer design: As described in Example 1, the difference between the all-male hybrid yellow catfish and the common hybrid yellow catfish in producing only females is that the all-male hybrid yellow catfish takes YY all-female yellow catfish as the female parent, while the common hybrid yellow catfish takes XX all-female yellow catfish as the female parent. Therefore, the all-male hybrid yellow catfish contains yellow catfish Y chromosome genetic information, while the common hybrid yellow catfish contains yellow catfish X chromosome genetic information. Based on this, the present example performs bioinformatics alignment on the sequences SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3, and the results are shown in Figure 3 SEQ ID NO. 4, which is derived from a fragment of SEQ ID NO. 1 and is not present in SEQ ID NO. 2 and SEQ ID NO. 3, and thus is a yellow catfish Y chromosome specific marker.

[0063] Further, the primers are designed and synthesized based on the above sequences, wherein the forward primer sequence is GCCTTTCTCTGTTACAC

[0064] TGCCT (SEQ ID NO. 5), which base pairs with the DNA molecule of the yellow catfish Y chromosome specific sequence; and the reverse primer is AATGACTGAATGCCACCATC (SEQ ID NO. 6), which base pairs with the DNA molecule of the yellow catfish three sequences.

[0065] (3) Identification of the all-male hybrid yellow catfish and the common hybrid yellow catfish, the steps are as follows:

[0066] Extract the DNA sample of the hybrid yellow catfish to be detected; the extracted DNA sample is subjected to PCR amplification using the above-mentioned primers, wherein the PCR amplification system is shown in Table 2:

[0067] Table 2 PCR amplification system

[0068]

[0069] The PCR amplification procedure is as follows: pre-denaturation: 95 ℃, 3 min; 35 cycles: 95 ℃, 25 s, 60 ℃, 30 s, 72 ℃, 15 s; extension: 72 ℃, 5 min; 4 ℃ preservation.

[0070] Agarose gel electrophoresis: prepare 1% concentration of agarose gel, and perform electrophoresis after spotting the PCR product to be detected. In order to verify the identification effect, the present application purchases ordinary hybrid yellow catfish fry from main producing areas such as Hubei Jingmen City Wanglong Aquaculture Co., Ltd., Guangdong Zhaoqing City Jiayi Aquatic Technology Co., Ltd., and Sichuan Meishan Wei Ji Aquaculture Technology Co., Ltd., covering Hubei breeding groups, Guangdong breeding groups, and Sichuan breeding groups.

[0071] The electrophoresis result is shown in Figure 3 From the figure, it can be seen that the all-male hybrid yellow catfish only amplifies a 450 bp band, and the ordinary hybrid yellow catfish in the remaining three regions has no band. Therefore, the type of the sample of the yellow catfish can be identified according to the electrophoresis band position.

[0072] Example 3 Comparison of economic traits of all-male hybrid yellow catfish and ordinary hybrid yellow catfish

[0073] The present embodiment provides a method for comparing the economic traits of all-male hybrid yellow catfish and ordinary hybrid yellow catfish, and the specific steps are as follows:

[0074] (1) Artificial breeding: produce all-male hybrid yellow catfish and ordinary hybrid yellow catfish water flowers according to the method of Example 1, and open and acclimate the feed according to the above method.

[0075] (2) Comparative culture in the same pond: when reaching 4 dph, 100 all-male hybrid yellow catfish and ordinary hybrid yellow catfish are taken, and the same number of mixed fish are cultured in a culture box (0.60 m x 0.50 m x 0.35 m) to 30 dph, and 3 replicates are set. When reaching 30 dph, they are transferred to a glass tank (1.00 m x 0.60 m x 0.60 m) for culture to 60 dph, and then transferred to a circulating water system composed of circular culture barrels (diameter 3 m x water depth 1 m) for culture to 90 dph.

[0076] (3) Body weight measurement and gonad observation: when reaching 90 dph, the body weight of each hybrid yellow catfish in each culture barrel was measured and recorded, and the gonad development was observed by dissection, and the tail fin bar was preserved in anhydrous ethanol for identification, and one-to-one correspondence was achieved.

[0077] (4) Identification: the sample to be detected was detected by referring to the method steps in Example 2, the all-male hybrid yellow catfish was separated from the hybrid yellow catfish and numbered, and the body weight, survival rate and male proportion of the all-male hybrid yellow catfish and the hybrid yellow catfish in each culture barrel were statistically analyzed.

[0078] Result analysis: after 90 dph of co-culture comparison test, the average body weight, survival rate and male proportion of each culture barrel are shown in Table 3.

[0079] Table 3 Statistical analysis of body weight, survival rate and male proportion of all-male hybrid yellow catfish and ordinary hybrid yellow catfish in co-culture

[0080]

[0081] As can be seen from Table 3, the growth rate and survival rate of the all-male hybrid yellow catfish are 24.04% and 13.67% higher than those of the ordinary hybrid yellow catfish, respectively, the male proportion of the all-male hybrid yellow catfish is 100%, and the male proportion of the ordinary hybrid yellow catfish is 51.67%. Therefore, the economic traits of the all-male hybrid yellow catfish are better than those of the ordinary hybrid yellow catfish.

[0082] In summary, the method for creating all-male hybrid yellow catfish provided in the present application has a high male stability rate, and the growth rate and survival rate are also significantly higher than those of ordinary hybrid yellow catfish. The molecular marker provided in the present application can be used for the variety and economic traits of hybrid yellow catfish.

[0083] The present application has been described in detail above, and specific examples have been applied to the principle and implementation mode of the present application. The above description of the examples is only used to help understand the present application and the core idea. It should be noted that for ordinary skilled persons in the technical field, without departing from the principle of the present application, the present application can be improved and modified, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. A method for creating an all-male hybrid yellow catfish and a common hybrid yellow catfish, comprising the following steps: YY all-female yellow catfish were obtained by treating yellow catfish with genotype YY with estradiol; All-male hybrid yellow catfish were obtained through artificial breeding using common yellow catfish as the male parent and YY all-female yellow catfish as the female parent; Common hybrid yellow catfish were obtained by artificial breeding using common yellow catfish as the male parent and XX female yellow catfish as the female parent.

2. A molecular marker for identifying the sex of yellow catfish, said molecular marker comprising a nucleotide sequence as shown in SEQ ID NO.4, or having at least 90% sequence identity with SEQ ID NO.4, and capable of serving as a variant of a Y chromosome-specific marker for yellow catfish.

3. Primer pair for amplifying the molecular marker of claim 2, comprising: Forward primer: Nucleotide sequence as shown in SEQ ID NO.5; Reverse primer: The nucleotide sequence is shown in SEQ ID NO.

6.

4. A kit comprising the primer pair of claim 3.

5. A method for identifying all-male hybrid yellow catfish and hybrid yellow catfish, comprising the following steps: DNA samples were extracted from the hybrid yellow catfish to be tested; Using the DNA sample as a template, PCR amplification was performed using the primer pair shown in claim 3; The obtained PCR products were subjected to gel electrophoresis to determine the species of hybrid yellow catfish to be tested.

6. The method according to claim 5, wherein the method for determining the species of the hybrid yellow catfish to be detected is as follows: If a single band appears in the PCR amplification product in gel electrophoresis, the yellow catfish being tested is an all-male hybrid yellow catfish. If no band appears in the PCR amplification product in gel electrophoresis, the yellow catfish to be tested is a common hybrid yellow catfish.

7. The method according to claim 5, wherein the PCR amplification system is as follows: 2×TaqMasterMix 5 μL, Forward primer (10 μM) 0.5 μL, Reverse primer (10 μM) 0.5 μL, DNA template 1 μL, ddH2O 3 μL.

8. The method according to claim 5, wherein the PCR amplification procedure is as follows: Pre-denaturation: 95 °C, 3 min; 35 cycles: 95 °C, 25 s, 60 °C, 30 s, 72 °C, 15 s; extension: 72 °C, 5 min; store at 4 °C.

9. A method for comparing the economic traits of all-male hybrid yellow catfish and hybrid yellow catfish, comprising the following steps: Equal amounts of all-male hybrid yellow catfish and ordinary hybrid yellow catfish fry were mixed and stocked in the same breeding pond. After 2 to 4 months of co-culture in the same pond, the body length and weight of each hybrid yellow catfish were measured, and the corresponding tail fins were cut off. Identify all-male hybrid yellow catfish and common hybrid yellow catfish using the primer pair described in claim 3, the kit described in claim 4, and / or the method described in any of claims 5 to 8; Economic traits of all-male hybrid yellow catfish and common hybrid yellow catfish were statistically analyzed separately.

Images