Separation and screening of plant endophyte, preparation process of fermentation product and application of separation and screening of plant endophyte

By using the fermentation process of Candida sp. IGLS2, an endophytic fungus of Dendrobium officinale, the problem of similarity among fermented products has been solved, and a unique and high-potential fermented skin care raw material has been prepared, achieving the effects of inhibiting ROS and IL-6 secretion and promoting skin healing.

CN121538093APending Publication Date: 2026-02-17INGREDI BIOTECH CO LTD +2
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511713126.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-20
Publication Date
2026-02-17

AI Technical Summary

Technical Problem

The lack of effective methods for screening and fermenting plant endophytic bacteria in existing technologies leads to increased similarity among fermented products, making it difficult to develop unique and high-potential fermented skincare ingredients.

Method used

Fermentation was carried out using the endophytic fungus Candida sp. IGLS2 of Dendrobium officinale. Fermentation broth of Dendrobium officinale was prepared through specific fermentation conditions and processes, including the composition of the fermentation medium, pH value, temperature and inoculum size.

Benefits of technology

The prepared Dendrobium officinale fermentation broth has a lower molecular weight, significantly inhibits ROS and IL-6 secretion, promotes scratch healing, and has no effect on cell viability at high concentrations, making it suitable for preparing daily chemical products with anti-wrinkle and firming effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to a plant endophyte as well as a preparation process and application of a fermentation product of the plant endophyte, and in particular, the plant endophyte is dendrobium officinale endophyte candida Gandida sp. IGLS2, and the preservation number is CCTCC (China Center For Type Culture Collection) M20242143. The endophyte can be fermented to obtain dendrobium officinale fermentation liquor without an additional carbon source, dendrobium polysaccharides can be effectively degraded, biotransformation is achieved, in addition, compared with an unfermented dendrobium officinale extracting solution, the capacity of inhibiting ROS and IL-6 is effectively improved, the cell migration rate is remarkably improved, and the cell activity is not affected under high concentration.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation, specifically to the isolation and screening of plant endophytic bacteria, the preparation process of fermentation products, and their applications. Background Technology

[0002] Plant endophytes are microorganisms that live part or all of their life cycle within the tissues or organs and intercellular spaces of healthy plants, without causing plant diseases. Endophytes can promote plant growth under both normal and adverse conditions, thereby enhancing their tolerance to biotic and abiotic stresses. This is mainly manifested in improving the host plant's nutrient absorption efficiency, regulating relevant plant hormones, antagonizing plant pathogens, and inhibiting pathogens, thus indirectly promoting plant growth. In exchange, endophytes receive photosynthetic products as a carbon source and obtain a protected ecological niche. A close symbiotic relationship is formed between the two. Furthermore, plant endophytes live in a relatively stable internal environment, making it easier to discover uncultured microorganisms, which holds great research potential.

[0003] Medicinal plants themselves have specific effects and functions, and the endophytic bacteria they carry can also produce compounds with medicinal value and new natural products through research; or they can be used as biological control agents to reduce the threat of pests and diseases to medicinal plants, increase the yield of medicinal materials, and alleviate the obstacles of continuous cropping.

[0004] Orchidaceae includes a variety of medicinal plants, such as Dendrobium, Gastrodia elata, and Bletilla striata. Orchidaceae plants are highly dependent on endophytic bacteria for organic carbon and other nutrients, and their symbiotic relationship is extremely specialized compared to other seed plants. Dendrobium officinale is a herbaceous plant belonging to the genus Dendrobium in the Orchidaceae family, mainly distributed in Yunnan, Guizhou, and Guangdong provinces of my country. Studies have shown that Dendrobium officinale contains various active ingredients such as polysaccharides, polyphenols, flavonoids, and dendrobine, which can participate in the regulation of various physiological processes in the human body, including blood sugar, gut microbiota, oxidative stress, and tumorigenesis. Polysaccharides are the most abundant and most active components in Dendrobium officinale. They have a complex structure and large molecular weight, possessing multiple effects such as anti-oxidation, anti-tumor, and fatigue relief. However, their large molecular weight is not conducive to the effective utilization of Dendrobium's active ingredients by the skin.

[0005] Microorganisms can secrete abundant enzymes (such as cellulase, amylase, pectinase, and protease), promoting the release of raw material components and increasing the utilization rate of active ingredients in Dendrobium officinale. Microbial metabolic activities produce new active ingredients, giving the product stronger physiological activity and endowing it with new efficacy. With consumers' increasing demand for product safety and natural ingredients, the application of fermentation technology in cosmetics and skincare products is receiving increasing attention. Using endophytic fungi to ferment orchid plants can mimic the natural microecology of plants, promoting the generation of effective substances and providing a new research direction for the development of fermented cosmetics.

[0006] Commonly used microbial strains, after long-term screening and optimization, have gradually formed standardized production processes, leading to increased similarity among fermented products in the market. Naturally derived fermentation strains can provide new, high-potential starting strains for bioengineering and offer more diverse fermentation pathways for industrial production. Plant endophytes and skin microbes occupy similar ecological niches; this ecological similarity implies they share similar survival strategies and functions. In-depth research on plant endophytes can yield new fermentation strains or microorganisms, and by utilizing their unique adaptations to host plants, unique fermented plant metabolites can be developed, thereby enriching the variety of raw materials for fermented skincare products.

[0007] Currently, there is limited research on endophytic fungi in publicly available patents or literature; their applications are mainly in agricultural fields such as biological control and promoting plant growth. For example, CN202311709275.8 discloses a plant endophytic fungus (…). Paraphaeosphaeria sardoa The strain and its application in promoting plant growth: The application of the strain and its fermentation broth filtrate provided by this invention can achieve a significant growth-promoting effect.

[0008] Therefore, there is an urgent need to develop a screening and isolation method for plant endophytic bacteria in order to provide new species or strains. Summary of the Invention

[0009] The purpose of this invention is to provide a new endophytic bacterial strain and its fermentation product preparation method and application.

[0010] In a first aspect of the invention, an endophytic fungus is provided, said endophytic fungus being *Candida albicans*, an endophytic fungus of *Dendrobium officinale*. Gandida sp . IGLS2, accession number CCTCC M20242143.

[0011] In another preferred embodiment, the endophytes comprise an ITS rDNA sequence as shown in SEQ ID NO:1; and / or the endophytes comprise a 26S ITS rDNA nucleotide sequence as shown in SEQ ID NO:2.

[0012] The second aspect of the invention provides the use of the endophytic bacteria as described in the first aspect of the invention for preparing Dendrobium officinale fermentation broth.

[0013] In a third aspect of the present invention, a method for preparing Dendrobium officinale fermentation broth is provided, the method comprising the steps of: inoculating endophytic bacteria as described in the first aspect of the present invention into Dendrobium officinale fermentation culture broth to carry out fermentation, thereby obtaining Dendrobium officinale fermentation broth.

[0014] In another preferred embodiment, the method includes the steps of: An aqueous solution of Dendrobium officinale powder is called Dendrobium officinale fermentation culture medium. A culture medium containing endophytic bacteria as described in the first aspect of the present invention is added to the aqueous solution, and fermentation is carried out to obtain a fermentation culture. The fermentation culture was purified to obtain the Dendrobium officinale fermentation broth.

[0015] In another preferred embodiment, the method further has one or more features selected from the group consisting of: (1) In the fermentation culture medium of Dendrobium officinale, the mass ratio of Dendrobium officinale powder to purified water is 1:5-50, preferably 1:20-30; (2) The pH of the Dendrobium officinale fermentation culture medium is 5.5-8.0, preferably 6.0-7.5; (3) The inoculation volume of the endophytic bacteria culture medium to the volume ratio of the Dendrobium officinale fermentation medium is 1:0.01~0.05; (4) The endophytic bacteria culture medium contains ≥10 endophytic bacteria as described in the first aspect of the present invention. 5 CFU / mL; preferably 10 5 -10 10 CFU / mL.

[0016] In another preferred embodiment, the fermentation culture time is 1-10 days, more preferably 2-6 days.

[0017] In another preferred embodiment, the fermentation culture temperature is 10-50°C, more preferably 20-40°C.

[0018] In another preferred embodiment, the Dendrobium officinale fermentation culture medium includes Dendrobium officinale powder and purified water, wherein the Dendrobium officinale powder is obtained by crushing dried Dendrobium officinale through a pulverizer and sieving.

[0019] In another preferred embodiment, the Dendrobium officinale fermentation culture medium is obtained by mixing and sterilizing the components.

[0020] In another preferred embodiment, the inoculation amount of endophytic bacteria to the volume ratio of the Dendrobium officinale fermentation culture medium in the method is 1:0.01~0.03.

[0021] In another preferred embodiment, the endophytic activated bacterial culture is obtained by inoculating the preserved Candida albicans strain IGLS2 into PDB activation medium and activating it at 10-50°C for 2-60 hours.

[0022] In another preferred embodiment, the method further includes, after fermentation, performing sterilization and filtration operations in sequence to obtain Dendrobium officinale fermentation liquid.

[0023] In another preferred embodiment, the sterilization is high-temperature and high-pressure sterilization.

[0024] In another preferred embodiment, the filtration is positive pressure filtration using a microporous membrane.

[0025] In a fourth aspect of the invention, a Dendrobium officinale fermentation liquid is provided, which is obtained by the method described in the second aspect of the invention.

[0026] In another preferred embodiment, the Dendrobium officinale fermentation broth has one or more characteristics selected from the group consisting of: (1) Inhibits ROS secretion; (2) Promotes scratch healing; (3) Inhibits IL-6 secretion; (4) Number average molecular weight ≤ 100 kDa; preferably 50-100 kDa; (5) Weight-average molecular weight ≤ 300 kDa; preferably 200-300 kDa; (6) z-average molecular weight ≤ 600 kDa; preferably 300-400 kDa.

[0027] In another preferred embodiment, the Dendrobium officinale fermentation broth has no effect on cell viability at high concentrations.

[0028] In another preferred embodiment, the Dendrobium officinale fermentation broth at a concentration of 0.2% has an inhibitory effect on ROS secreted in a UVB-induced Hacat cell photoaging model.

[0029] In another preferred embodiment, the Dendrobium officinale fermentation broth has an ROS inhibition rate of 30-50% at a concentration of 0.2%, more preferably 35-45%.

[0030] In another preferred embodiment, the Dendrobium officinale fermentation broth, compared with Dendrobium officinale extract that has not been fermented by endophytic bacteria IGLS2, has a 20-30% higher ROS inhibition rate, more preferably 25-28%.

[0031] In another preferred embodiment, the Dendrobium officinale fermentation broth promotes healing of keratinocytes with scratch damage combined with LPS stimulation.

[0032] In another preferred embodiment, the scratch healing rate of the Dendrobium officinale fermentation broth at a concentration of 0.5% is 20-40%, more preferably 25-30%.

[0033] In another preferred embodiment, the Dendrobium officinale fermentation broth improves the cell scratch healing rate by 500-600%, more preferably by 530-580%, compared with Dendrobium officinale extract that has not been fermented by endophytic bacteria IGLS2.

[0034] In another preferred embodiment, the Dendrobium officinale fermentation broth has an inhibitory effect on IL-6 secreted by LPS-induced macrophage Raw 264.7 cells.

[0035] In another preferred embodiment, the Dendrobium officinale fermentation broth exhibits an IL-6 inhibition rate of 35-55% at a concentration of 0.0625%, more preferably 38-48%.

[0036] In another preferred embodiment, the Dendrobium officinale fermentation broth exhibits an IL-6 inhibition rate of 8-18% at a concentration of 0.0313%, more preferably 10-15%.

[0037] In another preferred embodiment, the Dendrobium officinale fermentation broth showed an IL-6 inhibition rate that was 20-40% higher than that of Dendrobium officinale extract that was not fermented by endophytic bacteria IGLS2, more preferably 25-30%.

[0038] In another preferred embodiment, the Dendrobium officinale fermentation broth includes organic acids and their derivatives, lipids and lipid-like molecules, organic heterocyclic compounds, benzene ring compounds, organic oxygen compounds, phenylpropanoid compounds, organic nitrogen compounds, alkaloids and their derivatives.

[0039] In another preferred embodiment, the proportion of organic acids and their derivatives in the Dendrobium officinale fermentation broth is 30-35%.

[0040] In another preferred embodiment, the proportion of lipids and lipid-like molecules in the Dendrobium officinale fermentation broth is 20-25%.

[0041] In another preferred embodiment, the proportion of organic heterocyclic compounds in the Dendrobium officinale fermentation broth is 15-20%.

[0042] The fifth aspect of the invention provides the use of Dendrobium officinale fermentation liquid as described in the fourth aspect of the invention, for the preparation of daily chemical or daily-use products with anti-wrinkle and firming effects.

[0043] In a sixth aspect of the present invention, a daily chemical product is provided, the daily chemical product comprising Dendrobium officinale fermentation liquid as described in the fourth aspect of the present invention as an active ingredient.

[0044] In another aspect, the present invention provides a method for screening endophytic bacteria as described in the first aspect of the present invention, the method comprising: (1) Select healthy Dendrobium plants as isolation samples; (2) Cut off disease-free and non-browning parts from the sample; (3) Rinse with tap water, disinfect with ethanol-water mixture, disinfect with mercury solution (or NaClO), then rinse with sterile water several times, and use sterile paper to absorb excess water; (4) Use a sterile knife to cut the cleaned sample into pieces, transfer the cut pieces to PDA medium for culture, and obtain pure culture, i.e., endophytic bacteria, after repeated four-zone streak purification culture.

[0045] In another preferred embodiment, the healthy Dendrobium plants in the screening method are healthy Dendrobium epiphytes that have not been artificially fertilized or treated with pesticides for 2-10 years.

[0046] In another preferred embodiment, the healthy Dendrobium plants in the screening method are selected from the following group: Dendrobium nobile, Dendrobium officinale, Dendrobium wingedum, Dendrobium nobile var. gloriosa, and Dendrobium dentata.

[0047] In another preferred embodiment, the disease-free and non-browning parts in the screening method are selected from the group consisting of: roots, stems, and leaves.

[0048] In another preferred embodiment, the rinsing time with tap water in the screening method is 5-60 minutes, more preferably 20-30 minutes.

[0049] In another preferred embodiment, the ethanol-water mixture in the screening method is a 60-80% v / v ethanol-water mixture.

[0050] In another preferred embodiment, the disinfection time of the ethanol-water mixture in the screening method is 5-100s, more preferably 20-60s.

[0051] In another preferred embodiment, the concentration of the mercuric chloride solution in the screening method is 0.1% (v / v).

[0052] In another preferred embodiment, the concentration of NaClO in the screening method is 3% (v / v).

[0053] In another preferred embodiment, the disinfection time of the mercury solution or NaClO solution in the screening method is 2-40 min, preferably 8-15 min.

[0054] In another preferred embodiment, the PDA culture medium temperature in the screening method is 15-50℃, more preferably 25-38℃.

[0055] In another preferred embodiment, the PDA culture medium in the screening method is cultured for 0.5-10 days, more preferably 1-3 days.

[0056] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0057] Figure 1This is a 26S DNA phylogenetic tree of the Candida IGLS2 strain and related strains in Example 3.

[0058] Figure 2 This is a colony morphology diagram of IGLS2 in Example 4.

[0059] Figure 3 This is a microscopic observation of IGLS2 cells in Example 4.

[0060] Figure 4 The effect of IGLS2 fermentation filtrate on Hacat cell viability is shown in Test Case 1.

[0061] Figure 5 The effect of IGLS2 fermentation filtrate on ROS secretion is shown in test case 2.

[0062] Figure 6 The effect of Dendrobium officinale extract on ROS secretion was shown in test case 2.

[0063] Figure 7 The effects of Dendrobium officinale extract and Dendrobium officinale fermentation broth on scratch healing rate were shown in test case 3.

[0064] Figure 8 The effects of Dendrobium officinale extract and Dendrobium officinale fermentation broth on IL-6 secretion by cells were shown in test case 4.

[0065] Figure 9 The metabolomics characteristics of the fermentation filtrate of Dendrobium officinale are shown. Detailed Implementation

[0066] Through extensive and in-depth research, and through numerous screenings and tests, the inventors have provided a process for isolating and screening plant endophytic bacteria, preparing fermentation products, and their applications. The plant endophytic bacteria described are *Candida albicans*, an endophytic fungus found in *Dendrobium officinale*. Gandida sp. IGLS2. The endophytic bacteria can ferment Dendrobium officinale fermentation broth without the need for an external carbon source, effectively degrading Dendrobium officinale polysaccharides. The resulting Dendrobium officinale fermentation broth has a lower molecular weight and can enhance ROS secretion and IL-6 inhibition effects, without affecting cell viability at high concentrations. Based on this, the present invention was completed.

[0067] sequence list ITS rDNA sequence SEQ ID NO: 1 GCTTTATTACAATACTTACATGATTTTGTCAACACAACAACCAAACATTATTATTCAATAACACTTAAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAATCTTTGAACGCACATTGC GCCTTGAGGTATTCCTCAAGGCATGCCTGTTTGAGCGTCGGCTCCCTTCAAACCTTCCGGTTTTGGCTTTGCCTTCAGAAATATCAGAAACTCATGCAATTACGTTACATTTGTTTCCACTTTTTCGCCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGAAA 26S ITS rDNA sequence SEQ ID NO: 2 CAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCCCCCGGGGAATTGTAATTTGAAGGAGGAATGGTTTGGCGTTGCGCACTTCAAAGTCCCTTGGAACAGGGCGCCTTAGAGGGTGAGAGCCCCGTATGGAGTGTTGCAGTGTCTTTTTGCTGTTCCCCCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAG CTAAATACCGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACGGTCCTCGTGGCCGGGCCAGCATCGGTTGCCAGGGGTGGATAAGGCGGCAGGAATGTAGCTCACTGAGTATTATATCCTGCTGAGATACACCCACCGGCGACCGAGGCCTGCGATTCGT the term Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0068] As used herein, when referring to a specific enumerated value, the term “about” means that the value can vary by no more than 1% from the enumerated values. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0069] As used herein, the terms “containing” or “including (comprise)” can be open-ended, semi-closed, or closed. In other words, the terms also include “consistently made of” or “composed of”.

[0070] As used in this article, the terms "room temperature" or "normal temperature" refer to a temperature between 4 and 40 degrees Celsius. o C, preferably, 25±5 o C.

[0071] As used herein, the term "PDB medium" or "PDB activated medium" refers to potato extract-glucose-water medium. It is commonly used for culturing and propagating fungi and yeasts, and its main components include potato extract, glucose, and water.

[0072] As used herein, the terms “Dendrobium officinale fermentation liquid” or “fermentation liquid” or “Dendrobium officinale fermentation liquid S1” or “IGLS2 fermentation filtrate” and the “Dendrobium officinale fermentation” in the figure captions of the accompanying drawings all refer to Dendrobium officinale liquid obtained by fermentation with endophytic bacteria IGLS2, and the exemplary operating steps are as described in Example 5.

[0073] As used herein, the terms “Dendrobium officinale extract” or “extract” or “Dendrobium officinale extract C1” and the “Dendrobium officinale unfermented” or “Dendrobium officinale unfermented” in the figure captions of the accompanying drawings all refer to Dendrobium officinale extract obtained without fermentation using endophytic bacteria IGLS2, and with all other steps being exactly the same as those used in the preparation of fermentation broth. The exemplary operating steps are as described in Comparative Example 6.

[0074] The main advantages of this invention include: (1) The present invention provides a new strain of plant endophytic bacteria and a screening method thereof. The new strain of plant endophytic bacteria is obtained under natural conditions, is of non-genetic engineering origin, and has environmentally friendly characteristics.

[0075] (2) The new strain provided by the present invention can effectively degrade Dendrobium polysaccharide without the need for additional carbon source, thus achieving biotransformation.

[0076] (3) The new strain provided by this invention can be used to ferment Dendrobium officinale. The fermented Dendrobium officinale filtrate obtained has Hacat cell viability >90% at a concentration of 1.0%, and has no significant effect on Hacat cell viability, indicating a high safe concentration. When the addition amount is ≥0.2% (W / W), it can significantly inhibit intracellular ROS secretion, with a significantly stronger effect than the Dendrobium officinale extract that has not undergone fermentation, and has firming and anti-wrinkle effects.

[0077] The invention is further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0078] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the methods of this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0079] Example 1: Isolation and Screening of Endophytic Bacteria Healthy Dendrobium plants (including but not limited to Dendrobium nobile, Dendrobium officinale, Dendrobium wingedum, Dendrobium nobile var. gloriosa, and Dendrobium dentata) that grew on trees and were not artificially fertilized or treated with pesticides within 5-7 years, were selected as isolation samples from Dendrobium planting bases in Yunnan Province.

[0080] Cut disease-free and non-browning parts (roots, stems, and leaves) from the sample, rinse with tap water for 20-30 minutes to remove surface debris, disinfect with 75% ethanol for 20-60 seconds, disinfect with 0.1% (v / v) mercuric chloride solution (or 3% NaClO, v / v) for 8-15 minutes, then rinse with sterile water 6-10 times and absorb excess water with sterile paper.

[0081] The cleaned sample was cut into 0.2-1cm pieces using a sterile scalpel. 3 The samples were cut into blocks and transferred to PDA medium. After incubation at 25-38℃ for 1-3 days, endophytic bacteria were preliminarily classified by morphological observation. After 2-3 repeated streak purification cultures in four zones, pure cultures were obtained. After molecular biological identification, the endophytic bacteria IGLS2 was identified as a new species. The identification process will be described later.

[0082] Example 2: Molecular biological identification (ITS sequence) of endophytic bacteria IGLS2 Genomic DNA was extracted from the pure culture using a kit, and ITS rDNA amplification was performed. The amplification products were detected by 1% agarose gel electrophoresis. Qualified samples were sent for sequencing, and the sequencing results contained endophytic molecular markers, such as SEQ ID NO:1. Sequence alignment with a professional database based on the NCBI database was performed, and the strain was preliminarily identified as Candida albicans. Candida The ITS rDNA nucleotide sequence of IGLS2 is shown in SEQ ID NO:1. After identification, single colonies were picked, numbered, and expanded in PDB medium, then stored at low temperature with glycerol.

[0083] Example 3: Identification of IGLS2 by Molecular Biology (26S Sequence Phylogenetic Analysis) Genomic DNA was extracted from the pure cultures using a kit, and 26S rDNA gene sequencing was performed. The amplified products were detected by 1% agarose gel electrophoresis. Qualified samples were sent for further sequencing. The sequencing results contained the molecular markers of the new strain, and sequence alignment was performed with a professional database based on the NCBI database. The 26S ITS rDNA nucleotide sequence of *Candida* strain IGLS2 is shown in SEQ ID NO:2. Phylogenetic analysis was performed using the above sequence. The results are as follows: Figure 1 As shown, the Candida species IGLS2 belongs to a different branch than other species, proving that this species is a potential new species of the Candida genus.

[0084] Example 4: Morphological identification using IGLS2 IGLS2 bacteria were inoculated into MEA medium and cultured at 28°C for 72 h. The results are as follows: Figure 2 As shown, IGLS2 colonies are flat, white, creamy, viscous, and reflective. Microscopic observation yielded the following results: Figure 3 As shown, IGLS2 cells are oval or ovoid, solitary or paired, budding, and the diameter of a single cell is 2.5-7×3-9μm.

[0085] This Candida ( Candida The strain IGLS2 (sp.) was deposited at the China Center for Type Culture Collection on October 8, 2024, with accession number CCTCCM 20242143.

[0086] Example 5 of IGLS2 application: Preparation of IGLS2 fermentation filtrate Dried Dendrobium officinale was pulverized using a pulverizer and passed through a 25-mesh sieve to obtain Dendrobium officinale powder. The ratio of Dendrobium officinale powder to purified water was 1:25, and the pH of the system was adjusted to 6.0-7.5. The mixture was then sterilized at 121℃ under high temperature and pressure for 20 min to obtain the fermentation culture medium. The preserved Candida albicans strain IGLS2 was inoculated into PDB activation medium and activated at 30℃ for 18-30 h, yielding a bacterial count of 10... 5 The activated bacterial culture solution with a concentration of CFU / mL or higher was inoculated into the Dendrobium officinale fermentation broth, wherein the total inoculation volume of the bacterial culture solution was 2% of the volume of the Dendrobium officinale fermentation broth. The culture was fermented at 30℃ for 4 days. The culture was then sterilized at 121℃ under high pressure for 20 min and filtered under positive pressure using a filter membrane with a pore size of 0.45 μm to obtain Dendrobium officinale fermentation filtrate S1.

[0087] Comparative Example 6: Preparation of Dendrobium officinale extract After drying, *Dendrobium officinale* was pulverized using a pulverizer and passed through a 25-mesh sieve to obtain *Dendrobium officinale* powder. The ratio of *Dendrobium officinale* powder to purified water was 1:25, and the pH of the system was adjusted to 6.0-7.5. The mixture was then sterilized at 121℃ under high temperature and pressure for 20 min to obtain the fermentation broth. The sterilized PDB medium was inoculated into the *Dendrobium officinale* fermentation broth, with a volume ratio of PDB medium to *Dendrobium officinale* fermentation medium of 2%. The mixture was allowed to stand at 30℃ for 4 days, then sterilized at 121℃ under high temperature and pressure for 20 min. The mixture was then filtered through a 0.45 μm pore size filter under positive pressure to obtain *Dendrobium officinale* extract C1.

[0088] Example 7: Determination of Polysaccharide Molecular Weight in Fermentation Broth and Extract The filtrate obtained in Example 13 and the extract from Example 14 were freeze-dried to obtain a freeze-dried sample. The sample was dissolved in a 0.1M NaNO3 aqueous solution (containing 0.02% NaN3, w / w) to a final concentration of 1 mg / mL, and filtered through a 0.45 μm filter before analysis. The chromatographic system used was a gel permeation chromatography-differential chromatography-multi-angle laser light scattering system, with a U3000 liquid chromatography system (Thermo, USA), an Optilab T-rEX differential detector (Wyatt technology, CA, USA), and a DAWN HELEOS II laser light scattering detector (Wyatt technology, CA, USA).

[0089] The specific chromatographic column and elution conditions were as follows: Ohpak SB-805 HQ (300×8mm) and Ohpak SB-803 HQ (300×8mm) gel size exclusion columns were used in series. The column temperature was 45℃, the injection volume was 100 μL, the mobile phase was A (0.02% NaN3, 0.1M NaNO3), the flow rate was 0.6 mL / min, and the elution gradient was isocratic for 75 min.

[0090] The results of the polysaccharide molecular weight determination are shown in Table 1. The number-average molecular weight, weight-average molecular weight, and z-average molecular weight of the IGLS2 fermentation filtrate were lower than those of Dendrobium officinale extract, indicating that the Candida IGLS2 strain can effectively reduce the molecular weight of Dendrobium officinale polysaccharides and has biotransformation capabilities.

[0091] Table 1. Comparison of polysaccharide molecular weights between IGLS2 fermentation filtrate and Dendrobium officinale extract. Test Case 1: Determination of the maximum safe concentration of Dendrobium officinale fermentation filtrate obtained by IGLS2 fermentation using the MTT method The cell density was adjusted to 1×10⁻⁶. 5 Cells were seeded at a rate of 200 μL per well into 96-well plates and incubated at 37°C (5% CO2). After 24 h, the 96-well plates were removed, the old culture medium was discarded, and 200 μL of basal culture medium was added to each well of the zero-adjustment well and the blank control group. 200 μL of *Dendrobium officinale* fermentation filtrate S1 prepared with basal culture medium was added to each well of the experimental group. Cells were arranged in triplicate for each concentration group. Specific concentration groupings can be found in [reference needed]. Figure 4 Then, the plate was returned to the incubator for further incubation (37℃, 5% CO2). After 24 h of drug treatment, the 96-well plate was removed, and 20 μL of MTT working solution (5 mg / mL) was added to each well. The plate was then returned to the incubator for another 4 h of incubation. The liquid in the wells was then discarded, and 150 μL of DMSO was added to each well. After shaking for 10 min, the absorbance (OD value) was measured at a wavelength of 490 nm.

[0092] Specific test results are as follows: Figure 4 As shown, at a high concentration (1.0%), the Hacat cell viability of the fermentation filtrate was >90%, indicating that the fermentation filtrate of Dendrobium officinale obtained by IGLS2 fermentation is safe and non-irritating to cells or tissues.

[0093] Test Case 2: Experiment on the inhibitory activity of Dendrobium officinale fermentation filtrate obtained from IGLS2 fermentation on ROS secretion by cells. This experiment used UVB as an exogenous oxidant to induce an increase in ROS content in human keratinocytes as a photoaging cell model. The expression intensity of reactive oxygen species (ROS) was characterized by comparing the changes in fluorescence intensity of the fluorescent dye DCFH-DA in cells of each experimental group, thereby evaluating the effect of the samples on reactive oxygen species.

[0094] The experimental procedure is as follows: 1. Seeding: When cell density is ≥70%, digest with trypsin, resuspend, centrifuge for 4 min, and discard the supernatant. Add 1 mL of complete culture medium, mix well by pipetting, dilute, and count the cells to adjust the cell density to 1 x 10⁻⁶. 5 Cells / mL, seed 1000 μL into 24-well plates and incubate at 37°C with 5% CO2.

[0095] 2. Experimental grouping: 4 replicates per group for each concentration.

[0096] 3. Solution preparation: Select the sample concentration based on the cell viability test results and prepare the sample solution; VE acetate (200 μg / mL) is used as a positive control.

[0097] 4. Drug administration: 24 hours later, discard the old culture medium and add sample solutions according to the group. The blank control group and NC group are given basal culture medium, the PC group is given VE acetate, and the experimental group is given the corresponding concentration of sample. Culture at 37℃ and 5% CO2.

[0098] 5. UVB irradiation: 24 hours later, the NC group, PC group, and experimental group were irradiated with 15 mJ / cm². 2 UVB and BC groups were not irradiated. After 30 minutes, they were returned to the incubator.

[0099] 6. ROS detection: Incubate with DCFH-DA probe for 30 min, wash with PBS, digest cells with trypsin, collect by centrifugation, resuspend and add to 96-well plate, and detect fluorescence intensity using a fluorescence microplate reader (525nm incident light, 488nm excitation light).

[0100] 7. Results Analysis: ROS fluorescence intensity was summarized, plotted using GraphPad Prism, and analyzed using a T-test. #P < 0.05, ##P < 0.01, and ###P < 0.001 indicated significant differences. Specific test results are as follows... Figure 5 As shown, at a concentration of 0.2%, the fermentation filtrate S1 of *Dendrobium officinale* significantly inhibited the secretion of ROS in the UVB-induced Hacat cell photoaging model, with an inhibition rate of 49.73% (###P<0.001), indicating that at this concentration, it can exert a firming and anti-wrinkle effect by inhibiting / reducing the production of reactive oxygen species (ROS). The specific test results of the *Dendrobium officinale* extract C1 (extract of *Dendrobium officinale* without fermentation by endophytic bacteria IGLS2) obtained in Comparative Example 6 are as follows... Figure 6 As shown, at a concentration of 0.2%, Dendrobium officinale extract inhibited the secretion of ROS in the UVB-induced Hacat cell photoaging model, with an inhibition rate of 39.39% (###P<0.001), indicating that at this concentration, it can exert a firming and anti-wrinkle effect by inhibiting / reducing the production of reactive oxygen species (ROS).

[0101] By comparing the test results of Dendrobium officinale fermentation filtrate S1 obtained by fermentation with endophytic bacteria IGLS2 and Dendrobium officinale extract C1 obtained by fermentation without endophytic bacteria IGLS2, it was found that fermentation with Candida IGLS2 could increase the ROS inhibition rate of Dendrobium officinale by 26.25%. The inhibition rate increase was calculated as follows: (ROS inhibition rate of Dendrobium officinale fermentation filtrate - ROS inhibition rate of unfermented control) / ROS inhibition rate of unfermented control.

[0102] Test Case 3: Cell scratch healing experiment using the fermentation filtrate of Dendrobium officinale obtained by IGLS2 fermentation. When cells grow to the point of fusing into a monolayer, an artificially created blank area, called a "scratch," is created on the fused monolayer. Simultaneously, the inflammatory substance lipopolysaccharide is applied to stimulate the scratch, mimicking the skin injury process. Cells at the edge of the scratch gradually enter the blank area, causing the "scratch" to heal, simulating the skin damage repair process. This experiment evaluates the repair effect of the sample on scratch damage by testing the "scratch" healing rate.

[0103] When the cell density reaches 70% or higher, wash the cells 1-3 times with 2-3 mL of PBS, then add 2 mL of 0.25% trypsin to digest the cells and return them to a 37°C incubator for 10 minutes. After digestion, pipette the cells until resuspended, centrifuge at 1000 rpm for 4 minutes, discard the supernatant, add 1 mL of MEM complete culture medium, mix well, and adjust the cell density to 3.5 × 10⁻⁶ cells based on the cell count results. 5Cells / mL, ready for use. Next, take out the 6-well plate and use a marker and ruler to draw horizontal lines evenly on the back, one line every 0.5 cm, for a total of three lines, crossing all three lines in each well. Add 2 mL of cell suspension to each well and return to the incubator for further culture. After 24 hours, discard the culture medium in the wells, add 2 mL of MEM basal medium to each well, and return to the incubator for further culture. After changing the medium, discard the old culture medium, add 1 mL of PBS to each well, and use a 200 μL pipette tip to make three cuts perpendicular to the horizontal lines on the back of each well. Rinse the cells three times with PBS to remove cell debris, and then photograph the cuts under a microscope as the cell cuts at 0 hours, with 9 photographic points per well. Based on the cell viability test results, select an appropriate sample concentration and prepare the test samples, using TGF-β1 (100 ng / mL) as a positive control. The blank control group received 2 mL of MEM basal medium per well, without LPS; the negative control group received 1.99 mL of MEM basal medium and 10 μL of 200 μg / mL LPS per well; the positive control group received 1.99 mL of TGF-β1 (100 ng / mL) prepared in MEM basal medium and 10 μL of 200 μg / mL LPS per well; the experimental group received 1.99 mL of the test solution and 10 μL of 200 μg / mL LPS per well. Each concentration in each group was tested in duplicate. The experimental groups are shown in Table 2.

[0104] Table 2 Experimental Groups Cell scratch images were taken under a microscope at 0 and 24 hours after drug application to record changes in the scratches. Finally, Image Pro Plus was used to analyze the cell scratches, calculate the scratch area at 0 and 24 hours, and calculate the scratch healing rate using a formula. 24-hour scratch healing rate % = Specific test results are as follows: Figure 7 As shown, at a concentration of 0.5%, the fermentation filtrate S1 of Dendrobium officinale promoted the healing of keratinocytes with scratch damage combined with LPS stimulation, and the scratch healing rate was 27.38% (###P<0.001).

[0105] Compared with the negative control group (NC), the cell migration rate of Dendrobium officinale extract C1 obtained in Comparative Example 6 at a concentration of 0.5% was not significantly increased (P>0.05), and the scratch healing rate was 4.23%, indicating that it did not have the effect of promoting healing.

[0106] By comparing the test results of Dendrobium officinale fermentation filtrate S1 obtained by fermentation with endophytic bacteria IGLS2 and Dendrobium officinale extract C1 obtained by non-fermentation with endophytic bacteria IGLS2, it was found that fermentation with Candida IGLS2 could increase the cell scratch healing rate of Dendrobium officinale by 547.28%. The scratch healing rate increase rate was calculated as follows: (Scratch healing rate of Dendrobium officinale fermentation filtrate - Scratch healing rate of non-fermented control) / Scratch healing rate of non-fermented control.

[0107] Test Case 4: Experiment on the inhibitory activity of Dendrobium officinale fermentation filtrate obtained from IGLS2 fermentation on IL-6 secretion by cells. This experiment used an LPS-induced mouse macrophage (RAW264.7) inflammation model to determine the inhibitory effect of the sample on IL-6, thereby reflecting the soothing efficacy of the sample.

[0108] When the cell density reaches 70% or higher, discard the culture medium and wash the cells with PBS. Then, resuspend the cells in 4 mL of DMEM basal medium and transfer them to a 2 mL centrifuge tube. Centrifuge at 1000 rpm for 4 minutes and discard the supernatant. Next, add 1 mL of complete culture medium, mix thoroughly, dilute the cells to an appropriate concentration, and count them. Adjust the cell density to 8 × 10⁶ cells / mL. 4 Cells / mL were seeded at a volume of 200 μL per well into 96-well plates and incubated. According to Experimental Grouping Table 3, three cell-free wells were designated as the zero-control group, and each concentration in each group was replicated in four wells. When preparing the culture medium, appropriate sample concentrations were selected based on cell viability test results, with dexamethasone (100 μg / mL) used as a positive control. After 24 hours, the old culture medium was discarded, and 180 μL of sample or culture medium (dexamethasone was used for the positive control group) was added to each well according to the experimental group concentration. The plates were then incubated for 1 hour. After 1 hour, the 96-well plates were removed. 20 μL of basal culture medium was added to each well of the zero-control and blank control groups, and 20 μL of LPS (10 μg / mL) was added to each well of the negative control, positive control, and experimental groups. Incubation continued. After 24 hours, the cell supernatant from each group was collected into centrifuge tubes, centrifuged at 1000 rpm for 10 minutes, and the supernatant was transferred to 1.5 mL centrifuge tubes and stored at -20°C. Finally, the concentration of IL-6 in the cell supernatant was determined using an ELISA kit according to the instructions. The experimental concentration design is shown in Table 3.

[0109] Table 3 Experimental Concentration Design Specific test results are as follows: Figure 8As shown, at a concentration of 0.0625%, the fermentation filtrate S1 of Dendrobium officinale inhibited the secretion of IL-6 by LPS-induced macrophage Raw 264.7 cells, with an IL-6 inhibition rate of 44.30% (###P<0.001), indicating that it can have a soothing effect at this concentration.

[0110] At a concentration of 0.0625%, Dendrobium officinale extract C1 inhibited the secretion of IL-6 by LPS-induced macrophage Raw 264.7 cells, with an IL-6 inhibition rate of 14.15% (###P<0.001), indicating that it can have a soothing effect at this concentration.

[0111] The test results above show that the endophytic bacteria IGLS2 fermentation significantly enhances the inhibitory effect of Dendrobium officinale on IL-6. At the same effective concentration of 0.625%, the inhibition rate of IL-6 is 28.445% higher than that of the unfermented extract, indicating that the endophytic bacteria IGLS2 fermentation can significantly enhance the anti-inflammatory activity of Dendrobium officinale.

[0112] Test Case 5: Metabolomic Characteristics of Dendrobium officinale Fermentation Filtrate Obtained by IGLS2 Fermentation The fermentation filtrate S1 of *Dendrobium officinale* was analyzed using metabolomics. The analysis employed a locally built database and public databases (Human Metabolome Database (HMDB) (http: / / www.hmdb.ca), Metlin (http: / / metlin.scripps.edu), MassBank (http: / / www.massbank.jp / ), and mzcloud (https: / / www.mzcloud.org)). The results were matched with information in these databases regarding metabolite retention time, molecular weight, secondary fragmentation spectra, and collision energies to identify the structures of metabolites in the biological sample. The identification results underwent rigorous manual verification and confirmation. The identification level was Level 2 or higher. All identified metabolites were classified and statistically analyzed according to their chemical classification information. The proportion of each metabolite category was displayed using a pie chart, with the class level selected for each category.

[0113] Metabolomics characteristics of Dendrobium officinale fermentation filtrate, such as Figure 9As shown, the composition of the *Dendrobium officinale* fermentation filtrate is as follows: organic acids and their derivatives account for 31.6%, lipids and lipid-like molecules account for 21.9%, organic heterocyclic compounds account for 18.0%, benzene ring compounds account for 11.8%, organic oxygen compounds account for 6.0%, phenylpropanoids account for 4.7%, organic nitrogen compounds account for 3.9%, alkaloids and their derivatives account for 1.5%, and others account for 0.5%. It can be seen that the fermentation filtrate of *Dendrobium officinale* is mainly composed of organic acids and their derivatives, lipids and lipid-like molecules, and organic heterocyclic compounds, which together account for over 70%. It also contains various other types of active ingredients. This complexity of composition provides a solid material basis for developing its anti-wrinkle, firming, antioxidant, and anti-inflammatory effects in the cosmetics field.

[0114] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. An endophytic bacterium, characterized in that, The endophytic bacteria are *Candida albicans*, an endophytic fungus of *Dendrobium officinale*. Gandida sp . IGLS2, accession number CCTCC M20242143.

2. The endophytic bacteria as described in claim 1, characterized in that, The endophytes contain an ITS rDNA sequence as shown in SEQ ID NO:1; and / or the endophytes contain a 26S ITS rDNA nucleotide sequence as shown in SEQ ID NO:

2.

3. The use of the endophytic bacteria as described in claim 1, characterized in that, It is used to prepare Dendrobium officinale fermentation broth.

4. A method for preparing Dendrobium officinale fermentation broth, characterized in that, The process includes the following steps: inoculating the endophytic bacteria as described in claim 1 into the Dendrobium officinale fermentation culture medium, thereby fermenting and obtaining the Dendrobium officinale fermentation broth.

5. The preparation method according to claim 4, characterized in that, The method includes the following steps: An aqueous solution of Dendrobium officinale powder is called Dendrobium officinale fermentation culture medium. A culture medium containing the endophytic bacteria as described in claim 1 is added to the aqueous solution, and fermentation is carried out to obtain a fermentation culture. The fermentation culture was purified to obtain the Dendrobium officinale fermentation broth.

6. The preparation method according to claim 4, characterized in that, It also has one or more features selected from the following group: (1) In the fermentation culture medium of Dendrobium officinale, the mass ratio of Dendrobium officinale powder to purified water is 1:5-50, preferably 1:20-30; (2) The pH of the Dendrobium officinale fermentation culture medium is 5.5-8.0, preferably 6.0-7.5; (3) The inoculation volume of the endophytic bacteria culture medium to the volume ratio of the Dendrobium officinale fermentation medium is 1:0.01~0.05; (4) The endophytic bacteria culture medium contains ≥10% endophytic bacteria as described in claim 1. 5 CFU / mL; preferably 10 5 -10 10 CFU / mL.

7. A Dendrobium officinale fermentation liquid, characterized in that, The fermentation broth is obtained using the method described in any one of claims 4-6.

8. The Dendrobium officinale fermentation liquid as described in claim 7, characterized in that, The Dendrobium officinale fermentation broth has one or more characteristics selected from the group below: (1) Inhibits ROS secretion; (2) Promotes scratch healing; (3) Inhibits IL-6 secretion; (4) Number average molecular weight ≤ 100 kDa; preferably 50-100 kDa; (5) Weight-average molecular weight ≤ 300 kDa; preferably 200-300 kDa; (6) z-average molecular weight ≤ 600 kDa; preferably 300-400 kDa.

9. The use of the Dendrobium officinale fermentation liquid as described in claim 7, characterized in that, Used to prepare daily chemical or everyday products with anti-wrinkle and firming effects.

10. A daily chemical product, characterized in that, The aforementioned daily chemical products include Dendrobium officinale fermentation liquid as described in claim 7 as an active ingredient.

Citation Information

Patent Citations

  • A plant endophytic fungus and its application in plant growth promotion

    CN117683644B